Abstract
The Brassica genus comprises of agro-economically important vegetables. Disease causes great yield loss of Brassica vegetables worldwide. Different traditional methods such as crop rotation and chemical control have limited effect on different diseases of Brassica vegetables and cannot completely eradicate the pathogens by these methods. Development of disease resistant cultivars is one of the most effective, ecofriendly, and cheapest measure to control Brassica diseases. With the development of genomics, molecular biology techniques, and biological methods, it is possible to discover and introduce resistance (R) genes to efficiently control the plant diseases caused by pathogens. Some R genes of major diseases such as Fusarium wilt and clubroot in Brassica vegetables have been already identified. Therefore, we will focus to review the Fusarium wilt and clubroot resistance in Brassica vegetables and the methodologies for identification, mapping, and pyramiding of R genes/quantitative trait loci (QTLs) to develop disease resistant cultivars. These techniques will be helpful for sustainable crop production and to maintain global food security and contribute to ensure protection of food supply in the Asian country as well as throughout the world.
Keywords
- R gene
- marker assisted selection
- Fusarium wilt
- clubroot
- Brassica
1. Introduction
Brassica is a commercially important genus that contains vegetables, oilseeds, condiments, and fodder crops, and they provide nutrition and health-promoting substances to humans worldwide [1]. The commercially important vegetables such as Chinese cabbage (var.
Production of Brassica vegetables constantly threatened by emerging viral, bacterial, and fungal diseases, whose incidence has increased in recent years [2, 3]. The major diseases of Brassica vegetables are Black rot, clubroot, Downy mildew, Fusarium wilt, soft rot, and Turnip mosaic virus [2]. Cultural, physical, biological, or chemical controls, or a combination of these controls, integrated pest management, are used for disease control [2, 3]. However, soil-borne phytopathogens such as Fusarium wilt or clubroot are hard to control by physical and chemical methods, and they can survive in the soil for many years in dormant conditions and become devastating when they find suitable host [2, 3, 4]. Thus, breeding the disease resistant cultivars of Brassica vegetables, especially against soil-borne phytopathogens, is the best way for effective disease control. Recently, some disease resistance genes (
In this chapter, we focus on the Fusarium wilt and clubroot and present the breeding for these disease resistances in Brassica vegetables using DNA marker selection.
2. DNA marker selection for breeding Fusarium wilt disease resistant cultivars in Brassica vegetables
Fusarium wilt was first identified in the United States by Smith in the 1890s, and in the following decades it was subsequently found in Japan and several other countries [14, 15]. In recent years, Fusarium wilt has been overspread in China [16].
2.1 Traditional management
A number of traditional techniques have been adopted to manage Fusarium wilt disease. Crop rotation is effective to control Fusarium wilt disease [18], and soil solarization [19] and soil steam sterilization [20, 21] can suppress significantly the
2.2 Isolation of resistance genes
Most
2.3 DNA marker selection system
Selection by inoculation test is labor-intensive and highly influenced by the environmental factors, and selection of suitable plants highly depends on the experience of breeders. In contrast, DNA marker selection is rarely affected by the environmental conditions. DNA marker selection also has merits that it can be performed at early developmental stages, can handle many samples, and can test multiple traits in a sample [37]. Identification of
As the susceptible allele (
Primer sequence | PCR condition | R | S | Ref. | ||
---|---|---|---|---|---|---|
Bra012688m | F | AGTCGCTTGGAAGTCTGAGG | 1 cycle of 94 °C for 3 min, 35 cycles of 94 °C for 30s, 58 °C for 30s, and 72 °C for 1 min, and final extension at 72 °C for 3 min. | A | NA | [32, 33] |
R | GAGCTAACCAACTATACATTGAACC | |||||
YR688s | F | CTCCATCTGAGGATGGAAGTTGTACAAGCTCGGA | 1 cycle of 94 °C for 2 min, 35 cycles of 94 °C for 30s and 68 °C for 30s, and final extension at 68 °C for 2 min. This primer set is used with YR689s for multiplex PCR. | A | NA | |
R | GCTCCGAATTCGAATTGGTGAATATCGCATACGAG | |||||
SSR687int | F | CGTCAAAACCCTTTTGCCTA | 1 cycle of 94 °C for 2 min, 35 cycles of 94 °C for 30s, 58 °C for 30s, and 72 °C for 30s, and final extension at 72 °C for 2 min. This marker is co-dominant DNA marker | LB | SB | |
R | CAAACGCTCGGTCCTGAAAT | |||||
Bra012689m | F | GCATCAAGGCAAAAATGTCA | 1 cycle of 94 °C for 3 min, 35 cycles of 94 °C for 30s, 58 °C for 30s, and 72 °C for 1 min, and final extension at 72 °C for 3 min. | A | NA | [32, 33] |
R | CATTATAGTAGAACCCAAGTTGATCC | |||||
YR689s | F | CCACTCAGATGTCGTTGAGAAGTCTGATACCATCG | 1 cycle of 94 °C for 2 min, 35 cycles of 94 °C for 30s and 68 °C for 30s, and final extension at 68 °C for 2 min. This primer set is used with YR688s for multiplex PCR | A | NA | |
R | AGGAGACGACGACTGATCCACAAAGTGTGTATC |
Table 1.
