Open access peer-reviewed chapter

Breeding for Disease Resistance in Brassica Vegetables Using DNA Marker Selection

Written By

Mst Arjina Akter, Hasan Mehraj, Takeru Itabashi, Tomoe Shindo, Masaaki Osaka, Ayasha Akter, Naomi Miyaji, Naoki Chiba, Junji Miyazaki and Ryo Fujimoto

Submitted: September 17th, 2020 Reviewed: January 27th, 2021 Published: February 24th, 2021

DOI: 10.5772/intechopen.96263

From the Edited Volume

Brassica Breeding and Biotechnology

Edited by A. K. M. Aminul Islam, Mohammad Anwar Hossain and A. K. M. Mominul Islam

Chapter metrics overview

360 Chapter Downloads

View Full Metrics

Abstract

The Brassica genus comprises of agro-economically important vegetables. Disease causes great yield loss of Brassica vegetables worldwide. Different traditional methods such as crop rotation and chemical control have limited effect on different diseases of Brassica vegetables and cannot completely eradicate the pathogens by these methods. Development of disease resistant cultivars is one of the most effective, ecofriendly, and cheapest measure to control Brassica diseases. With the development of genomics, molecular biology techniques, and biological methods, it is possible to discover and introduce resistance (R) genes to efficiently control the plant diseases caused by pathogens. Some R genes of major diseases such as Fusarium wilt and clubroot in Brassica vegetables have been already identified. Therefore, we will focus to review the Fusarium wilt and clubroot resistance in Brassica vegetables and the methodologies for identification, mapping, and pyramiding of R genes/quantitative trait loci (QTLs) to develop disease resistant cultivars. These techniques will be helpful for sustainable crop production and to maintain global food security and contribute to ensure protection of food supply in the Asian country as well as throughout the world.

Keywords

  • R gene
  • marker assisted selection
  • Fusarium wilt
  • clubroot
  • Brassica

1. Introduction

Brassica is a commercially important genus that contains vegetables, oilseeds, condiments, and fodder crops, and they provide nutrition and health-promoting substances to humans worldwide [1]. The commercially important vegetables such as Chinese cabbage (var. pekinensis), pak choi (var. chinensis), and turnip (var. rapa) are involved in Brassica rapaL., and cabbage (var. capitata), broccoli (var. italica), and cauliflower (var. botrytis) are involved in Brassica oleraceaL. [1].

Production of Brassica vegetables constantly threatened by emerging viral, bacterial, and fungal diseases, whose incidence has increased in recent years [2, 3]. The major diseases of Brassica vegetables are Black rot, clubroot, Downy mildew, Fusarium wilt, soft rot, and Turnip mosaic virus [2]. Cultural, physical, biological, or chemical controls, or a combination of these controls, integrated pest management, are used for disease control [2, 3]. However, soil-borne phytopathogens such as Fusarium wilt or clubroot are hard to control by physical and chemical methods, and they can survive in the soil for many years in dormant conditions and become devastating when they find suitable host [2, 3, 4]. Thus, breeding the disease resistant cultivars of Brassica vegetables, especially against soil-borne phytopathogens, is the best way for effective disease control. Recently, some disease resistance genes (Rgenes) have been isolated in Brassica vegetables, and DNA marker assisted selection is applicable in some diseases [2, 3].

In this chapter, we focus on the Fusarium wilt and clubroot and present the breeding for these disease resistances in Brassica vegetables using DNA marker selection.

Advertisement

2. DNA marker selection for breeding Fusarium wilt disease resistant cultivars in Brassica vegetables

Fusariumspecies are highly host specific and comprise more than 120 formae speciales(f. sp.) further sub grouped into races [5, 6]. Fusarium oxysporumis considered as one of the top ten most devastating plant pathogens throughout the world and can infect approximately 150 of independent host plants or over, including economically important agricultural crops such as cabbage, tomato, onion, pepper, cucumbers, bananas, melons, cotton, etc. [5, 7, 8, 9, 10, 11, 12]. Two formae specialesof F. oxysporum(f. sp. conglutinansand f. sp. rapae) mainly invade in Brassica vegetables [3, 13].

Fusarium wilt was first identified in the United States by Smith in the 1890s, and in the following decades it was subsequently found in Japan and several other countries [14, 15]. In recent years, Fusarium wilt has been overspread in China [16]. F. oxysporumf. sp. conglutinansinfects Brassica vegetable roots (young roots are more vulnerable), and thereafter, it colonizes and blocks the xylem vessels by their growth leading to blockage of the water transport inside the plant. Finally, it leads to show the disease symptoms such as dull green to yellow green color of the leaves initially, yellowing, wilting, necrosis of leaf, defoliation, stunting, and death of seedling [17].

2.1 Traditional management

A number of traditional techniques have been adopted to manage Fusarium wilt disease. Crop rotation is effective to control Fusarium wilt disease [18], and soil solarization [19] and soil steam sterilization [20, 21] can suppress significantly the F. oxysporumf. sp. conglutinanspopulation. Application of chemical fungicides such as prochloraz, carbendazim, and Bavistin is also used [22], but it is not strongly recommended to control Fusarium wilt [23, 24]. Chemical fumigants such as sodium azide, chloropicrin, and methyl bromide etc. are environmentally hazardous and most of them are not available nowadays. A few chemical fumigants may be available in commercial market in some countries, but it needs to be applied according to the sustainable regulations [25, 26, 27]. An alternative environment friendly method is biological control, but there are not any registered biological control agents for the Fusarium wilt in Brassica vegetables [27]. Combining different independent strategies are used for the more efficient control of Fusarium wilt. For example, combining the organic soil amendment (Brassica carinatadefatted seed meals and compost) with a short period of soil solarization can significantly reduce both F. oxysporumf. sp. conglutinansand F. oxysporumf. sp. raphani[28].

