Open access peer-reviewed chapter

Interlinks between Wildlife and Domestic Cycles of Echinococcus spp. in Kenya

By Dorothy Kagendo, Eric Muchiri, Peter Gitonga and Esther Muthoni

Submitted: June 5th 2020Reviewed: October 23rd 2020Published: November 12th 2020

DOI: 10.5772/intechopen.94612

Downloaded: 218

Abstract

Effective conservation and management of wildlife in the current changing world, call for incorporation of infectious zoonotic diseases surveillance systems, among other interventions. One of such diseases is echinococcosis, a zoonotic disease caused by Echinococcus species. This disease exists in two distinct life cycle patterns, the domestic and wildlife cycles. To investigate possible inter-links between these cycles in Kenya, 729 fecal samples from wild carnivores and 406 from domestic dogs (Canis lupus familiaris) collected from Maasai Mara and Samburu National Reserves were analyzed. Taeniid eggs were isolated by zinc chloride sieving-flotation method and subjected to polymerase chain reaction of nicotinamide adenine dehydrogenase subunit 1 (NAD1). Subsequent amplicons were sequenced, edited and analyzed with GENtle VI.94 program. The samples were further subjected to molecular identification of specific host species origin. All sequences obtained were compared with those in Gene-bank using Basic Local Alignment Search Tool (BLAST). The study found that there were 74 taeniid positive samples, 53 from wild carnivores and 21 from domestic dogs. In wildlife, mixed infections with Echinococcus and Taenia species were identified and these included E. granulosus sensu stricto, E. felidis, T. canadensis G6/7, Taenia hydatigena, T. multiceps, and T. saginata. Domestic dogs harbored Echinococcus and Taenia species similar to wild carnivores including E. granulosus G1–3, E. felidis, T. multiceps, T. hydatigena, and T. madoquae. Taenia species of nine taeniid eggs were not identified. Majority of genotypes were found in hyena (Crocuta crocuta) fecal samples. Distribution of Echinococcus and Taenia spp. varied with hosts. Mixed infections of Echinococcus spp, T. multiceps and T. hydatigena in a single animal were common. There seemed to be existence of interactions between the two cycles, although public health consequences are unknown. The presence of T. saginata in hyena suggests scavenging of human fecal matter by the animal. In addition, presence of T. multiceps, T hydatigena, T madoquae and T. saginata in the two cycles suggested possible human exposure to these parasites. The results are important in drawing up of strategies and policies towards prevention and control of Echinococcosis and other Taenia related parasitic infections, especially in endemic areas given their potential risk to public and socio- economic livelihood.

Keywords

  • conservation
  • management wildlife
  • Echinococcosis
  • Taenia species

1. Introduction

1.1 Importance of wildlife conservation and management

Wildlife conservation and management is the process of caring for wild animal species and their environments from destruction, including preserving rare species from extinction. All this is done to sustain a better balance within an ecosystem as well as maintaining the beauty of mother nature [1, 2, 3]. In cases where the balance is interrupted, for example in communities where wild carnivores are killed due to wildlife-human conflicts, it may lead to overpopulation of wild-herbivores, and consequently translate into overgrazing of the available vegetation and deforestation [4, 5]. For centuries wildlife, has been reported to serve as a source of food, thus sustaining human life through provision of products such as honey and bush meat [6]. Where strict wildlife management procedures are observed, the chances for transmission of zoonotic diseases are reduced and therefore, good health and disease-free populations [7]. Due to improved wildlife conservation and management strategies, the economy of many countries globally has improved due to income generated from tourism attraction [3]. Tourist visits have in turn led to enhanced social and cultural livelihood in different communities, the Maasai and Samburu of Kenya included [3, 8].

Advertisement

2. Challenges facing wildlife species

In Africa wildlife has faced great challenges, often attributed to human activities including encroachment into wildlife sanctuaries and loss of habitats [9]. Other challenges include poaching and illegal wildlife trade, activities that have led to the declining numbers of wild animals’ overtime [8, 10, 11]. Besides loss of habitats, poaching, pollution, climate change and invasive species, emerging and re-emerging zoonotic diseases are increasingly featuring as a major challenge in wildlife conservation. The current wild pandemic of covid-19 is a major example of such diseases, transferable from animals to human or/and vice versa which often happen when human encroach wildlife sanctuaries, and affect the balance of Nature, for example, deforestation and modification of natural habitats as a result of land use and land cover changes is responsible for outbreak of about 50% of the emerging zoonoses [12].