DNA marker for predicting fusarium wilt resistance in
R, resistance; S, susceptible; A, amplification of PCR product; NA, no amplification of PCR product; LB, large sized band; SB, small sized band.

Figure 1.
Determining of Fusarium wilt resistance by DNA marker. A dominant DNA marker (Bra012688m) and co-dominant DNA marker (SSR687int) are used. Lane 3 and 4 show the heterozygosity of
In
Primer sequence | PCR condition | R | S | Ref. | ||
---|---|---|---|---|---|---|
Fusa-6 | F | TGATGCAAGTGTGGTGACAA | 1 cycle of 94 °C for 3 min, 35 cycles of 94 °C for 30s, 58 °C for 30s, and 72 °C for 1 min, and final extension at 72 °C for 3 min After PCR, | D | ND | [61] |
R | CAATCGCTTCTTGCTTCTCC | |||||
Fusa-4 | F | ATCATGGGATCGAGAGAAGCCGCCC | 1 cycle of 94 °C for 3 min, 35 cycles of 94 °C for 30s, 58 °C for 30s, and 72 °C for 1 min, and final extension at 72 °C for 3 min After PCR, | ND | D | [61] |
R | TAGCTTCATGCCATAGTCGTCCTGG | |||||
#1 | F | AGATTGTGCAATTAAACGCGACG | 1 cycle of 94 °C for 3 min, 35 cycles of 94 °C for 30s, 58 °C for 30s, and 72 °C for 1 min, and final extension at 72 °C for 3 min After PCR, | ND | D | [36] |
R | CATCCTCAGATTCCAAGCACAAC | |||||
#2 | F | GAAGTTGGGTAAAGAAATTGTTCGTGC | 1 cycle of 94 °C for 3 min, 35 cycles of 94 °C for 30s, 58 °C for 30s, and 72 °C for 1 min, and final extension at 72 °C for 3 min | SB | LB | [36] |
R | ATCCCAAGTTGATATCAGTAGGAAGAG | |||||
#3 | F | AATGGTTGCTCAATGAGAAGTATGC | 1 cycle of 94 °C for 3 min, 35 cycles of 94 °C for 30s, 58 °C for 30s, and 72 °C for 1 min, and final extension at 72 °C for 3 min After PCR, | ND | D | [36] |
R | GCCTCTGAAAGATCTGGAAAAAGAA |
Table 2.
DNA marker for predicting fusarium wilt resistance in
R, resistance; S, susceptible; D, PCR products are digested; ND, PCR products are not digested; LB, large sized band; SB, small sized band.
