Fenitothion Degradation by Aspergillus parasiticus

Abstract

India is a predominantly agriculture-based country with a population of 1.27 billion, according to FAO the population has reached to 1.66 billion in between 2007 and 2050. Tense because of overgrowing population the yield of crops were increased by applying various insecticides for controlling (insects, pests). Globally, an appraise 1 to 2.5 million tons of effective insecticide additives go on applied each year, especially in agriculture. Fenitrothion is an organophosphate insecticide employed to destroy pests, insects particularly in Paddy fields and it is an acetylcholinesterase inhibitor, neurotoxicant and the toxic metabolites in the environment is remain for longer periods, so it is necessary to degrade the fenitrothion by biodegradation. The fungi Aspergillus parasiticus were screened from paddy fields and Molecular characterized it by 26S rDNA gene sequencing, the fungi breaks the insecticide within 24 h of incubation in PDB. The course of the degradation process was studied using FTIR and HPLC.

1. Introduction

Extensive dimensions of insecticides make employment toward agriculture everywhere in the universe [1]. Organophosphates (OPs) remain a class of insecticides, certain of which are extremely toxic. Organophosphorus composite poisoning is a global health obstacle among nearby 3 million poisonings furthermore 200 000 deaths periodically [2]. The primary organophosphorus insecticide, tetraethyl pyrophosphate, did originate furthermore employed near 1937. They were among the numerous extensively applied insecticides available. Organophosphates (also known as phosphate esters, or OPEs) are a group regarding organophosphorus compounds besides the global edifice O=P(OR)_3, a prime phosphate particle including alkyl or aromatic substituents.

Most utmost of the organophosphorus insecticides enhance relevent universal composition, comprising 3 phosphoester linkages, plus hydrolysis concerning one of the phosphoester bonds dramatically diminishes the toxicity regarding comic insecticides by eliminating their acetylcholinesterase–inactivating properties [3] fenitrothion [O, O-dimethyl O- (3-methyl-4-nitrophenyl) phosphorothioate] stands one of the various broadly utilized broad-spectrum organophosphate insecticide, an acaricide is exercised to slaughter pests like piercing, crunch, and suctorial insect pests (bugs of wheat, beetles of flour, grain, stem borers of rice, Weevils of grain) usually acts on rice, cereals, grasp, greens, further applied as a mosquito, sail, cockroach repellents, sprays as fields and society curriculum, and can do grasped through each route, including inhaling, ingestion, plus dermal intake, comic toxicological effect as concerns comic insecticide fenitrothion is about entirely due to comic repression of acetylcholinesterase in the nervous system, emerging against respiratory, myocardial and neuromuscular transmission impairment, and comic toxic metabolites in the environment remain for more sustained periods, because of this inference fenitrothion is degraded by employing microorganisms.

The extreme degradation product of fenitrothion is 3-methyl-4-nitrophenol and induces extensive corruption in soils and the aquatic environment.

Fenitrothion degradation proceeds through hydrolysis & photolysis under sunlight (or) UVR, microflora further impersonates a very important role in degradation, fenitrothion in water is stable when microorganisms, sunlight is not an available form, in soil mainline of degradation is the biodegradation [4].

In the degradation of fenitrothion the biological spp. namely Anthrobacter aurescens, Burkholderia, Rhizobium, Flavobacterium, Chlorella, Pseudomonas operate vital activity.

Genes of particular are abode culpable for the degradation of insecticides, several practicable organisms able of cleavage diverse sort of organophosphates has been screened and characterized from various slots. The vastly optimistic way for the degradation of organophosphate insecticides are enzymatic mechanisms, of extracellular, hydrolase of organophosphorus (OPH) has being a classic enzyme with capable to resolve a vast array of organophosphorus pesticide and chemical combat determinants.

Organophosphate hydrolase along with MPD, OPD, MPH, etc. regard to organophosphorus hydrolase group. Organophosphorus hydrolase has the highest exercise along with wide-ranging for the abrupt withdrawal out of organophosphates. Along with this parathion hydrolase, paraoxonase, esterase, phosphotriesterase, and diisopropyl fluorophosphatase [5] also display the pivotal part in fenitrothion degradation. Pakala [6] identified the bacterial species namely Serratia, which is responsible for the deterioration of Parathion by Parathion hydrolase and also reducing the nitro group by nitroreductase.