Advertisement

3. Emergence of infectious zoonotic diseases

Wide range of pollutants affects wildlife health and sometimes lead to animal death. Diseases in wildlife influence several biological factors like reproduction, survival fitness and abundance of wildlife species [13]. Often arthropods and other animal species of wildlife origin have been reported to transmit diseases including Nile fever, Lyme disease, Encephalomyelopathies, COVID-19, Bovine tuberculosis, among other zoonotic diseases. Ben (2014) stated need for humans to refrain from anthropocentric attitudes towards wildlife and learn a need for respect to ecosystems, emphasizing on major benefits that exist when the balance in nature is maintained. In their report, Vila and group of scientists reported endoparasites causing zoonotic diseases in cattle and wild animals in Europe [14, 15]. The Asian tiger mosquito (Aedes albopictus)was reported as a vector that caused over 22 Arboviruses worldwide. The mosquito has been reported to have caused outbreaks of dengue and chikungunya in Northern Italy [16]. During the time, the dengue fever was cited as a major cause of deaths in children in moat of the Asian countries [16]. In the African continent, tsetse fly (genus Glossina) has been reported to cause trypanosomiasis in both humans and livestock [15, 17, 18]. Simwango et al. [18] linked exposure of the Maasai people to zoonotic diseases, with their frequent interactions with wildlife. A recent emerging zoonotic disease, COVID-19, caused by Corona virus with impacts to over 210 countries worldwide [12, 19], is linked to animal human transmission cycle [20, 21]. The current emergence of viruses, parasites and bacteria as significant pathogens, originate mainly from human encroachment areas [22]. These organisms had the capability of reducing body immunity and causing acute illnesses that could often be fatal. Helminths, trematodes and cestodes are important parasitic human-wildlife diseases. In East Africa most of the diseases are augmented by the closeness of pastoralists with their livestock into wildlife sanctuaries, especially during cattle herding [23]. However, only limited data on interlinks between human and wildlife disease cycles exist. The impact of emerging and re-emerging zoonotic diseases is a nightmare, which continues to cause heavy pandemics worldwide, more effect being felt in developing countries including Kenya [24]. It is worth noting that zoonotic diseases found in human-wildlife interfaces are complex, and thus hard to predict on time.

Advertisement

4. Echinococcosis: a zoonotic diseases

Cystic echinococcosis (CE) is a zoonotic disease of human and animals (livestock and wildlife), caused by larval stages of tapeworms of dogs and other carnivores. The disease occurs worldwide, but is particularly prevalent under conditions of extensive livestock keeping, uncontrolled slaughter and low levels of hygiene [25]. In sub-Saharan Africa, CE is a serious public health and economic problem in the eastern and southern parts, especially for pastoralists and nomadic communities, but reliable data are limited [25]. Effective control is prevented by inadequate resources and limited knowledge about the epidemiology. Several Hydatid cysts may occupy space on a lung, liver or kidney making it difficult for the person or animal to breath. The parasite exists in two distinct life cycle patterns, namely the domestic and the wildlife cycles [9].

Humans get cystic echinococcosis after ingestion of Taeniid eggs that may have been shed through feces of domestic dogs (in the domestic cycle) and/or wild carnivores in the wildlife cycle. Echinococcus granulosuss.l. is a cestode parasite of the family Taeniidae.The parasite is made up of at least five species, namely; E. granulosussensu stricto, E. equinus, E. ortleppi, E. canadensisand E. felidis.Distribution of these cestode taxa vary greatly across the globe. However sub-Saharan Africa is by far the most diverse region with all species of E. granulosussensu lato found, with exception of the genotypes G8 and G10 of E. canadensis.[26, 27].

Globally. granulosussensu stricto (s. s). is the most important agent for human CE in both humans and animals [28, 29]. Contributions of E. equinusand E. felidisin human CE is non-existent, that of E. ortleppiis very marginal and E. canadensisG6/7 is only about 11% [27, 29]. The case report of genotype E. granulosusGomo from an Ethiopian patient by Wassermann et al.,reported in 2016 as well as the prevalence of several E. granulosustaxa in countries such as Kenya present aspects of the disease that is not yet fully understood.