3. DNA marker selection for breeding clubroot disease resistant cultivars in Brassica vegetables
Clubroot is also one of the most devastating diseases in Brassica vegetables and spreads almost all over the world [39]. Clubroot disease is caused by an obligate plant pathogen
3.1 Traditional management
Clubroot is quite difficult to control completely by the traditional methods due to the long survival spores of the
Some biocontrol agents against
3.2 Isolation of resistance genes
In
In
3.3 DNA marker selection system
A breeding for clubroot resistance is much more complex compared with Fusarium wilt resistance due to the complexity of plant–pathogen interactions. A number of clubroot resistance locus has been identified by the different research groups in
Primer sequence | PCR condition | R | S | Ref. | ||
---|---|---|---|---|---|---|
CRaim-T | F | TATATTAATGATAAAGCAGAAGAAGAAA | 1 cycle of 94 °C for 3 min, 35 cycles of 94 °C for 30s, 58 °C for 30s, and 72 °C for 1 min, and final extension at 72 °C for 3 min. | A | NA | [33, 49] |
R | AATGCGACTGAGAAAGTTGTAG | |||||
Craim-Q | F | TGAAGAATGCGGGCTACGTCCTCTGAAATC | NA | A | ||
R | GAAGTAGATGAACGTGTTTATTTTAGAAA | |||||
TCR108 | F | CGGATATTCGATCTGTGTTCA | 1 cycle of 94 °C for 3 min, 35 cycles of 94 °C for 30s, 58 °C for 30s, and 72 °C for 1 min, and final extension at 72 °C for 3 min. | A | NA | [33, 62] |
R | AAAATGTATGTGTTTATGTGTTTCTGG | |||||
mCrr1a | F | CGATGACATGTCTGCCTTCT | 1 cycle of 94 °C for 3 min, 35 cycles of 94 °C for 30s, 58 °C for 30s, and 72 °C for 1 min, and final extension at 72 °C for 3 min. | SB | LB | [33] |
R | TCTGAGATTCAACCGCTTCA | |||||
B50-C9 | F | GATTCAATGCATTTCTCTCGAT | 1 cycle of 94 °C for 3 min, 35 cycles of 94 °C for 1 min, 55 °C for 1.5 min, and 72 °C for 2 min, and final extension at 72 °C for 7 min. | A | NA | [60] |
B50 | R | CGTATTATATCTCTTTCTCCATCCC | ||||
B50-6R | F | AATGCATTTTCGCTCAACC | NA | A | ||
B50 | R | CGTATTATATCTCTTTCTCCATCCC | ||||
HC688–4 | F | TCTCTGTATTGCGTTGACTG | 1 cycle of 94 °C for 3 min, 35 cycles of 94 °C for 1 min, 60 °C for 1.5 min, and 72 °C for 2 min, and final extension at 72 °C for 7 min. | A | NA | [60] |
HC688–6 | R | ATATGTTGAAGCCTATGTCT | ||||
HC688–4 | F | TCTCTGTATTGCGTTGACTG | NA | A | ||
HC688–7 | R | AAATATATGTGAAGTCTTATGATC | ||||
BRMS-096 | F | AGTCGAGATCTCGTTCGTGTCTCCC | 1 cycle of 94 °C for 1 min, 35 cycles of 94 °C for 1 min, 40 °C for 1 min, and 72 °C for 1 min, and final extension at 72 °C for 4 min. | LB | SB | [63] |
R | TGAAGAAGGATTGAAGCTGTTGTTG | |||||
OPC11–2S | F | GTAACTTGGTACAGAACAGCATAG | 1 cycle of 94 °C for 30s, 45 cycles of 94 °C for 30s, 40 °C for 1 min, and 72 °C for 2 min, and final extension at 72 °C for 7 min. | LB | SB | [64, 65] |
R | ACTTGTCTAATGAATGATGATGG |
Table 3.
DNA marker for predicting clubroot resistance in
R, resistance; S, susceptible; A, amplification of PCR product; NA, no amplification of PCR product; LB, large sized band; SB, small sized band.

Figure 2.
Determining of clubroot resistance by DNA marker. A dominant DNA marker (TCR108) or co-dominant DNA marker (OPC11–2S) is used in left or middle panel, respectively. In right panel, two primer sets (TCR108& OPC11–2S) were used for the simultaneous selection of multiple clubroot resistance genes.