Bioremediation is the process of applying biological systems of diminution in regard to contaminants of aquatic, sublunary or from the wind. The major biological systems applied for Bioremediation are naturally or premeditatively microorganisms and plants. The most frequently applying method for Biodegradation is bioremediation with microorganisms. The present universal proceedings of bioremediation that comprise bioengineering tense potential of innate microbes to clear up comic habitat are compelling different to prevalent rendition methods [7].

Fungi, bacteria acts as the cheaper, excel environment friendlier option in deterioration referring to insecticides of organophosphates, biological process form different metabolites in fenitrothion degradation. Biodegradation was effective in the treatment of this pollution in a eco-friendly manner.

In the present study, a novel fungal Aspergillus Parasiticus capable as concerns deteriorating not justly fenitrothion but also 3-methyl-4-nitrophenol was isolated. Biodegradation of fenitrothion in Czepak-dox medium was studied. Tense research directs toward elucidating per probable employment of an isolated fungal strain toward remediation as concerns comic fenitrothion-contaminated environment.

2. Materials and methods

2.1 Chemicals

Analytical grade fenitrothion (50% ec) were purchased from Shijiazhuang Awiner Biotech Co., Ltd., China and were employed as standard. Technical grade fenitrothion a 20% emulsifiable concentrate used in this study were obtained from Chennai local market, India. All additional reagents applied in this study were of high purity and analytical grade.

2.2 Soil sample

Paddy soils were taken away from the agriculture field regarding Pakala, Chittoor District, Andra Pradesh, with a sustain cultivation exercise as well as Thirty years. Exterior clay of 0–15 cm was levelheaded, stored currently in elastic pouches, transferred these particulates directed toward the lab [8]. The paddy clay was drained at room temperature, restrained the wateriness contentment by about 20% (W/W), besides, the paddy clay is transpired over a bowl-shaped sieve alongside a 2 mm net, physicochemical parameters of the test clay was assayed, detailed physicochemical parameters of the soil are presented in Table 1.

Parameters	Soil
Sand (%)	50%
Silt (%)	20%
Clay (%)	27%
Organic matter (%)	0.8%
Texture	Black loam-sandy clay
pH	7.8
Maximum water-holding capacity (ml/g)	0.226

Table 1.

Physicochemical parameters of the test soil.

2.3 Isolation of fungi-enrichment technique

The clay samples of 50 g were allocated in various Erlenmeyer flasks and samples were further enriched with amendment of different (10, 25, 50, 75,100 ppm) concentrations with fenitrothion respectively to provide a terminal quantity about 100 ppm, agitated the flasks forcefully being homogeneous mingle of insecticide, incubate it at 27C ± 2°C up to 3 weeks, wateriness contentment was maintained with the addition of distilled water twofold by 1-week interim [8]. The media of stock culture were processed over transpose 5 g of paddy clay to Potato dextrose broth from enriched clay samples of pH -7 [9] with ingredients Potatoes, infusion-200.0, Dextrose-20.000, Agar - 15.000, pH (at 25°C)- 5.6 ± 0.2 Gms/lt, without agar for preparation of broth.

2.4 Screening of Fenitrothion degrading fungi

10 ml of the stock cultures abide transmitted into the range of 100 ml Erlenmeyer flask consist of fresh 50-ml broth of Potato dextrose, subject it to the incubator belongs to shaking by maintaining the speed of rpm 250 at 27C ± 2°C. Further, the culture of 1 ml is transferred to clean Erlenmeyer flasks containing fresh broth with (10, 25, 50, 75,100 ppm) of insecticide and maintained at 27C ± 2°C with shaking at 250 rpm for 1 week. The steps were repeated up to 6 transfers. Following 6 transmittals, one loop of inoculates abide inoculated over agar of Potato dextrose plates, stored by 27C ± 2°C for 24 - 48 h [8].