In Kenya, it has been unveiled that the two transmission patterns of Echinococcusexist and an initial observation of an interface was reported previously [9]. Global control of CE in domestic settings is very complex and presents a variation of challenging factors in endemic regions such as illiteracy, poor road networks, social cultural beliefs, and poverty [22, 30]. In parts of Africa, control of CE has only been partially achieved despite establishment of long-term control programs [31, 32]. The diversity of species, a wide range of hosts and various cultural practices in sub-Saharan Africa have made control strategies of CE in the region less successful. Therefore, sylvatic-domestic transmission interface presents a new aspect of Echinococcus species that is the least understood. In Africa, where diversity of E. granulosus(sensu lato) is very high, elucidation of the sylvatic-domestic interaction is very essential. A recent study reported E. felidis, a strain well adapted to lions in the wildlife and also a sister species to the global problematic E. granulosus(sensu stricto) in domestic dogs [29]. The pathogenicity of E. felidisto domestic animals remains unknown. In 2014, Kagendo et al., isolated E. granulosuss. s. eggs from lion feces, however the extent of actual transmission in the wildness or how the lions contracted the taxa was a mare speculation, since there were only a few reports showing the taxa to have been isolated in a stool sample from a warthog [33]. The present study aimed to evaluate the interaction of the sylvatic and domestic cycles of this zoonotic disease in areas adjacent to the national reserves in Kenya.

Advertisement

5. Materials and methods

5.1 Study areas

The study was done in two cystic Echinococcosis (CE) endemic areas of Maasai Mara and Samburu National reserves. The Maasai Mara National Reserve, situated in the northern part of Tanzania’s Serengeti National Park occupies 1500 km2 [9]. The Reserves a part of the Greater Serengeti-Mara Ecosystem which is globally popular for unique phenomenon of wildebeest’s migration. The ecosystem has suitable vegetation and climatic conditions supporting a variety of wild animals, livestock and human beings. In this case, co-existence of wild animals with pastoral communities in the area is evident [9].

Samburu national reserve covers about 165 km2. Human beings, livestock and wild animals in are primarily dependent on the river ‘Ewaso Nyiro’. Human and wildlife interactions are therefore a common phenomenon, with wild carnivores often preying on livestock and humans fighting back and killing the predators.

5.2 Collection of study samples and isolation of Taeniid eggs

Fecal samples of wild carnivores were collected from the environment by following signs and tracks [34]. Similarly, freshly dropped fecal samples of domestic dogs were collected within the homesteads in the two areas. Taeniid eggs were isolated from 3 g of the fecal samples using the Zinc floatation method and subsequent microscopy identification [35] (Figures 1 and 2).

Figure 1.

The Maasai Mara wildlife human interface areas where samples were collected.

Figure 2.

The Samburu wildlife human interface areas where samples were collected.

5.3 Sample processing

5.4 DNA isolation for PCR

Individual taeniid eggs were picked under the microscope, lysed in 10 μl of 0.02 N NaOH solution. Lysates were used for amplification of the short fragment of NADH dehydrogenase Sub unit 1 gene (nad1) of Echinococcus sppand other Taenia species[36](Figure 3).

Figure 3.

Steps during fecal sample processing.

5.5 Polymerase chain reaction and gene sequencing of nad1positive amplicons

Amplification of a 200 bp long fragment of nad1was done in a primary PCR using Nadnest A 5’-TGTTTTTGAGATCAGTTCGGTGTG3’ and Nadnest C 5’ CATAATCAAACGGAGTACGATAG −3′ primers in a 25 μl mix that was constituted using 1x dream Taq green buffer (20 nM Tris–HCl pH 8), 0.2 mM dNTPs, 0.25 μM of each forward and reverse primer, 2 mM MgCl2 and 0.625 U of dream Taq green DNA polymerase (Thermo scientific) and 2 μl of the target DNA template. A nested PCR was done using Nadnest 5’_B CAGTTCGGTGTGCTTTTGGGTCTG-3′ and Nadnest D 5’-GAGTACGATTAGTCTCACACAGCA primers in a 25 μ mixture of same constitution as the primary PCR the use of 1 μl of the of the primary PCR amplicon as a source of DNA template [33]. Cycling conditions of primary and nested PCRs were the same; initial denaturation for 5 minutes at 94°C, and a 35-cycle involving denaturation at 94 0Cfor 30 s, elongation at 55°C for 30 s and annealing at 72°C for 1 minutes., and a final extension at 72°C for 5 minutes. Detection of amplicons was done on a 2% gel red stained agarose gel. All nad1positive individual samples were purified using high pure product purification kit (Roche, Germany) and sequenced using the reverse primer at GATC Biotech AG, Germany.