2.2 Isolation of resistance genes

Most Rgenes encode proteins with leucine-rich repeats (LRR), a central nucleotide binding site (NBS) domain, and in the N-terminus a domain that contains homology to cytosolic domains of the Drosophila Toll or animal interleukin-1 receptors (TIR) (termed TIR–NBS–LRR) or a potential coiled coil (CC) domain (termed CC–NBS–LRR) [29, 30, 31]. Rgene of F. oxysporumf. sp. conglutinanshas been identified in B. rapausing transcriptome analysis focusing on differentially expressed putative Rgenes that have NBS, LRR, TIR, or CC motifs between Fusarium wilt resistant and susceptible lines [32]. Two TIR-NBS-LRR genes (Bra012688 and Bra012689), which located next to each other in the same transcriptional direction, have been identified as candidates of Rgene (FocBr1), and presence and absence of these two genes were identical to the resistant and susceptible phenotypes, respectively, by inoculation test using F2 population derived from crossing between susceptible and resistant lines [32, 33]. However, it has not been clarified which gene is FocBr1[32].

Rgene of F. oxysporumf. sp. conglutinans(FocBo1) has also been identified in B. oleraceaby genetic approach [34, 35], and candidate Rgene in B. oleraceais ortholog of Bra012688 [35]. It suggests that Bra012688 could be FocBr1.The susceptible B. oleracealines have mutations causing frame shift and there are several susceptible alleles [34, 35, 36], suggesting that mutations leading to susceptibility have occurred multiple times independently. In contrast, no mutations other than deletion leading to loss of function of FocBr1have been found in B. rapa[32, 33].

2.3 DNA marker selection system

Selection by inoculation test is labor-intensive and highly influenced by the environmental factors, and selection of suitable plants highly depends on the experience of breeders. In contrast, DNA marker selection is rarely affected by the environmental conditions. DNA marker selection also has merits that it can be performed at early developmental stages, can handle many samples, and can test multiple traits in a sample [37]. Identification of Rgene or locus linked to Rgene enables us to develop DNA marker for disease resistance [2, 3, 38].

As the susceptible allele (focbr1–1) of Fusarium wilt in B. rapais due to deletion of FocBr1, a dominant DNA marker (Bra012688m), which confirms amplification of FocBr1, has been developed. This dominant DNA marker cannot distinguish the homozygous (FocBr1/FocBr1) and heterozygous (FocBr1/focbr1–1) alleles (Table 1). The SSR marker (SSR687int), which locates close to FocBr1, was identified, and we have confirmed this DNA marker can identify the heterozygous alleles in some lines (Figure 1). However, as there were several lines showing not identical to genotype information with resistance phenotypes by inoculation test, the genotypes determined by this DNA marker (SSR687int) and disease resistance by inoculation test must be confirmed before applying the DNA marker selection. To shorten the time required for PCR and to allow simultaneous determination of two dominant DNA markers of Bra012688 and Bra012689 (multiplex), the new DNA marker sets (YR688s and YR689s) were developed (Table 1).

Primer sequencePCR conditionRSRef.
Bra012688 (FocBr1)
Bra012688mFAGTCGCTTGGAAGTCTGAGG1 cycle of 94 °C for 3 min, 35 cycles of 94 °C for 30s, 58 °C for 30s, and 72 °C for 1 min, and final extension at 72 °C for 3 min.ANA[32, 33]
RGAGCTAACCAACTATACATTGAACC
YR688sFCTCCATCTGAGGATGGAAGTTGTACAAGCTCGGA1 cycle of 94 °C for 2 min, 35 cycles of 94 °C for 30s and 68 °C for 30s, and final extension at 68 °C for 2 min.
This primer set is used with YR689s for multiplex PCR.
ANA
RGCTCCGAATTCGAATTGGTGAATATCGCATACGAG
SSR687intFCGTCAAAACCCTTTTGCCTA1 cycle of 94 °C for 2 min, 35 cycles of 94 °C for 30s, 58 °C for 30s, and 72 °C for 30s, and final extension at 72 °C for 2 min.
This marker is co-dominant DNA marker
LBSB
RCAAACGCTCGGTCCTGAAAT
Bra012689
Bra012689mFGCATCAAGGCAAAAATGTCA1 cycle of 94 °C for 3 min, 35 cycles of 94 °C for 30s, 58 °C for 30s, and 72 °C for 1 min, and final extension at 72 °C for 3 min.ANA[32, 33]
RCATTATAGTAGAACCCAAGTTGATCC
YR689sFCCACTCAGATGTCGTTGAGAAGTCTGATACCATCG1 cycle of 94 °C for 2 min, 35 cycles of 94 °C for 30s and 68 °C for 30s, and final extension at 68 °C for 2 min.
This primer set is used with YR688s for multiplex PCR
ANA
RAGGAGACGACGACTGATCCACAAAGTGTGTATC

Table 1.

DNA marker for predicting fusarium wilt resistance in Brassica rapa.

R, resistance; S, susceptible; A, amplification of PCR product; NA, no amplification of PCR product; LB, large sized band; SB, small sized band.

Figure 1.

Determining of Fusarium wilt resistance by DNA marker. A dominant DNA marker (Bra012688m) and co-dominant DNA marker (SSR687int) are used. Lane 3 and 4 show the heterozygosity ofFocBr1andfocbr1–1alleles.

In B. oleracea, three different susceptible alleles (focbo1–1, focbo1–2, and focbo1–3) were found [36]. As DNA marker sets covering these three susceptible alleles have been developed [36], it is necessary to select a DNA marker suitable for lines and will be available for breeder to use these primer sets (Table 2).