2.5 Enrichment procedure for isolation of potential fungi strain

Fungal isolates were carried out in Czepak-dox broth according to the methods of [10]. Fungi isolate degrading fenitrothion were obtained by enrichment culture in the Czepak-dox agar media containing Sodium nitrate, 2.0 gm L⁻¹, Sucrose, 30.0 gm L⁻¹, Magnesium sulphate, 0.5 gm L⁻¹, Dipotassium Phosphate, 1.0 gm L⁻¹, Ferrous sulphate, 0.01 gm L⁻¹, Potassium Chloride, 0.5 gm L⁻¹, Agar, 15.0 gm L⁻¹, pH 7.3 ± 0.3 at 25°C by successively greater fenitrothion convergence (200, 300, 400, 500 ppm) by maintaining the controls (without inoculation of fungi). For this different ppm concentration of fenitrothion (Figure 1) were prepared by solubilizing the fenitrothion in acetone. By using Czepak-dox broth the degradation of insecticide is also checked in liquid media [7, 8, 11].

Figure 1.

Different ppm concentrations of fenitrothion.

2.6 Growth studies of the potential isolate

Growth curves of fungi isolate were determined in PDB with fenitrothion and without fenitrothion as control, A culture of aliquant is taken out by constant interim as for 0, 5, 10, 15, 20, 24 hours. Absorbance was measured at 600 nm [12].

2.7 Parameters of optimization

To check shaking & static consequence of insecticide degradation, flasks containing 50 ml PDB amended with fenitrothion insecticide and fungi culture were inoculated and incubated at 37°C in static condition and another set is subject to the shaker of orbital up to 24 hours by 120 rpm. Insecticide samples are introverted by systematic span interregnum & exposed to degradation assay.

2.8 Utilization of phosphate by fungi

According to the literature of [7, 8, 11, 13]. The fungi utilize phosphorus from [Organo Phosphate Insecticide] as the major source for their growth- Phosphatase activity. Czepak-dox agar medium with, without out Phosphorus & dispersed in conical flaskets of 100 ml & sterilized with autoclave through standard manner, after sterilization various concentrations related to Fenitrothion of 50% EC as 10, 20, 50, 100 ppm is added as a phosphorus source. Two agar plates were kept as Control - Czepak-dox agar medium with Phosphorus (without Fenitrothion). The Isolate namely Aspergillus parasitcus abide cleft in distinction to earnestly thriving culture on PDA & positioned on comic centre as concerns specific Petri dishes encompass a various congregation as for Fenitrothion. The effect of growth and utilization of Phosphate by Aspergillus parasitcus by virtue of culture medium belongs to liquid prior to Czapak Dox, be accomplished with 2 calibrates albeit with & without Fenitrothion emendation.

2.9 Taxonomic identification of the fungi strain

Genomic DNA isolation purification is carried out by carried out by utilizing fungal-peculiar 26 s rDNA sequencing of gene molecular characterization [14] was identified. Further, strains were amplified by PCR and then confirmed by molecular-based 26 s rDNA partial sequencing accomplished at National Collection of Industrial Microorganisms (NCIM) CSIR-NCL, Pune. Virtually intact term 26 s rDNA abide ampliate over PCR upon ITS1, ITS4. By using the universal primer this reaction was carried out. The sequel of primer abide follows in the process of 5’TCCGTAGGTGAACCTGCGG3’- ITS1 5’TCCTCCGCTTATTGATATGC3’- ITS4, the polymerase chain reaction were carried out by Initiatory denaturation-94°C-5 min, Denaturation-94°C-30 sec, Annealing 56°C-30 sec, Elongation 72°C-30 sec, Eventual expansion 72°C-10 min up to 35 cycles.