5.6 DNA sequence analysis and taeniid parasite identification

DNA Sequences were viewed and edited using the GENtle software (Manske M. 2003, University of Cologne, Germany). Clean DNA sequences were then compared with existing sequences in the NCBI GenBank using the Basic Local Alignment Search Tool (BLAST).

5.7 Wild carnivore host identification

Host specificity of all taeniid positive samples from the environment of the parks were done by a method previously described [33]. A PCR system using primer pairs forward 5’-TCATTCATTGA(C/T) CT(C/T) CCCAC(C/T) CCA-3’and reverse 5’-ACGGTA(A/G) GACATA(A/T) CC(C/T) ATGAA(G/T) G-3′ for primary reaction and a secondary reaction with primer pairs forward CA(C/T) CCAA(C/T) ATCTCAGCATGAA and reverse 5′-(G/T) GC(G/T) GTAGCTAT(A/T) ACTGTGAA(C/T) A(A/G)-3′ were used to amplify partial fragment of the cobgene. A different primer pair was used for amplification of cob sequence of domestic dogs including lupus for cob5’-CATCTAACATCTCTGCTTGATG-3’and lupus rev 5’-CTGTGGCTATGGTTGCGAATAA-3′. The subsequent cob PCR amplicons were purified and sequenced, then used in identification of host origin by comparing to earlier gene bank entries including; hyena (NC_020670), leopard (NC_010641), lion (KC495058) and domestic dogs (NC 002008).

Advertisement

6. Results

6.1 Echinococcusand Taeniaspp. in wild carnivores of Maasai Mara and Samburu national reserves

A total of 729 fecal samples of wild carnivores from Maasai Mara (387) and Samburu (342) were screened for taeniideggs and subsequently characterized to the cestode species level. Of these 53 fecal samples contained taeniideggs, out of which 521 eggs were isolated. Each egg was treated as isolate in the subsequent molecular analysis. All isolated eggs were screened by a PCR test for Taeniidaeamplification of a partial fragment of the NADH dehydrogenase subunit 1 (nad1) which yielded 183/521 (35%) taeniid positive from the two parks; Maasai Mara (86/183) and Samburu (97/183).

DNA sequence analysis of the taeniideggs revealed occurrence of E. granulosus(G1-G3) and E. felidisin Maasai Mara National Reserve. In Samburu National Reserves there were E. granulosus(G1-G3), E. felidis,and E. canadensisG6/7 (Table 1). Three Taeniaspp. were identified in the two National Reserves -Taenia multiceps,and T. hydatigenafrom Maasai Mara and T. hydatigena, T. multicepsand T. saginatain Samburu (Table 1).

ParkAnimal hostn taeniid positive / n samplesn taeniid positive PCR / n eggs screenedEchinococcusand Taeniaspp.
SamburuCrocuta crocuta(Spotted hyena)13/34251/15630 E. felidis, 14 E. granulosus(G1-G3), 6 T.hydatigena,T. saginata
Panthera leo(Lion)3/34211/364 E. felidis,5 E. granulosus(G1-G3), 2 T. hydatigena
Canis lupus familiaris(Domestic dog)6/34213/728 E. felidis, 2 E. granulosus(G1-G3), 1 E. canadensisG6/7, 1 T.hydatigena,T. multiceps
Canis adustus (Side striped jackal)1/3425/122 E. felidis, 3 E. granulosus(G1-G3)
Unidentified host4/34217/609 E. felidis, 7 E. granulosus(G1-G3), 1 E. canadensisG6/7
Maasai MaraCrocuta crocuta(Spotted hyena)17/38761/19741 E. felidis,18 T. hydatigena, 2 T. multiceps
Panthera leo(Lion)4/38712/489 E. felidis, 1 T. hydatigena, 2 T. multiceps
Canis lupus familiaris(Domestic dog)1/3875/124 E. felidis,T. hydatigena
Unidentified host4/3878/483 E. felidis,1 E. granulosus(G1-G3), 2 T. hydatigena,T. multiceps

Table 1.