Primer sequencePCR conditionRSRef.
Fusa-6FTGATGCAAGTGTGGTGACAA1 cycle of 94 °C for 3 min, 35 cycles of 94 °C for 30s, 58 °C for 30s, and 72 °C for 1 min, and final extension at 72 °C for 3 min
After PCR, Hind III digestion
FocBo1vs. focbo1–1
DND[61]
RCAATCGCTTCTTGCTTCTCC
Fusa-4FATCATGGGATCGAGAGAAGCCGCCC1 cycle of 94 °C for 3 min, 35 cycles of 94 °C for 30s, 58 °C for 30s, and 72 °C for 1 min, and final extension at 72 °C for 3 min
After PCR, EcoRI digestion
FocBo1vs. focbo1–1
NDD[61]
RTAGCTTCATGCCATAGTCGTCCTGG
#1FAGATTGTGCAATTAAACGCGACG1 cycle of 94 °C for 3 min, 35 cycles of 94 °C for 30s, 58 °C for 30s, and 72 °C for 1 min, and final extension at 72 °C for 3 min
After PCR, EcoRI digestion
FocBo1vs. focbo1–1
NDD[36]
RCATCCTCAGATTCCAAGCACAAC
#2FGAAGTTGGGTAAAGAAATTGTTCGTGC1 cycle of 94 °C for 3 min, 35 cycles of 94 °C for 30s, 58 °C for 30s, and 72 °C for 1 min, and final extension at 72 °C for 3 min
FocBo1vs. focbo1–2
SBLB[36]
RATCCCAAGTTGATATCAGTAGGAAGAG
#3FAATGGTTGCTCAATGAGAAGTATGC1 cycle of 94 °C for 3 min, 35 cycles of 94 °C for 30s, 58 °C for 30s, and 72 °C for 1 min, and final extension at 72 °C for 3 min
After PCR, EcoRI d-caps marker
FocBo1vs. focbo1–3
NDD[36]
RGCCTCTGAAAGATCTGGAAAAAGAA

Table 2.

DNA marker for predicting fusarium wilt resistance in Brassica oleracea.

R, resistance; S, susceptible; D, PCR products are digested; ND, PCR products are not digested; LB, large sized band; SB, small sized band.

Advertisement

3. DNA marker selection for breeding clubroot disease resistant cultivars in Brassica vegetables

Clubroot is also one of the most devastating diseases in Brassica vegetables and spreads almost all over the world [39]. Clubroot disease is caused by an obligate plant pathogen Plasmodiophora brassicae,which has distinct pathotypes or physiological races over the world [40, 41]. Plants infected by P. brassicaeform clubs on roots, which interfere with the host plant’s water and nutrients uptake. This interference leads to leaf yellowing, wilting, stunted growth, and death of the host plants.

3.1 Traditional management

Clubroot is quite difficult to control completely by the traditional methods due to the long survival spores of the P. brassicaein soil, their pattern of life cycle, and their pathotype specific infection, so that P. brassicaeultimately causes a broad diversity of virulence [3]. However, some traditional management system can control clubroot disease in some extent. Crop rotation with non-cruciferous plants can reduce the infestation of P. brassicae[18, 42], but cannot eliminate the P. brassicaecompletely [43, 44]. It is recommended not to grow any cruciferous plants on the infested site at least five to seven years.

Some biocontrol agents against P. brassicaesuch as Bacillus subtilis, Streptomyces griseorube, etc. are able to reduce the severity of clubroot infection [45, 46]. Soil sterilants like chloropicrin, diazomet, methyl, or ethylene dibromide etc. are effective to control clubroot [47]. Application of fungicides fluazinam and cyazofamid can effectively reduce the viability of resting P. brassicaespores and prevent infection [47]. However, the real fact is that these chemicals are not commercially approved for clubroot management since a long ago [47]. Integrated application of cultural or physical, chemical, and biocontrol agents can also be practiced for the more efficient management of P. brassicae[47, 48].

3.2 Isolation of resistance genes

In B. rapa, clubroot resistance is controlled by major dominant genes and pathotypes specific [3]. About 20 clubroot resistance loci have been identified, and highest numbers of clubroot resistance genes were found in chromosome A03 [3]. Two clubroot resistance genes (CRa/band Crr1a) have been cloned and both genes encode a TIR-NB-LRR class R protein [49, 50, 51]. Recently, new clubroot resistance loci were found in a locus close to Crr1ain chromosome A08. A clubroot resistance locus, covering CRsgene, has been identified, and Bra020876 and Bra020918 have been identified as candidates of the Rgene. Another clubroot resistance locus, covering Rcr9gene, was also identified in chromosome A08, and Bra020936 has been identified as a candidate gene [52]. Two clubroot resistance loci, Rcr3 and Rcr9wa, have been mapped in chromosome A08 being 1.17 Mb apart each other. Three genes, Bra020951, Bra020974, and Bra020979, have been identified as candidates of the Rcr3gene, and three genes related to immune-system-process (Bra020827, Bra020828, Bra020814) have been identified as candidates of the Rcr9wagene [53]. A clubroot resistance locus, covering PbBrA08Banglimgene, was also detected on chromosome A08, where is near to Crr1, CRs, and Rcr9[54]. These reports suggest that they are not allelic, thus chromosome A08 covering these genes has an Rgene cluster.

In B. oleracea, clubroot resistance is quantitative, and QTLs have been identified. Effect of each QTL is weak, and little progress in isolation of Rgene or fine mapping of Rgene in B. oleracea[3]. It clarifies resistant mechanism of clubroot in B. oleraceais polygenic nature where multiple clubroot loci combinedly responsible to the clubroot resistance [55].