2.10 Insecticide residues-extraction & exploration

Tense flasks of culture Test Sample be possessed & percolate via the filter paper of Whatman No.1, elicitation regarding Fenitrothion amid extract of culture filtrate [15] abide accomplished later. The filtrate abides embrace as the funnel of detached facing that saline water of twenty ml about the percentage of 2 was put on. Subsequently, hexane of 40 ml, 20 ml of ethyl acetate was put on, vibrate the funnel aggressively & and concede on the point of base up to ten minutes thus 2-phases simultaneously aqueous, organic phase comes into detached, tense pace be redone thrives on redeeming comic insecticide. Finishing, funnel abide permit on sit up to fifteen minutes in-favor-of entire detachment regarding phases. Tense upper layer (organic phase) comprises fenitrothion be separated & the samples containing the residues of fenitrothion were subject for chromatographic procedures.

2.11 FTIR-Fourier-transform infrared spectroscopy-interpretation

Deterioration products as for the fenitrothion ensue monitored on FTIR – utilized as investing modifications with it apparent functional categories such abide intricate with its comic degradation about fenitrothion. The sample & control abide torrid & assorted by Potassium bromide (1:20; 0.02 grams as regards to sample accompanied by KBr with finishing net of 0.4 grams) Premise the samples, desorb it by 60°C & press down for pellets of IR-transparent. Tense absorbancy spectra regarding samples are chronicled by utilizing (FT-IR-NICOLET IS10). The scanning rate as concerns 500–3000 cm⁻¹ is applied for taking the spectra. Tense FT-IR is initially measured peculiar background scanning along with control as clear Potassium bromide & afterwards, the sample regarding analysis be scanned tense Fourier-transform infrared spectrum about comic non-deteriorated control be finishing deduct out of possession of comic spectra about deteriorated insecticide [16]. The positions of stretching & band, bending be espied & collate along with allusion compounds. With wave quantity group the band posture is conferred (cm⁻¹ reciprocal centimeters). Tense band ferocity manifested as (T) transmittance. According to comic band positions, the presence of functional groups was counted.

2.12 HPLC - high-performance liquid chromatography

Tense deteriorated compounds abide determined at high-performance liquid (HPLC-1200 series) chromatography. Decolourized residue was dissolved in acetonitrile was inject into the column using mobile phase like acetonitrile-water. HPLC be carried out to separate individual compounds of intermediates, for separation of sole products concerning intermediary that were identified by utilizing of UV–Vis detector reverse phase column be applied. Tense acetonitrile-water in the ratio of 1:1 was used with the rate of movement 0.5 ml/minute. Tense eluates are monitored by 254 nm wavelength using isocratic elution [17].

3. Results and discussion

In the current study, we practised selective enrichment methods to isolate fenitrothion deteriorating fungi of the paddy field and 5 distinct strains was obtained, among which Aspergillus parasitcus was chosen for analysis because of potential degradation of fenitrothion. The fungi utilize fenitrothion as phosphate source.

Soil sample collected from paddy field was enriched with fenitrothion to isolate the fenitrothion degrading fungi. From this enrichment culture, among 5 distinct strains were isolated on Potato dextrose medium containing fenitrothion. Czapek Dox Agar plate applied to screen the isolates for potential tolerance to fenitrothion.

BLAST result of the 26 s rDNA gene sequence of fungi isolate exhibited 99% similarity to that of the 26 s rDNA gene of Aspergillus parasitcus (GenBank accession no. MH714745). (Figure 2) indicates growth kinetics of Aspergillus parasitcus, the metabolism of fenitrothion by Aspergillus parasitcus was indicated by a visible increase in mycelia mass with time, the growth curve pattern was studied by growing the organisms in the presence of insecticide and comparing it with the control (without insecticide). The growth pattern of Aspergillus parasitcus was significantly different from the control and the lag phase delayed up to 12 hours in comic residence as concerns both isolates while in comparison toward control. Tense maximum progress was observed after 21 hours in Aspergillus parasitcus. The number of cells decreased as fenitrothion degradation progressed in time. Tense cells eventually are old, lyse & comic enzyme of extracellular interacts with insecticide to reduce the toxicity.

Figure 2.

Growth curve of Aspergillus parasitcus.