Echinococcusand Taeniaspp. among carnivorous hosts of the Maasai Mara and Samburu National Reserves.

6.2 Confirmation of wild carnivore hosts origin of Taeniidpositive samples

In addition to signs and tracks used in identifying the source of fecal samples in the field, the actual host origin of the 53 taeniid positive samples (26 from Maasai Mara and 27 from Samburu) were confirmed by PCR and DNA sequencing of the cob gene. The cob DNA sequences indicated the involvement of Crocuta crocuta(30/53), Panthera leo(7/53), Canis lupus familiaris(7/53), and Canis adustus(1/53) in the two National Reserves (Table 1). Host origin of 8 taeniidpositive samples could not be determined.

6.3 Echinococcosisand Taeniaspp. in the domestic settings in areas around Maasai Mara and Samburu national reserves

In the vicinity of Samburu National Reserve, 406 fecal samples from domestic dogs were collected; from 21 samples, 304 taeniid eggs were isolated. Ninety-two of the 304 eggs were positive on nad1PCR and revealed E. granulosus(G1-G3) (9) and E. felidis(47), T. hydatigena(10), T. madoquae(10), T. multiceps(7), and undetermined Taeniaspp. (9). The domestic dog origin of all E. felidispositive fecal samples were confirmed by PCR and DNA sequencing. An earlier report where 500 domestic dog fecal samples from Maasai Mara National Reserve were screened, 34 samples were found positive for nad 1, of which 92/213 individual taeniid eggs were identified as E. granulosus(G1-G3) (86), E. ortleppi(2), E. felidis(3) and E. canadensis(1) [33].

Advertisement

7. Discussion

Human encroachment into wildlife sanctuaries has augment domestic-wildlife interactions thereby raising the risk margin for transmission of zoonotic diseases. Reduced interactions between human and wild animals by putting in place strict wildlife conservation and management legislations and strategic measures will reduce the burden of zoonotic disease transmission [37]. Population density in wildlife areas may occur in cases where management strategies include introduction of new animal species, which often result into introduction of new strains of zoonotic diseases, amidst improving number of animal population [38]. Wildlife movements often facilitate transfer of different disease strains from one point to the other, with an example of the wildebeest migration occurring every year from Serengeti to Maasai Mara [9]. While the migratory behavior is termed as a big economic gain due to increased tourist attraction for both countries, transmission of new strains that can cause extinction of wild species is possible. This is evidenced by a report in 2014 on existence of Echinococcus granulosusG1–3 in wildebeests [9]. The increased disease predisposition in wildlife sanctuaries has not only led to mortalities, and hence reduced wild animal populations but also diseases transmitted from wildlife to humans, example being the increasing burden of arboviruses and the current world pandemic of COVID-19 [12, 39, 40].

Zoonotic diseases have caused advanced effect especially in low and middle-income countries [41]. On average, up to 40% deaths occur in Africa due to infectious diseases, most of which are zoonotic [42]. These diseases have been reported to not only cause animal or human sickness but have led to deaths and major economic loses [37, 43]. Echinococcosis, a neglected zoonotic disease, has been reported to have highest prevalence in Kenya [30, 44]. It is hypothesized that the disease transmission could be minimized by improved wild conservation management systems in the country, since this has been seen to work well as reported in previous studies [43, 45]. Most wildlife sanctuaries are unfenced, and cattle are observed often at the heart of the protected areas, and wild animals in human homesteads [24]. This is equally interlinked with human bad slaughter behavior, where condemned offal is offered to domestic dogs, and with wild animals marauding at night, they may access and feed on this offal. This, consequently, leads to transmission of zoonotic diseases including Echinococcosis. The only reliable cure for Echinococcosis is a total removal of hydatid cyst, which is an extremely expensive undertaking, which calls for a specialized surgeon. Emergence and re-emergence of Echinococcusspp. has been reported in most countries in the African continent [24]. Until recently, six genotypes/species have been noted in Sub-Saharan Africa; E. granulosussensu stricto, E. canadensisG6/7, E. ortleppi, E. equinus, E. felidisand E. granulosusgenotype G. omo[9, 25, 26, 27, 33, 34]. These genotypes range from domestic origins (E. granulosussensu stricto, E. canadensisG6/7, E.ortleppi, E. granulosusgenotype Gomo), to wild origin spp. i.e. felidisand E. equinus. In this study, we confirmed the existence of the previously suggested overlap between domestic pets and wildlife cycles of Echinococcusspecies in Kenya.