In
4. Perspective
Both Fusarium wilt and clubroot are the serious disease for Brassica vegetables. Breeders are trying to develop the resistant lines for the both diseases by DNA marker assisted breeding. It has already been successfully developed Fusarium wilt and clubroot resistant lines. However, a Fusarium wilt resistant line can be infested by the clubroot or vice versa, while the clubroot has the virulence complexity. It is quite difficult to inoculate the multiple pathogens/races in an individual plant, while resistant breeding independently for each disease will make a further issue. DNA marker-based selection will enables us to overcome the mentioned issue. It has already found an association between a Fusarium wilt resistance allele and clubroot susceptible allele in
Acknowledgments
This chapter includes results supported by grants from Project of the NARO Bio-oriented Technology Research Advancement Institution (Research program on development of innovation technology).
References
- 1.
Lv H, Miyaji N, Osabe K, Akter A, Mehraj H, Shea DJ, Fujimoto R. The importance of genetic and epigenetic research in the Brassica vegetables in the face of climate change. In: Kole C, editor. Genomic Designing of Climate-Smart Vegetable Crops. Cham: Springer; 2020. p. 161-255. DOI: 10.1007/978-3-319-97415-6_3 - 2.
Lv H, Fang Z, Yang L, Zhang Y, Wang Y. An update on the arsenal: Mining resistance genes for disease management of Brassica crops in the genomic era. Horticulture Research. 2020;7:34. DOI: 10.1038/s41438-020-0257-9 - 3.
Mehraj H, Akter A, Miyaji N, Miyazaki J, Shea DJ, Fujimoto R, Doullah MA. Genetics of clubroot and Fusarium wilt disease resistance in Brassica vegetables: The application of marker assisted breeding for disease resistance. Plants. 2020;9:726. DOI: 10.3390/plants9060726 - 4.
Shlevin E, Mahrer Y, Katan J. Effect of moisture on thermal inactivation of soilborne pathogens under structural solarization. Phytopathology. 2004;94:132-137. DOI: 10.1094/PHYTO.2004.94.2.132 - 5.
Armstrong GM, Armstrong JK. Formae speciales and races of Fusarium oxysporum causing wilt diseases. In: Nelson PE, Toussoun TA, editors. Fusarium: Diseases, Biology and Taxonomy. University Park, Pennsylvania: Pennsylvania State University Press; 1981. p. 391-399 - 6.
Lievens B, Houterman PM, Rep M. Effector gene screening allows unambiguous identification of Fusarium oxysporum f. sp.lycopersici races and discrimination from otherformae speciales . FEMS Microbiology Letters. 2009;300:201-215. DOI: 10.1111/j.1574-6968.2009.01783.x - 7.
MacHardy WE, Beckman CH. Vascular wilt Fusaria: Infection and pathogenesis. In: Nelson PE, Toussoun TA, editors. Fusarium: Disease, Biology, and Taxonomy. University Park, Pennsylvania: Pennsylvania State University Press; 1981. p. 365-390 - 8.
Fourie G, Steenkamp ET, Ploetz RC, Gordon TR, Viljoen A. Current status of the taxonomic position of Fusarium oxysporum formae specialis cubense within theFusarium oxysporum complex. Infection, Genetics and Evolution. 2011;11:533-542. DOI: 10.1016/j.meegid.2011.01.012 - 9.
Dean R, Van Kan JAL, Pretorius ZA, Hammond-Kosack KE, Di Pietro A, Spanu PD, Rudd JJ, Dickman M, Kahmann R, Ellis J, Foster GD. The top 10 fungal pathogens in molecular plant pathology. Molecular Plant Pathology. 2012;13:414-430. DOI: 10.1111/j.1364-3703.2011.00783.x - 10.
Khan N, Maymon M, Hirsch AM. Combating Fusarium infection usingBacillus -based antimicrobials. Microorganisms. 2017;5:75. DOI: 10.3390/microorganisms5040075 - 11.
Sun Y, Wang M, Li Y, Gu Z, Ling N, Shen Q , Guo S. Wilted cucumber plants infected by Fusarium oxysporum f. sp.cucumerinum do not suffer from water shortage. Annals of Botany. 2017;120:427-436. DOI: 10.1093/aob/mcx065 - 12.
de Lamo FJ, Takken FLW. Biocontrol by Fusarium oxysporum using endophyte-mediated resistance. Frontiers in Plant Science. 2020;11:37. DOI: 10.3389/fpls.2020.00037 - 13.