The degradation efficiency of fenitrothion insecticide was studied by static and shaking conditions at various time intervals. The resolute of degradation were identified through an increase at the flasks to be retained in a condition of static (90%) and comic activity of degradation was reduced beneath the condition of shaking (30%) (Figure 3). Beneath the conditions of shaking, oxygen presence divests hydrolase enzyme so the degradation process decreased, whereas under static conditions the activation of enzyme degrades the fenitrothion.

Figure 3.

Effect of stationary & shaking situation on the degradation of insecticide.

Fungi Utilize Fenitrothion as Phosphate Source when compared to control. Control with lack of fenitrothion, the 2 fungi with fenitrothion shows similar growth rates, which intimates phosphate is the major source for the growth of 2 isolated fungi (in solid, liquid media) namely Aspergillus parasitcus intimated in the (Figures 4and5) and (Figures 6 and 7).

Figure 4

Control (without fenitrothion).

Figure 5.

A. parasitcus (with fenitrothion).

Figure 6.

Control (without fenitrothion).

Figure 7.

A. parasitcus (with fenitrothion).

3.1 In liquid medium

The spectrum of FTIR Aspergillus parasiticus is analyzed between the scan ranges (500–3500 cm⁻¹), The FTIR spectrum obtained from the control (Figure 8) [Peaks of red color intimates control] displayed a peak at 2950 cm⁻¹ 2850 cm⁻¹ indicating stretching and strong vibration of the C-H bond of alkane (Table 2). A Peak at 2150 indicating bending and medium-weak vibration of C-H bond of alkane. A Peak on 1700 cm⁻¹ & 1600 cm⁻¹ exhibit C=O lengthen & strong vibration of the carbonyl group. Peaks on 1350 cm⁻¹ & 1300 cm⁻¹ lengthen vibration & medium-weak of alkyl Halide compounds. Peaks at 1250 cm⁻¹ exhibit C-N lengthen as regards amine compounds. Peaks on 1080 & 1030 cm⁻¹ exhibit C-O C-O lengthen as for strong compounds of ether. Peaks at 980 cm⁻¹ & 750 cm⁻¹ showed = C-H alkene compounds. Peaks by 620 cm⁻¹ and 610 cm⁻¹ & 600 cm⁻¹ exhibit Stretch & Strong vibration of alkyl halide respectively.

Figure 8.

FTIR spectrum of A. parasiticus (FI-I) (red-Control, Purple- FI-1).

The FTIR spectrum of the products formed after degradation in Aspergillus parasiticus isolate (Figure 8) [Peaks of purple color intimates] array a peak on 2910 cm⁻¹ & 2890 cm⁻¹ showed C-H indicating lengthen and strong vibration of alkane compounds. The peak on 1600 cm⁻¹ exhibit N-H indicating lengthen and strong quaking of amine compounds. Peak on 1590 cm⁻¹ exhibit C=C indicating lengthen and strong quaking aromatic compounds. Tense peak at 1500 cm⁻¹ exhibit N-O indicating lengthen & strong vibration intimates nitro groups. Peaks on 1490 cm⁻¹ & 1400 cm⁻¹ showed C=C lengthen of aromatic compounds. Peaks on 1350 cm⁻¹ showed C-N stretching concerning strong aromatic amines. Peaks on 1330 cm⁻¹ showed C-N bent concerning strong aromatic amines. Peaks on 1230 cm⁻¹ showed O-H lengthen concerning strong alcohol compounds. Peaks at 1220 cm⁻¹ and 1010 cm⁻¹ showed = C-H alkyl halide compounds. Peaks on 980 cm⁻¹ showed O-H Stretch and Strong vibration of carboxylic acids. Peaks at 790 cm⁻¹ showed = C-H bending and Strong quaking concerning an alkene. Peaks on 670 cm⁻¹, 660 cm⁻¹, 640 cm⁻¹, 630 cm⁻¹ showed O-H Stretch, bent and Strong vibration of alkyl halide Peaks at 600 cm⁻¹ & 590 cm⁻¹ exhibit C=C lengthen & Strong vibration of aromatic compounds respectively (Table 2).