3.3 DNA marker selection system

A breeding for clubroot resistance is much more complex compared with Fusarium wilt resistance due to the complexity of plant–pathogen interactions. A number of clubroot resistance locus has been identified by the different research groups in B. rapa, and this variation is due to the pathotype specific pathogenicity of P. brassicae[2, 3]. As CRa/CRband Crr1ahave been isolated, DNA markers in these genes have been developed. A dominant resistance (CRaim-T) and susceptible (Craim-Q) DNA marker set of CRahas been developed [49], and co-dominant indel marker (mCrr1a) of Crr1ahas been developed (Table 3) [33, 50]. In B. rapa, as the other clubroot resistance genes have not been isolated, linkage DNA markers are developed (Table 3). Some clubroot resistant cultivars in Chinese cabbage have been produced by introducing a single gene for clubroot resistance from European turnip. However, there is a problem that the loss of resistance by the presences of multiple pathotypes of P. brassicaeor arising new pathotypes has been found [56, 57]. Thus, the accumulation of multiple genes of clubroot resistance could make small risks to the breakdown of resistance [58, 59]. The introduction of DNA marker selection is essential for the simultaneous selection of multiple clubroot resistance genes. Furthermore, high-throughput genotyping system such as multiplex PCR could be useful. We have developed the multiplex DNA marker selection system (Figure 2). Indeed, the accumulation of three major clubroot resistance genes (CRa/CRb, CRk, and CRc) by DNA marker selection in Chinese cabbage represented the highly resistance against six isolates of P. brassicae[60]. A high clubroot resistant Chinese cabbage cultivar, ‘Akimeki’, was also developed by the accumulation of Crr1a, Crr2, and CRa/CRbgenes by DNA marker selection [3].

Primer sequencePCR conditionRSRef.
CRa/CRb
CRaim-TFTATATTAATGATAAAGCAGAAGAAGAAA1 cycle of 94 °C for 3 min, 35 cycles of 94 °C for 30s, 58 °C for 30s, and 72 °C for 1 min, and final extension at 72 °C for 3 min.ANA[33, 49]
RAATGCGACTGAGAAAGTTGTAG
Craim-QFTGAAGAATGCGGGCTACGTCCTCTGAAATCNAA
RGAAGTAGATGAACGTGTTTATTTTAGAAA
CRbzhang
TCR108FCGGATATTCGATCTGTGTTCA1 cycle of 94 °C for 3 min, 35 cycles of 94 °C for 30s, 58 °C for 30s, and 72 °C for 1 min, and final extension at 72 °C for 3 min.ANA[33, 62]
RAAAATGTATGTGTTTATGTGTTTCTGG
Crr1a
mCrr1aFCGATGACATGTCTGCCTTCT1 cycle of 94 °C for 3 min, 35 cycles of 94 °C for 30s, 58 °C for 30s, and 72 °C for 1 min, and final extension at 72 °C for 3 min.SBLB[33]
RTCTGAGATTCAACCGCTTCA
CRc
B50-C9FGATTCAATGCATTTCTCTCGAT1 cycle of 94 °C for 3 min, 35 cycles of 94 °C for 1 min, 55 °C for 1.5 min, and 72 °C for 2 min, and final extension at 72 °C for 7 min.ANA[60]
B50RCGTATTATATCTCTTTCTCCATCCC
B50-6RFAATGCATTTTCGCTCAACCNAA
B50RCGTATTATATCTCTTTCTCCATCCC
CRk
HC688–4FTCTCTGTATTGCGTTGACTG1 cycle of 94 °C for 3 min, 35 cycles of 94 °C for 1 min, 60 °C for 1.5 min, and 72 °C for 2 min, and final extension at 72 °C for 7 min.ANA[60]
HC688–6RATATGTTGAAGCCTATGTCT
HC688–4FTCTCTGTATTGCGTTGACTGNAA
HC688–7RAAATATATGTGAAGTCTTATGATC
Crr2
BRMS-096FAGTCGAGATCTCGTTCGTGTCTCCC1 cycle of 94 °C for 1 min, 35 cycles of 94 °C for 1 min, 40 °C for 1 min, and 72 °C for 1 min, and final extension at 72 °C for 4 min.LBSB[63]
RTGAAGAAGGATTGAAGCTGTTGTTG
Crr3
OPC11–2SFGTAACTTGGTACAGAACAGCATAG1 cycle of 94 °C for 30s, 45 cycles of 94 °C for 30s, 40 °C for 1 min, and 72 °C for 2 min, and final extension at 72 °C for 7 min.LBSB[64, 65]
RACTTGTCTAATGAATGATGATGG

Table 3.

DNA marker for predicting clubroot resistance in Brassica rapa.

R, resistance; S, susceptible; A, amplification of PCR product; NA, no amplification of PCR product; LB, large sized band; SB, small sized band.

Figure 2.

Determining of clubroot resistance by DNA marker. A dominant DNA marker (TCR108) or co-dominant DNA marker (OPC11–2S) is used in left or middle panel, respectively. In right panel, two primer sets (TCR108& OPC11–2S) were used for the simultaneous selection of multiple clubroot resistance genes.

In B. oleracea, it has also been compared by the independent and cumulative incorporation of the clubroot resistance locus to combat various isolates, where one major clubroot resistance gene (PbBo(Anju)1) accumulated independently, as well as combined with four minor clubroot resistance genes (PbBo(Anju)2, PbBo(Anju)3, Pb-Bo(Anju)4, Pb-Bo(GC)1). Accumulation of five clubroot resistance genes (one major and four minor clubroot resistance genes) represented the highest resistance against six P. brassicaeisolates. Here, the major QTL, PbBo(Anju)1, is a main player for the resistance mechanism against P. brassicaeand the introgression of other four minor clubroot resistance QTLs boosted up the resistance [55]. As this major clubroot resistance gene acts as repressive, heterozygous of this gene shows susceptibility to P. brassicae. Previously, we have tested using linkage DNA marker of PbBo(Anju)1in 35 cabbage F1 cultivars in Japan, and 12 cultivars (34%) have homozygous of PbBo(Anju)1allele [61], suggesting that about 60% of cabbage cultivars could be susceptible to P. brassicae. One reason for clubroot resistance breeding in B. oleraceabeing behind in B. rapais due to the theoretically impossible to introduce recessive resistance gene by backcrossing with inoculation test. However, DNA marker selection can overcome this problem as co-dominant DNA marker can distinguish the heterozygosity and homozygosity of PbBo(Anju)1allele, suggesting that introduction of DNA marker selection is indispensable in B. oleracea. However, the current DNA markers are linkage markers, making it difficult to use them universally. Thus, it will be necessary to develop gene markers based on mutations that cause susceptibility, and this will require the isolation of clubroot resistance genes in B. oleracea.