Edel-Hermann V, Lecomte C. Current status of Fusarium oxysporum formae speciales and races. Phytopathology. 2019;109:512-530. DOI: 10.1094/PHYTO-08-18-0320-RVW - 14.
Smith EF. The fungus infection of agricultural soils in the United States. Scientific American Supplementary. 1899;48:19981-19982. DOI: 10.1038/scientificamerican11181899-19981supp - 15.
Gillman JC. Cabbage yellows and the relation of temperature to its occurrence. Annals of the Missouri Botanical Garden. 1916;3:25-84. DOI: 10.2307/2990072 - 16.
Xing M, Lv H, Ma J, Xu D, Li H, Yang L, Kang J, Wang X, Fang Z. Transcriptome profiling of resistance to Fusarium oxysporum f. sp.conglutinans in cabbage (Brassica oleracea ) roots. PLoS ONE. 2016;11:e0148048. DOI: 10.1371/journal.pone.0148048 - 17.
Gaetán SA. Occurrence of Fusarium wilt on canola caused by Fusarium oxysporum f. sp.conglutinans in Argentina. Plant Disease. 2005;89:432-432. DOI: 10.1094/PD-89-0432C - 18.
Shafique HA, Sultana V. Ehteshamul-Haque S, Athar M. Management of soil-borne diseases of organic vegetables. Journal of Plant Protection Research. 2016;56:221-230. DOI: 10.1515/jppr-2016-0043 - 19.
Ramirez-Villapudua J, Munnecke DE. Control of cabbage yellow ( Fusarium oxysporum f. sp.conglutinans ) by solar heating of field soils amended with dry cabbage residues. Plant Disease. 1987;71:217-221. DOI: 10.1094/PD-71-0217 - 20.
Afek U, Orenstein J. Disinfecting potato tubers using steam treatments. Canadian Journal of Plant Pathology. 2002;24:36-39. DOI: 10.1080/07060660109506968 - 21.
Panth M, Hassler SC, Baysal-Gurel F. Methods for management of soilborne diseases in crop production. Agriculture. 2020;10:16. DOI: 10.3390/agriculture10010016 - 22.
Song W, Zhou L, Yang C, Cao X, Zhang L, Liu X. Tomato Fusarium wilt and its chemical control strategies in a hydroponic system. Crop Protection. 2004;23:243-247. DOI: 10.1016/j.cropro.2003.08.007 - 23.
Uesugi Y. Fungicide Classes: Chemistry, Uses and Mode of Action. In: Hutson D, Miyamoto J, editors. Fungicidal activity: Chemical and biological approaches to plant protection. New York: John Wiley & Sons; 1998. p. 23-56 - 24.
Ma YT, Fan HF, Gao YQ , Li H, Zhang AL, Gao JM. Natural products as sources of new fungicides (I): synthesis and antifungal activity of acetophenone derivatives against phytopathogenic fungi. Chemical Biology & Drug Design. 2013;81:545-552. DOI: 10.1111/cbdd.12064 - 25.
Colla P, Garibaldi A, Gullino ML. A review and critical analysis of the European situation of soilborne disease management in the vegetable sector. Phytoparasitica. 2012;40:515-523. DOI: 10.1007/s12600-012-0252-2 - 26.
Colla P, Garibaldi A, Gullino ML. Consequences of European pesticide policies enforcement in soil disinfestation sector. Acta Horticulturae. 2014;1044:363-366. DOI: 10.17660/ActaHortic.2014.1044.48 - 27.
Arie T. Fusarium diseases of cultivated plants, control, diagnosis, and molecular and genetic studies. Journal of Pesticide Science. 2019;44:275-281. DOI: 10.1584/jpestics.J19-03 - 28.
Gilardi G, Demarchi S, Moizio M, Gullino ML, Garibaldi A. Disease management strategies against Fusarium wilt of basil and rocket by combining amendments and soil solarization. Acta Horticulturae. 2014;1044:319-324. DOI: 10.17660/ActaHortic.2014.1044.41 - 29.