During material sampling, it was observed that livestock herding inside the Maasai Mara National Reserve, took place at night as such the accompanying dogs might have access to carcasses of preyed animals. In both reserves the ‘lion strain´ E. felidiscould be isolated from both wild carnivores and domestic dogs. The lion strain, E. felidiswas first promoted to the species status in 2009 where it was described as a lion strain probably confined to sylvatic transmission in sub-Saharan Africa [33]. Subsequently, E. felidiswas isolated from wildlife in Kenya [9] and South Africa [46]. This seem to confirm its adaptation to sylvatic transmission systems. Isolation of E. felidisin both cycles in the present study is, therefore, an indication of active interaction of wild animals and domestic dogs within the Reserve environments. It is also possible that, these domestic dogs were infected in the process of herding of livestock. During other livelihood activities such as collection of firewood, accompanying dog(s) could scavenge on wild herbivores or might have been infected through coprophagy of wild carnivorous host’s fecal matter. On the other hand, wild carnivores were often observed marauding within manyattas(homesteads of the Samburu and Maasai pastoral communities) at night [9]. In 31 Taeniid eggs from fecal samples of wild definitive host from Samburu National Reserve (hyena, lion and side stripped jackals) were found to have E. granulosuss.s. Following the observations/reports of wild carnivores in manyattasand predation on livestock, it is highly likely that such carnivores acquired E. granulosuss.s. infection as a result of preying on livestock.

Transmission overlap of E. granulosuss.s. and E. felidisin the domestic and sylvatic cycles could not be fully explored with data that were available. However, our observation clearly demonstrates the interaction between domestic and wildlife definitive hosts, raising major public health concerns. The genetic proximity between E. granulosuss.s. and ´lion strain´ E. felidisis well understood [34], but the pathogenic potential of E. felidisin livestock and human, and the importance of E. granulosuss.s. in wildlife intermediate hosts are some of the crucial aspects of Cystic Echinococcosis (CE) that remain unanswered. E. granulosuss.s. is the most infective species to humans in locally [31], and worldwide [47]. The mere presence of E. granulosuss.s. in wild carnivores broadens their transmission to human and wild ungulates. So far, warthogs are known to be the most suitable intermediate hosts of E. felidis[34]. It is, however, unclear as to whether domestic pigs or any other livestock plays the intermediate host role to sustain the transmission of E. felidisin the domestic setting. Slaughter data of animals from Maasai land could not reveal the occurrence of E. felidisin the domestic intermediate hosts [27]. This, however, does not rule out the possibility perhaps that the disease situation in other domesticated animals in endemic wildlife vicinity might be the catalytic factor.

Echinococcus canadensisG6/7 was found in a dog fecal sample in Samburu National Reserve area. The genotype, is rare in wildlife and its existence in a domestic dog fecal sample collected from the heart of the Reserve cannot guarantee its wildlife origin. [33]. Possibly, the dog acquired the infection from the domestic setting and defecated at the heart of the Reserve during regular human visits to the area such as herding or collection of firewood mostly by Samburu Morans who often visited the heart of the Reserve often accompanied by their dogs [9]. Furthermore, in the absence of wild intermediate host, its existence in wildlife cycle can henceforth be ruled out.

Increased infection of the Echinococcus speciesand other Taenia species in domestic dogs, especially in Samburu could be due a long-standing tradition in the community where animal lungs are fed to dogs. This was supported by what the local community had to say as quoted ‘specifically lungs are strictly fed to the dogs during home slaughter or/and at the abattoirs. In the course of our study, other parasites observed included three cosmopolitan Taeniaspp. including: T. multicepsand T. hydatigena(found in Samburu and Maasai Mara and in both cycles) and T. saginata, which was rare but reported here in hyena feces collected in Samburu National Reserve environment. Existence of T. multicepsin the domestic and wild definitive hosts is rather alarming. The parasite has earlier been reported in dogs and jackals and is known to cause severe neurological disease in animals (coenurosis) when the larva migrates to the brain and spinal cord [48]. It affects sheep and goats, being their major intermediate hosts [49]. The hyena with T. saginataeggs most likely acquired this through feeding on human feces as previously reported [9, 33]. This protracts the range for cattle to be infected since herding dogs interacts more closely with livestock and, therefore, may increase chances of infection for cattle.