Advertisement

4. Perspective

Both Fusarium wilt and clubroot are the serious disease for Brassica vegetables. Breeders are trying to develop the resistant lines for the both diseases by DNA marker assisted breeding. It has already been successfully developed Fusarium wilt and clubroot resistant lines. However, a Fusarium wilt resistant line can be infested by the clubroot or vice versa, while the clubroot has the virulence complexity. It is quite difficult to inoculate the multiple pathogens/races in an individual plant, while resistant breeding independently for each disease will make a further issue. DNA marker-based selection will enables us to overcome the mentioned issue. It has already found an association between a Fusarium wilt resistance allele and clubroot susceptible allele in B. napus, but their recombination was also reported [66]. It is necessary to identify the possible linkage between the genes responsible for the Fusarium wilt and clubroot diseases in Brassica vegetables. A Fusarium wilt resistance gene (FocBr1) is located on the region covering CRgenes (CRa/CRb, Rcr1, Crr3, and CRk) with a physical distance approximately 2 Mb in chromosome A03 [3]. Recombination of two genes has been found [33], thus we can accumulate Fusarium and clubroot resistant alleles. In B. oleracea, FocBo1is close to a minor clubroot QTL in chromosome C06, but they are not closely linked each other [35, 55, 61, 67]. A linkage between dissimilar resistance loci can allow to inherit the resistance genes both for Fusarium wilt and clubroot, which can lead us for the development of resistant cultivars for both diseases.

Advertisement

Acknowledgments

This chapter includes results supported by grants from Project of the NARO Bio-oriented Technology Research Advancement Institution (Research program on development of innovation technology).

Advertisement

Conflict of interest

The authors declare no conflict of interest.