Meyers BC, Kozik A, Griego A, Kuang H, Michelmore RW. Genome-wide analysis of NBS–LRR-encoding genes in Arabidopsis. The Plant Cell. 2003;15:809-834. DOI: 10.1105/tpc.009308 - 30.
Joshi RK, Nayak S. Functional characterization and signal transduction ability of nucleotide-binding site-leucine-rich repeat resistance genes in plants. Genetics and Molecular Research. 2011;10:2637-2652. DOI: 10.4238/2011.October.25.10 - 31.
Marone D, Russo MA, Laidò G, De Leonardis AM, Mastrangelo AM. Plant nucleotide binding site-leucine-rich repeat (NBS-LRR) genes: active guardians in host defense responses. International Journal of Molecular Sciences. 2013;14:7302-7326. DOI: 10.3390/ijms14047302 - 32.
Shimizu M, Fujimoto R, Ying H, Pu ZJ, Ebe Y, Kawanabe T, Saeki N, Taylor JM, Kaji M, Dennis ES, Okazaki K. Identification of candidate genes for fusarium yellows resistance in Chinese cabbage by differential expression analysis. Plant Molecular Biology. 2014;85:247-257. DOI: 10.1007/s11103-014-0182-0 - 33.
Kawamura K, Kawanabe T, Shimizu M, Nagano AJ, Saeki N, Okazaki K, Kaji M, Dennis ES, Osabe K, Fujimoto R. Genetic characterization of inbred lines of Chinese cabbage by DNA markers; towards the application of DNA markers to breeding of F1 hybrid cultivars. Data in Brief. 2016;6:229-237. DOI: 10.1016/j.dib.2015.11.058 - 34.
Lv H, Fang Z, Yang L, Zhang Y, Wang Q , Liu Y, Zhuang M, Yang Y, Xie B, Liu B, Liu J, Kang J, Wang X. Mapping and analysis of a novel candidate Fusarium wilt resistance gene FOC1 inBrassica oleracea . BMC Genomics. 2014;15:1094. DOI: 10.1186/1471-2164-15-1094 - 35.
Shimizu M, Pu ZJ, Kawanabe T, Kitashiba H, Matsumoto S, Ebe Y, Sano M, Funaki E, Fujimoto R, Okazaki K. Map-based cloning of a candidate gene conferring Fusarium yellows resistance in Brassica oleracea . Theoretical and Applied Genetics. 2015;128:119-130. DOI: 10.1007/s00122-014-2416-6 - 36.
Sato M, Shimizu M, Shea DJ, Hoque M, Kawanabe T, Miyaji N, Fujimoto R, Fukai E, Okazaki K. Allele specific DNA marker for fusarium resistance gene FocBo1 inBrassica oleracea . Breeding Science. 2019;69:308-315. DOI: 10.1270/jsbbs.18156 - 37.
Collard BYC, Mackill DJ. Marker-assisted selection: an approach for precision plant breeding in the twenty-first century. Philosophical Transactions of the Royal Society B. 2008;363:557-572. DOI: 10.1098/rstb.2007.2170 - 38.
Hirani AH, Gao F, Liu J, Fu G, Wu C, Yuan Y, Hou J, Duncan R, Li G. Transferring clubroot resistance from Chinese cabbage ( Brassica rapa ) to canola (B. napus ). Canadian Journal of Plant Pathology. 2016;38:82-90. DOI: 10.1080/07060661.2016.1141799 - 39.
Hirani AH, Li G. Understanding the genetics of clubroot resistance for effectively controlling this disease in Brassica species. In: Hany El-Shemy, editor. Plants for the Future. IntechOpen; 2015. DOI: 10.5772/60936 - 40.
Kageyama K, Asano T. Life cycle of Plasmodiophora brassicae . Journal of Plant Growth Regulation. 2009;28:203-211. DOI: 10.1007/s00344-009-9101-z - 41.
Tommerup IC, Ingram DS. The life-cycle of Plasmodiophora brassicae Woron. InBrassica tissue cultures and in intact roots. New Phytologist. 1971;70:327-332. DOI: 10.1111/j.1469-8137.1971.tb02531.x - 42.