Advertisement

8. Conclusion

Inadequate data on wildlife-human related infectious diseases has reduced preparedness against disease outbreak in Kenya. More studies on problems relating to wildlife diseases, determining the presence of such diseases, their prevalence and their impact on wildlife conservation and management are inevitable. Existing wildlife management systems are deficient of disease surveillance component, and this has led to human deaths and animal loses to zoonotic infectious disease. Disease transmission between the human-wildlife cycle is a generally gray area to most stakeholders, making disease management strategies difficult. Growth in human population is causing great challenges in environmental conservation management. Changes observed include wildlife habitat change, which has adversely caused ecological changes as well as increased emergence and re-emergence of zoonotic infectious diseases. Based on the findings of this study, it can be hypothesized that if proper wildlife management systems including disease surveillance systems are observed in Kenya, wild animal population will increase, the rare species will be free of illnesses, and human mortalities caused by zoonotic diseases will decrease. There is an overlap in occurrence of E. granulosuss.s. and E. felidisin wildlife and domestic settings in Kenya. Active interaction of wild and domestic Echinococcusin definitive hosts has been observed. However, data on importance of intermediate hosts for the ´lion strain´ E. felidisin domestic and E. granulosuss.s. in wildlife would be key in interpreting transmission dynamics of these parasites. Our study provides a base for further analysis of the sylvatic-domestic transmission interface of Echinococcusspp. in sub-Saharan Africa, and suggests improved wildlife conservation and management systems, with possibility of having all wildlife sanctuaries fenced, for the benefit of human and well as animals.

Advertisement

Acknowledgments

The authors acknowledge the support of Lynn Nkatha who assisted with field sampling and laboratory analysis. The authors further acknowledge financial assistance by cystic Echinococcosis in Sub-Saharan Africa Research Initiative.

Advertisement

Ethical approval

Ethical permission to conduct this research was granted by Kenya Medical Research Institute’s Ethical Committee, animal care and use committee and Meru University of Science and Technology Institutional Research Ethics Review committee (MIREC-035-2017). Permission to collect samples from Maasai Mara and Samburu National Reserves was granted by Kenya Wildlife Services.

© 2020 The Author(s). Licensee IntechOpen. This chapter is distributed under the terms of the Creative Commons Attribution 3.0 License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

How to cite and reference

Link to this chapter Copy to clipboard

Cite this chapter Copy to clipboard

Dorothy Kagendo, Eric Muchiri, Peter Gitonga and Esther Muthoni (November 12th 2020). Interlinks between Wildlife and Domestic Cycles of <em>Echinococcus</em> spp. in Kenya, Managing Wildlife in a Changing World, Jafari R. Kideghesho, IntechOpen, DOI: 10.5772/intechopen.94612. Available from:

chapter statistics

218total chapter downloads

More statistics for editors and authors

Login to your personal dashboard for more detailed statistics on your publications.

Access personal reporting

Related Content

This Book

Next chapter

Wildlife Management Areas in Tanzania: Vulnerability and Survival Amidst COVID-19

By Rehema Abeli Shoo, Elizabeth Kamili Mtui, Julius Modest Kimaro, Neema Robert Kinabo, Gladys Joseph Lendii and Jafari R. Kideghesho

Related Book

First chapter

Hydrological Stress and Climate Change Impact in Arid Regions with Agricultural Valleys in Northern Mexico

By Mariano Norzagaray Campos, Norma Patricia Muñoz-Sevilla and Maxime Le Bail

We are IntechOpen, the world's leading publisher of Open Access books. Built by scientists, for scientists. Our readership spans scientists, professors, researchers, librarians, and students, as well as business professionals. We share our knowledge and peer-reveiwed research papers with libraries, scientific and engineering societies, and also work with corporate R&D departments and government entities.

More About Us