References

  1. 1. Lv H, Miyaji N, Osabe K, Akter A, Mehraj H, Shea DJ, Fujimoto R. The importance of genetic and epigenetic research in theBrassicavegetables in the face of climate change. In: Kole C, editor. Genomic Designing of Climate-Smart Vegetable Crops. Cham: Springer; 2020. p. 161-255. DOI: 10.1007/978-3-319-97415-6_3
  2. 2. Lv H, Fang Z, Yang L, Zhang Y, Wang Y. An update on the arsenal: Mining resistance genes for disease management of Brassica crops in the genomic era. Horticulture Research. 2020;7:34. DOI: 10.1038/s41438-020-0257-9
  3. 3. Mehraj H, Akter A, Miyaji N, Miyazaki J, Shea DJ, Fujimoto R, Doullah MA. Genetics of clubroot and Fusarium wilt disease resistance in Brassica vegetables: The application of marker assisted breeding for disease resistance. Plants. 2020;9:726. DOI: 10.3390/plants9060726
  4. 4. Shlevin E, Mahrer Y, Katan J. Effect of moisture on thermal inactivation of soilborne pathogens under structural solarization. Phytopathology. 2004;94:132-137. DOI: 10.1094/PHYTO.2004.94.2.132
  5. 5. Armstrong GM, Armstrong JK. Formae speciales and races ofFusarium oxysporumcausing wilt diseases. In: Nelson PE, Toussoun TA, editors. Fusarium: Diseases, Biology and Taxonomy. University Park, Pennsylvania: Pennsylvania State University Press; 1981. p. 391-399
  6. 6. Lievens B, Houterman PM, Rep M. Effector gene screening allows unambiguous identification ofFusarium oxysporumf. sp.lycopersiciraces and discrimination from otherformae speciales. FEMS Microbiology Letters. 2009;300:201-215. DOI: 10.1111/j.1574-6968.2009.01783.x
  7. 7. MacHardy WE, Beckman CH. Vascular wilt Fusaria: Infection and pathogenesis. In: Nelson PE, Toussoun TA, editors. Fusarium: Disease, Biology, and Taxonomy. University Park, Pennsylvania: Pennsylvania State University Press; 1981. p. 365-390
  8. 8. Fourie G, Steenkamp ET, Ploetz RC, Gordon TR, Viljoen A. Current status of the taxonomic position ofFusarium oxysporum formae specialis cubensewithin theFusarium oxysporumcomplex. Infection, Genetics and Evolution. 2011;11:533-542. DOI: 10.1016/j.meegid.2011.01.012
  9. 9. Dean R, Van Kan JAL, Pretorius ZA, Hammond-Kosack KE, Di Pietro A, Spanu PD, Rudd JJ, Dickman M, Kahmann R, Ellis J, Foster GD. The top 10 fungal pathogens in molecular plant pathology. Molecular Plant Pathology. 2012;13:414-430. DOI: 10.1111/j.1364-3703.2011.00783.x
  10. 10. Khan N, Maymon M, Hirsch AM. CombatingFusariuminfection usingBacillus-based antimicrobials. Microorganisms. 2017;5:75. DOI: 10.3390/microorganisms5040075
  11. 11. Sun Y, Wang M, Li Y, Gu Z, Ling N, Shen Q , Guo S. Wilted cucumber plants infected byFusarium oxysporumf. sp.cucumerinumdo not suffer from water shortage. Annals of Botany. 2017;120:427-436. DOI: 10.1093/aob/mcx065
  12. 12. de Lamo FJ, Takken FLW. Biocontrol byFusarium oxysporumusing endophyte-mediated resistance. Frontiers in Plant Science. 2020;11:37. DOI: 10.3389/fpls.2020.00037
  13. 13. Edel-Hermann V, Lecomte C. Current status ofFusarium oxysporum formae specialesand races. Phytopathology. 2019;109:512-530. DOI: 10.1094/PHYTO-08-18-0320-RVW
  14. 14. Smith EF. The fungus infection of agricultural soils in the United States. Scientific American Supplementary. 1899;48:19981-19982. DOI: 10.1038/scientificamerican11181899-19981supp
  15. 15. Gillman JC. Cabbage yellows and the relation of temperature to its occurrence. Annals of the Missouri Botanical Garden. 1916;3:25-84. DOI: 10.2307/2990072
  16. 16. Xing M, Lv H, Ma J, Xu D, Li H, Yang L, Kang J, Wang X, Fang Z. Transcriptome profiling of resistance toFusarium oxysporumf. sp.conglutinansin cabbage (Brassica oleracea) roots. PLoS ONE. 2016;11:e0148048. DOI: 10.1371/journal.pone.0148048
  17. 17. Gaetán SA. Occurrence of Fusarium wilt on canola caused byFusarium oxysporumf. sp.conglutinansin Argentina. Plant Disease. 2005;89:432-432. DOI: 10.1094/PD-89-0432C
  18. 18. Shafique HA, Sultana V. Ehteshamul-Haque S, Athar M. Management of soil-borne diseases of organic vegetables. Journal of Plant Protection Research. 2016;56:221-230. DOI: 10.1515/jppr-2016-0043
  19. 19. Ramirez-Villapudua J, Munnecke DE. Control of cabbage yellow (Fusarium oxysporumf. sp.conglutinans) by solar heating of field soils amended with dry cabbage residues. Plant Disease. 1987;71:217-221. DOI: 10.1094/PD-71-0217
  20. 20. Afek U, Orenstein J. Disinfecting potato tubers using steam treatments. Canadian Journal of Plant Pathology. 2002;24:36-39. DOI: 10.1080/07060660109506968
  21. 21. Panth M, Hassler SC, Baysal-Gurel F. Methods for management of soilborne diseases in crop production. Agriculture. 2020;10:16. DOI: 10.3390/agriculture10010016
  22. 22. Song W, Zhou L, Yang C, Cao X, Zhang L, Liu X. Tomato Fusarium wilt and its chemical control strategies in a hydroponic system. Crop Protection. 2004;23:243-247. DOI: 10.1016/j.cropro.2003.08.007
  23. 23. Uesugi Y. Fungicide Classes: Chemistry, Uses and Mode of Action. In: Hutson D, Miyamoto J, editors. Fungicidal activity: Chemical and biological approaches to plant protection. New York: John Wiley & Sons; 1998. p. 23-56
  24. 24. Ma YT, Fan HF, Gao YQ , Li H, Zhang AL, Gao JM. Natural products as sources of new fungicides (I): synthesis and antifungal activity of acetophenone derivatives against phytopathogenic fungi. Chemical Biology & Drug Design. 2013;81:545-552. DOI: 10.1111/cbdd.12064