Wallenhammar AC, Johnsson L, Gerhardson B. Agronomic performance of partly clubroot-resistant spring oilseed turnip rape lines. Journal of Phytopathology. 2000;148:495-499. DOI: 10.1046/j.1439-0434.2000.00536.x - 43.
Faggian R, Strelkov SE. Detection and Measurement of Plasmodiophora brassicae . Journal of Plant Growth Regulation. 2009;28:282-288. DOI: 10.1007/s00344-009-9092-9 - 44.
Daniel C, Hommes M, Koller M. Plant protection in organic production of Brassica vegetables and oilseed rape. IOBC-WPRS Bulletin. 2016;118:110-115 - 45.
Peng G, McGregor L, Lahlali R, Gossen BD, Hwang SF, Adhikari KK, Strelkov SE, McDonald MR. Potential biological control of clubroot on canola and crucifer vegetable crops. Plant Pathology. 2011;60:566-574. DOI: 10.1111/j.1365-3059.2010.02400.x - 46.
Wang J, Huang Y, Lin S, Liu F, Song Q , Peng Y, Zhao L. A strain of Streptomyces griseoruber isolated from rhizospheric soil of Chinese cabbage as antagonist toPlasmodiophora brassicae . Annals of Microbiology. 2012;62:247-253. DOI: 10.1007/s13213-011-0253-2 - 47.
Donald C, Porter I. Integrated control of clubroot. Journal of Plant Growth Regulation. 2009;28:289-303. DOI: 10.1007/s00344-009-9094-7 - 48.
Donald EC, Porter IJ, Faggian R, Lancaster RA. An integrated approach to the control of clubroot in vegetable Brassica crops. Acta Horticulturae. 2006;706:283-300. DOI: 10.17660/ActaHortic.2006.706.33 - 49.
Ueno H, Matsumoto E, Aruga D, Kitagawa S, Matumura H, Hayashida N. Molecular characterization of the CRa gene conferring clubroot resistance inBrassica rapa . Plant Molecular Biology. 2012;80:621-629. DOI: 10.1007/s11103-012-9971-5 - 50.
Hatakeyama K, Suwabe K, Tomita RN, Kato T, Nunome T, Fukuoka H, Matsumoto S. Identification and characterization of Crr1a , a gene for resistance to clubroot disease (Plasmodiophora brassicae Woronin) inBrassica rapa L. PLoS ONE. 2013;8:e54745. DOI: 10.1371/journal.pone.0054745 - 51.
Hatakeyama K, Niwa T, Kato T, Ohara T, Kakizaki T, Matsumoto S. The tandem repeated organization of NB-LRR genes in the clubroot-resistant CRb locus inBrassica rapa L. Molecular Genetics and Genomics. 2017;292:397-405. DOI: 10.1007/s00438-016-1281-1 - 52.
Laila R, Park JI, Robin AHK, Natarajan S, Vijayakumar H, Shirasawa K, Isobe S, Kim HT, Nou IS. Mapping of a novel clubroot resistance QTL using ddRAD-seq in Chinese cabbage ( Brassica rapa L.). BMC Plant Biology. 2019;19:13. DOI: 10.1186/s12870-018-1615-8 - 53.
Karim MM, Dakouri A, Zhang Y, Chen Q , Peng G, Strelkov SE, Gossen BD, Yu F. Two clubroot-resistance genes, Rcr3 andRcr9wa , mapped inBrassica rapa using bulk segregant RNA sequencing. International Journal of Molecular Sciences. 2020;21:5033. DOI: 10.3390/ijms21145033 - 54.
Choi SR, Oh SH, Chhapekar SS, Dhandapani V, Lee CY, Rameneni JJ, Ma Y, Choi GJ, Lee SS, Lim YP. Quantitative trait locus mapping of clubroot resistance and Plasmodiophora brassicae pathotype Banglim-specific marker development inBrassica rapa . International Journal of Molecular Sciences. 2020;21:4157. DOI: 10.3390/ijms21114157 - 55.
Tomita H, Shimizu M, Doullah MA, Fujimoto R, Okazaki K. Accumulation of quantitative trait loci conferring broad-spectrum clubroot resistance in Brassica oleracea . Molecular Breeding. 2013;32:889-900. DOI: 10.1007/s11032-013-9918-9 - 56.