Functional group		Type of Vibration	Characteristic Absorptions (cm^-1)	Intensity
Control
Alkane	C-H	Stretch	2950	Strong
Alkane	C-H	Stretch	2850	Strong
Alkane	C-H	Bending	2150	Medim-weak
Carbonyl	C=O	Stretch	1700	Strong
Carbonyl	C=O	Stretch	1600	Strong
Alkyl Halide	C-H	Stretch	1350	Medim-weak
Alkyl Halide	C-H	Stretch	1300	Medim-weak
Amine	C-N	Stretch	1250	Strong
Ether	C-O	Stretch	1080	Strong
Ether	C-O	Stretch	1030	Strong
Alkene	=C-H	Stretch	980	Strong
Alkene	=C-H	Stretch	750	Medim-weak
Alkyl Halide	C-H	Stretch	620	Strong
Alkyl Halide	C-H	Stretch	600	Strong
Alkyl Halide	C-H	Stretch	610	Strong
Aspergillus parasiticus (FI-1)
Alkane	C-H	Stretch	2910	Strong
Alkane	C-H	Stretch	2890	Strong
Amine	N-H	Stretch	1600	Strong
Aromatic	C=C	Stretch	1590	Strong
Nitro	N-O	Stretch	1500	Strong
Aromatic	C=C	Stretch	1490	Strong
Aromatic	C=C	Stretch	1400	Strong
Aromatic amines	C-N	Stretch	1350	Weak
Aromatic amines	C-N	Bended	1330	Strong
Alcohol	O-H	Bended	1230	Weak
Alkyl Halide	C-H	Stretch	1220	Strong
Alkyl Halide	C-H	Stretch	1010	Strong
Carboxylic acids	O-H	Stretch	980	Strong
Alkene	=C-H	Bending	790	Strong
Alkyl Halide	C-H	Stretch	670	Strong
Alkyl Halide	C-H	Stretch	660	Strong
Alkyl Halide	C-H	Bending	640	Weak
Alkyl Halide	C-H	Stretch	630	Strong
Aromatic	C=C	Stretch	620	Strong
Aromatic	C=C	Stretch	600	Strong
Aromatic	C=C	Stretch	590	Strong

Table 2.

FTIR compounds from fenitrothion degrading from Aspergillus parasiticus.

The insecticides were determined on collation based on comic retention time by samples with a comic standard. The HPLC elution profile of fenitrothion (control) showed prominent peaks at retention time of 10.652 minutes (Figure 9). The samples at 3–4 days of the interval beyond be a notable decline by the magnitude appropriate to peak on retention time 2.489,1.950, 1.275,1.209 (Figure 10) & The samples at 7–8 days of the interval a notable decline by magnitude appropriate to peak on retention time 1.930, 1.231 (Figure 11) in the degraded sample Aspergillus parasiticus confirming the degradation of fenitrothion. Various peaks do too espy by comic chromatogram as regards the degraded sample illustrate comic proffering as concerns metabolites at comic isolates. The significant absence concerning comic peaks recognized by comic insecticide (control) sample & tense presence as concerns strange peaks at comic degraded metabolites upon strange retention times ramparts comic biotransformation as regards parent insecticide toward molecules.

Peak #	R.T [min]	Type	Width [min]	Area	Area%
1	1.637	VB	0.057	40.616	1.221
2	8.735	BV	0.302	187.882	5.647
3	9.485	VV	0.301	245.940	7.392
4	9.815	VV	0.345	255.086	7.667
5	10.652	VB	0.383	2480.939	74.572
6	19.165	BBA	0.629	116.432	3.500

Peak #	R.T [min]	Type	Width [min]	Area	Area%
1	1.209	BV	0.062	226.236	91.211
2	1.275	VV	0.082	1032.986	25.875
3	1.950	VB	0.211	24.360	1.809
4	2.489	BB	0.419	1856.630	53.471

Peak #	R.T [min]	Type	Width [min]	Area	Area%
1	1.231	BV	0.072	235.266	94.562
2	1.524	VV	0.110	1032.761	2.556
3	1.930	VV	0.204	63.226	1.705
4	15.836	BB	0.360	43.632	1.177

Figure 9.

HPLC chromatogram of fenitrothion (control).

Figure 10.