  25. 25. Colla P, Garibaldi A, Gullino ML. A review and critical analysis of the European situation of soilborne disease management in the vegetable sector. Phytoparasitica. 2012;40:515-523. DOI: 10.1007/s12600-012-0252-2
  26. 26. Colla P, Garibaldi A, Gullino ML. Consequences of European pesticide policies enforcement in soil disinfestation sector. Acta Horticulturae. 2014;1044:363-366. DOI: 10.17660/ActaHortic.2014.1044.48
  27. 27. Arie T.Fusariumdiseases of cultivated plants, control, diagnosis, and molecular and genetic studies. Journal of Pesticide Science. 2019;44:275-281. DOI: 10.1584/jpestics.J19-03
  28. 28. Gilardi G, Demarchi S, Moizio M, Gullino ML, Garibaldi A. Disease management strategies against Fusarium wilt of basil and rocket by combining amendments and soil solarization. Acta Horticulturae. 2014;1044:319-324. DOI: 10.17660/ActaHortic.2014.1044.41
  29. 29. Meyers BC, Kozik A, Griego A, Kuang H, Michelmore RW. Genome-wide analysis of NBS–LRR-encoding genes in Arabidopsis. The Plant Cell. 2003;15:809-834. DOI: 10.1105/tpc.009308
  30. 30. Joshi RK, Nayak S. Functional characterization and signal transduction ability of nucleotide-binding site-leucine-rich repeat resistance genes in plants. Genetics and Molecular Research. 2011;10:2637-2652. DOI: 10.4238/2011.October.25.10
  31. 31. Marone D, Russo MA, Laidò G, De Leonardis AM, Mastrangelo AM. Plant nucleotide binding site-leucine-rich repeat (NBS-LRR) genes: active guardians in host defense responses. International Journal of Molecular Sciences. 2013;14:7302-7326. DOI: 10.3390/ijms14047302
  32. 32. Shimizu M, Fujimoto R, Ying H, Pu ZJ, Ebe Y, Kawanabe T, Saeki N, Taylor JM, Kaji M, Dennis ES, Okazaki K. Identification of candidate genes for fusarium yellows resistance in Chinese cabbage by differential expression analysis. Plant Molecular Biology. 2014;85:247-257. DOI: 10.1007/s11103-014-0182-0
  33. 33. Kawamura K, Kawanabe T, Shimizu M, Nagano AJ, Saeki N, Okazaki K, Kaji M, Dennis ES, Osabe K, Fujimoto R. Genetic characterization of inbred lines of Chinese cabbage by DNA markers; towards the application of DNA markers to breeding of F1 hybrid cultivars. Data in Brief. 2016;6:229-237. DOI: 10.1016/j.dib.2015.11.058
  34. 34. Lv H, Fang Z, Yang L, Zhang Y, Wang Q , Liu Y, Zhuang M, Yang Y, Xie B, Liu B, Liu J, Kang J, Wang X. Mapping and analysis of a novel candidate Fusarium wilt resistance geneFOC1inBrassica oleracea. BMC Genomics. 2014;15:1094. DOI: 10.1186/1471-2164-15-1094
  35. 35. Shimizu M, Pu ZJ, Kawanabe T, Kitashiba H, Matsumoto S, Ebe Y, Sano M, Funaki E, Fujimoto R, Okazaki K. Map-based cloning of a candidate gene conferring Fusarium yellows resistance inBrassica oleracea. Theoretical and Applied Genetics. 2015;128:119-130. DOI: 10.1007/s00122-014-2416-6
  36. 36. Sato M, Shimizu M, Shea DJ, Hoque M, Kawanabe T, Miyaji N, Fujimoto R, Fukai E, Okazaki K. Allele specific DNA marker for fusarium resistance geneFocBo1inBrassica oleracea. Breeding Science. 2019;69:308-315. DOI: 10.1270/jsbbs.18156
  37. 37. Collard BYC, Mackill DJ. Marker-assisted selection: an approach for precision plant breeding in the twenty-first century. Philosophical Transactions of the Royal Society B. 2008;363:557-572. DOI: 10.1098/rstb.2007.2170
  38. 38. Hirani AH, Gao F, Liu J, Fu G, Wu C, Yuan Y, Hou J, Duncan R, Li G. Transferring clubroot resistance from Chinese cabbage (Brassica rapa) to canola (B. napus). Canadian Journal of Plant Pathology. 2016;38:82-90. DOI: 10.1080/07060661.2016.1141799
  39. 39. Hirani AH, Li G. Understanding the genetics of clubroot resistance for effectively controlling this disease in Brassica species. In: Hany El-Shemy, editor. Plants for the Future. IntechOpen; 2015. DOI: 10.5772/60936
  40. 40. Kageyama K, Asano T. Life cycle ofPlasmodiophora brassicae. Journal of Plant Growth Regulation. 2009;28:203-211. DOI: 10.1007/s00344-009-9101-z
  41. 41. Tommerup IC, Ingram DS. The life-cycle ofPlasmodiophora brassicaeWoron. InBrassicatissue cultures and in intact roots. New Phytologist. 1971;70:327-332. DOI: 10.1111/j.1469-8137.1971.tb02531.x
  42. 42. Wallenhammar AC, Johnsson L, Gerhardson B. Agronomic performance of partly clubroot-resistant spring oilseed turnip rape lines. Journal of Phytopathology. 2000;148:495-499. DOI: 10.1046/j.1439-0434.2000.00536.x
  43. 43. Faggian R, Strelkov SE. Detection and Measurement ofPlasmodiophora brassicae. Journal of Plant Growth Regulation. 2009;28:282-288. DOI: 10.1007/s00344-009-9092-9
  44. 44. Daniel C, Hommes M, Koller M. Plant protection in organic production ofBrassicavegetables and oilseed rape. IOBC-WPRS Bulletin. 2016;118:110-115
  45. 45. Peng G, McGregor L, Lahlali R, Gossen BD, Hwang SF, Adhikari KK, Strelkov SE, McDonald MR. Potential biological control of clubroot on canola and crucifer vegetable crops. Plant Pathology. 2011;60:566-574. DOI: 10.1111/j.1365-3059.2010.02400.x
  46. 46. Wang J, Huang Y, Lin S, Liu F, Song Q , Peng Y, Zhao L. A strain ofStreptomyces griseoruberisolated from rhizospheric soil of Chinese cabbage as antagonist toPlasmodiophora brassicae. Annals of Microbiology. 2012;62:247-253. DOI: 10.1007/s13213-011-0253-2
  47. 47. Donald C, Porter I. Integrated control of clubroot. Journal of Plant Growth Regulation. 2009;28:289-303. DOI: 10.1007/s00344-009-9094-7
  48. 48. Donald EC, Porter IJ, Faggian R, Lancaster RA. An integrated approach to the control of clubroot in vegetable Brassica crops. Acta Horticulturae. 2006;706:283-300. DOI: 10.17660/ActaHortic.2006.706.33