Kuginuki Y, Yoshikawa H, Hirai M. Variation in virulence of Plasmodiophora brassicae in Japan tested with clubroot-resistant cultivars of Chinese cabbage (Brassica rapa L. ssp.pekinensis ). European Journal of Plant Pathology. 1999;105:327-332. DOI: 10.1023/A:1008705413127 - 57.
Hatakeyama K, Fujimura M, Ishida M, Suzuki T. New classification method for Plasmodiophora brassicae field isolates in Japan based on resistance of F1 cultivars of Chinese cabbage (Brassica rapa L.) to clubroot. Breeding Science. 2004;54:197-201. DOI: 10.1270/jsbbs.54.197 - 58.
Neik TX, Barbetti MJ, Batley J. Current status and challenges in identifying disease resistance genes in Brassica napus . Frontiers in Plant Science. 2017;8:1788. DOI: 10.3389/fpls.2017.01788 - 59.
Strelkov SE, Hwang SF, Manolii VP, Cao T, Fredua-Agyeman R, Harding MW, Peng G, Gossen BD, Mcdonald MR, Feindel D. Virulence and pathotype classification of Plasmodiophora brassicae populations collected from clubroot resistant canola (Brassica napus ) in Canada. Canadian Journal of Plant Pathology. 2018;40:284-298. DOI: 10.1080/07060661.2018.1459851 - 60.
Matsumoto E, Ueno H, Aruga D, Sakamoto K, Hayashida N. Accumulation of three clubroot resistance genes through marker-assisted selection in Chinese cabbage ( Brassica rapa spp. pekinensis ). Journal of the Japanese Society for Horticultural Science. 2012;81:184-190. DOI: 10.2503/jjshs1.81.184 - 61.
Kawamura K, Shimizu M, Kawanabe T, Pu Z, Kodama T, Kaji M, Osabe K, Fujimoto R, Okazaki K. Assessment of DNA markers for seed contamination testing and selection of disease resistance in cabbage. Euphytica. 2017;213:28. DOI: 10.1007/s10681-016-1821-0 - 62.
Zhang T, Zhao Z, Zhang C, Pang W, Choi SR, Lim YP, Piao Z. Fine genetic and physical mapping of the CRb gene conferring resistance to clubroot disease inBrassica rapa . Molecular Breeding. 2014;34:1173-1183. DOI: 10.1007/s11032-014-0108-1 - 63.
Suwabe K, Tsukazaki H, Iketani H, Hatakeyama K, Fujimura M, Nunome T, Fukuoka H, Matsumoto S, Hirai M. Identification of two loci for resistance to clubroot ( Plasmodiophora brassicae Woronin) inBrassica rapa L. Theoretical and Applied Genetics. 2003;107:997-1002. DOI: 10.1007/s00122-003-1309-x - 64.
Saito M, Kubo N, Matsumoto S, Suwabe K, Tsukada M, Hirai M. Fine mapping of the clubroot resistance gene, Crr3 , inBrassica rapa . Theoretical and Applied Genetics. 2006;114:81-91. DOI: 10.1007/s00122-006-0412-1 - 65.
Hirai M, Harada T, Kubo N, Tsukada M, Suwabe K, Matsumoto S. A novel locus for clubroot resistance in Brassica rapa and its linkage markers. Theoretical and Applied Genetics. 2004;108:639-643. DOI 10.1007/s00122-003-1475-x - 66.
Rahman H, Franke C. Association of fusarium wilt susceptibility with clubroot resistance derived from winter Brassica napus L. ‘Mendel’. Canadian Journal of Plant Pathology. 2019;41: 60-64. DOI: 10.1080/07060661.2018.1505780 - 67.
Pu ZJ, Shimizu M, Zhang YJ, Nagaoka T, Hayashi T, Hori H, Matsumoto S, Fujimoto R, Okazaki K. Genetic mapping of a fusarium wilt resistance gene in Brassica oleracea . Molecular Breeding. 2012;30:809-818. DOI: 10.1007/s11032-011-9665-8