HPLC analysis of fenitrothion degradation by Aspergillus parasiticus.

Figure 11.

HPLC analysis of fenitrothion degradation by Aspergillus parasiticus.

4. Conclusions

Fenitrothion organophosphate insecticide was selected for the present study. It is well known to be poisonous, carcinogenic, mutagenic and pollutant in nature because it is an acetylcholine esterase inhibitor, and inhibit different metabolic activities, and also highly toxic to all living ecosystem.

The degradation ability is also observed under static/ shaking conditions and was measured by spectrophotometric method. Degradation of fenitrothion insecticide was more efficient in static condition than at shaking condition with 7 days of incubation. The static condition, transmit as regards oxygen abide finite toward comic surface of the broth & comic cell cultures do utmost probably residuum of comic flasks & get briskly drained oxygen and enhance the degradation, fungi produce an enzyme which helps to break down the organic compounds in wastewater.

In this study the fungi utilize the phosphate as the major nutrient for their growth which is tested by Czapek Dox media which were prepared with and without fenitrothion, without fenitrothion were coded as control, the plates which contain fenitrothion should be inoculated as the two selected fungi spp. as the same way the control is also inoculated with fungi, and kept for incubation up to 7 days, along with control, the plates which contain fenitrothion also shows the same growth, here while preparation of the Czapek Dox media for control all nutrients namely sodium nitrate, sucrose, magnesium sulphate, dipotassium phosphate, ferrous sulphate, potassium chloride was added, here dipotassium phosphate serves as a phosphate source for the growth of 2 fungi, while in the other plates dipotassium phosphate is not added, instead of this fenitrothion is added, fungi for their growth it utilizes the fenitrothion as a phosphate source. Different temperature and pH and different time intervals also influence the growth of fungi which is a helpful factor to know the detailed conditions of the selected fungi.

Differences in the FTIR spectrum of fenitrothion and metabolites indicated that the insecticide molecule degraded into different metabolites. In FTIR analysis, control (insecticide) had several peaks. The difference in the FTIR spectrum of fenitrothion and metabolites indicated that the insecticide molecule degraded into different metabolites by Aspergillus parasiticus. The presence as concerns latest peaks in comic insecticide and nonappearance appropriate to the above peak representing the catalyzed cleavage of fenitrothion.

In the FTIR spectrum, exhibit an important modification over the position as concerns a peak, while correlated toward comic control insecticide span in both fungi isolates of Aspergillus parasiticus. Significant disappearance of the peaks develops over comic insecticide sampler & comic emergence as concerns fresh peaks by comic degraded samplers beside fresh retention times rampart comic biotransformation as concerns fenitrothion toward fresh compounds.

The HPLC chromatogram of fenitrothion showed prominent peaks at retention time 10.652 intimates the control, the reduction chic ferocity as concerns comic peak by Aspergillus parasiticus retention time was 1.275, 1.209, 1.950, 2.489 and 1.231, 1.930, 15.836 respectively. The study exhibit comic appearance as regards peaks amidst the vanishing of the peaks of fenitrothion confirming the insecticide degradation by metabolites. The results supported by the emergence as concerns of the latest peaks over comic deteriorated compounds concoct later degradation, due to the production of different intermediate metabolites.

Our study revealed that the fungi isolate exhibit an increased level of degradation at 300 ppm concentration. Fenitrothion at a concentration of 100 to 400 ppm observed an increase in degradation with the increase in insecticide concentration. At lower ppm concentrations 75, 100 the degradation rates were increased rapidly, but the captivation as regards insecticide be boost amid 200–300 ppm comic deterioration rates were very slowly at starting days of incubation but on prolonged incubation, up to 14 days the degradation rates were increased, intimates that rapid increase in ppm concentration will slow the growth of organisms. When the concentration of ppm up to 400 ppm and 7 to 14 days there is no growth, but on prolonged incubation up to 20 days the degradation rates were increased slowly.

This intimates that at higher concentrations of fenitrothion up to 600, 1000 ppm also shows degradation from slow level to a higher level. Here at the time insecticide concentration was high, the isolates showed less capability.