  49. 49. Ueno H, Matsumoto E, Aruga D, Kitagawa S, Matumura H, Hayashida N. Molecular characterization of theCRagene conferring clubroot resistance inBrassica rapa. Plant Molecular Biology. 2012;80:621-629. DOI: 10.1007/s11103-012-9971-5
  50. 50. Hatakeyama K, Suwabe K, Tomita RN, Kato T, Nunome T, Fukuoka H, Matsumoto S. Identification and characterization ofCrr1a, a gene for resistance to clubroot disease (Plasmodiophora brassicaeWoronin) inBrassica rapaL. PLoS ONE. 2013;8:e54745. DOI: 10.1371/journal.pone.0054745
  51. 51. Hatakeyama K, Niwa T, Kato T, Ohara T, Kakizaki T, Matsumoto S. The tandem repeated organization of NB-LRR genes in the clubroot-resistantCRblocus inBrassica rapaL. Molecular Genetics and Genomics. 2017;292:397-405. DOI: 10.1007/s00438-016-1281-1
  52. 52. Laila R, Park JI, Robin AHK, Natarajan S, Vijayakumar H, Shirasawa K, Isobe S, Kim HT, Nou IS. Mapping of a novel clubroot resistance QTL using ddRAD-seq in Chinese cabbage (Brassica rapaL.). BMC Plant Biology. 2019;19:13. DOI: 10.1186/s12870-018-1615-8
  53. 53. Karim MM, Dakouri A, Zhang Y, Chen Q , Peng G, Strelkov SE, Gossen BD, Yu F. Two clubroot-resistance genes,Rcr3andRcr9wa, mapped inBrassica rapausing bulk segregant RNA sequencing. International Journal of Molecular Sciences. 2020;21:5033. DOI: 10.3390/ijms21145033
  54. 54. Choi SR, Oh SH, Chhapekar SS, Dhandapani V, Lee CY, Rameneni JJ, Ma Y, Choi GJ, Lee SS, Lim YP. Quantitative trait locus mapping of clubroot resistance andPlasmodiophora brassicaepathotype Banglim-specific marker development inBrassica rapa. International Journal of Molecular Sciences. 2020;21:4157. DOI: 10.3390/ijms21114157
  55. 55. Tomita H, Shimizu M, Doullah MA, Fujimoto R, Okazaki K. Accumulation of quantitative trait loci conferring broad-spectrum clubroot resistance inBrassica oleracea. Molecular Breeding. 2013;32:889-900. DOI: 10.1007/s11032-013-9918-9
  56. 56. Kuginuki Y, Yoshikawa H, Hirai M. Variation in virulence ofPlasmodiophora brassicaein Japan tested with clubroot-resistant cultivars of Chinese cabbage (Brassica rapaL. ssp.pekinensis). European Journal of Plant Pathology. 1999;105:327-332. DOI: 10.1023/A:1008705413127
  57. 57. Hatakeyama K, Fujimura M, Ishida M, Suzuki T. New classification method forPlasmodiophora brassicaefield isolates in Japan based on resistance of F1 cultivars of Chinese cabbage (Brassica rapaL.) to clubroot. Breeding Science. 2004;54:197-201. DOI: 10.1270/jsbbs.54.197
  58. 58. Neik TX, Barbetti MJ, Batley J. Current status and challenges in identifying disease resistance genes inBrassica napus. Frontiers in Plant Science. 2017;8:1788. DOI: 10.3389/fpls.2017.01788
  59. 59. Strelkov SE, Hwang SF, Manolii VP, Cao T, Fredua-Agyeman R, Harding MW, Peng G, Gossen BD, Mcdonald MR, Feindel D. Virulence and pathotype classification ofPlasmodiophora brassicaepopulations collected from clubroot resistant canola (Brassica napus) in Canada. Canadian Journal of Plant Pathology. 2018;40:284-298. DOI: 10.1080/07060661.2018.1459851
  60. 60. Matsumoto E, Ueno H, Aruga D, Sakamoto K, Hayashida N. Accumulation of three clubroot resistance genes through marker-assisted selection in Chinese cabbage (Brassica rapa spp. pekinensis). Journal of the Japanese Society for Horticultural Science. 2012;81:184-190. DOI: 10.2503/jjshs1.81.184
  61. 61. Kawamura K, Shimizu M, Kawanabe T, Pu Z, Kodama T, Kaji M, Osabe K, Fujimoto R, Okazaki K. Assessment of DNA markers for seed contamination testing and selection of disease resistance in cabbage. Euphytica. 2017;213:28. DOI: 10.1007/s10681-016-1821-0
  62. 62. Zhang T, Zhao Z, Zhang C, Pang W, Choi SR, Lim YP, Piao Z. Fine genetic and physical mapping of theCRbgene conferring resistance to clubroot disease inBrassica rapa. Molecular Breeding. 2014;34:1173-1183. DOI: 10.1007/s11032-014-0108-1
  63. 63. Suwabe K, Tsukazaki H, Iketani H, Hatakeyama K, Fujimura M, Nunome T, Fukuoka H, Matsumoto S, Hirai M. Identification of two loci for resistance to clubroot (Plasmodiophora brassicaeWoronin) inBrassica rapaL. Theoretical and Applied Genetics. 2003;107:997-1002. DOI: 10.1007/s00122-003-1309-x
  64. 64. Saito M, Kubo N, Matsumoto S, Suwabe K, Tsukada M, Hirai M. Fine mapping of the clubroot resistance gene,Crr3, inBrassica rapa. Theoretical and Applied Genetics. 2006;114:81-91. DOI: 10.1007/s00122-006-0412-1
  65. 65. Hirai M, Harada T, Kubo N, Tsukada M, Suwabe K, Matsumoto S. A novel locus for clubroot resistance inBrassica rapaand its linkage markers. Theoretical and Applied Genetics. 2004;108:639-643. DOI 10.1007/s00122-003-1475-x
  66. 66. Rahman H, Franke C. Association of fusarium wilt susceptibility with clubroot resistance derived from winterBrassica napusL. ‘Mendel’. Canadian Journal of Plant Pathology. 2019;41: 60-64. DOI: 10.1080/07060661.2018.1505780
  67. 67. Pu ZJ, Shimizu M, Zhang YJ, Nagaoka T, Hayashi T, Hori H, Matsumoto S, Fujimoto R, Okazaki K. Genetic mapping of a fusarium wilt resistance gene inBrassica oleracea. Molecular Breeding. 2012;30:809-818. DOI: 10.1007/s11032-011-9665-8

Written By

Mst Arjina Akter, Hasan Mehraj, Takeru Itabashi, Tomoe Shindo, Masaaki Osaka, Ayasha Akter, Naomi Miyaji, Naoki Chiba, Junji Miyazaki and Ryo Fujimoto

Submitted: September 17th, 2020 Reviewed: January 27th, 2021 Published: February 24th, 2021