Open access peer-reviewed chapter

Role of COX-2 Promoter Methylation and Helicobacter pylori Infection in Impaired Gastric Ulcer Healing

Written By

Hiroshi Yasuda, Yoshiyuki Watanabe, Ritsuko Oikawa and Fumio Itoh

Submitted: October 30th, 2017 Reviewed: July 5th, 2018 Published: November 5th, 2018

DOI: 10.5772/intechopen.79973

Chapter metrics overview

827 Chapter Downloads

View Full Metrics

Abstract

Helicobacter pylori (H. pylori) infection causes aberrant DNA methylation of various genes in the gastric mucosa. Cyclooxygenases (COX) play a critical role in peptic ulcer development and healing. Human COX-2 has CpG islands (CGIs) in its promoter region, suggesting a possible epigenetic regulation. Here, we evaluated COX-2 promoter methylation in the gastric mucosa of patients with various gastric diseases and found that COX-2 methylation levels in the gastric mucosa were significantly increased in patients with H. pylori infection. We further investigated the roles of COX-2 during the healing of acetic acid-induced gastric ulcers in H. pylori-infected Mongolian gerbils (MGs). While COX-2 mRNA expression levels on the edges of acetic acid-induced gastric ulcers were significantly increased after ulcer induction in MGs in the absence of H. pylori, no such induction was observed in H. pylori-infected gastric mucosa. Cloning of the MG COX-2 gene revealed abundant CGIs in the promoter region. COX-2 mRNA expression in MG-derived gastric carcinoma MGC2 cells was significantly increased by addition of the demethylating agent 5-Aza-dC. Additionally, COX-2 methylation levels were higher in H. pylori-infected MG gastric mucosa than in control mucosa. These results indicated that epigenetic inhibition of COX-2 mRNA induced by H. pylori impairs gastric ulcer healing.

Keywords

  • COX-2
  • gastric ulcer healing
  • Helicobacter pylori
  • methylation
  • Mongolian gerbils
  • MGC2 cells

1. Introduction

Helicobacter pylori(H. pylori) is a Gram-negative bacterium that selectively colonizes the gastric epithelium of humans and is the leading cause of peptic ulcers [1]. Although the majority of individuals infected with H. pyloriremain asymptomatic throughout their life, essentially all infected individuals develop chronic inflammation. Patients with antral-predominant gastritis are predisposed to duodenal ulcers, while patients with corpus-predominant gastritis and multifocal atrophy are more likely to have gastric ulcers. Eradication of H. pyloridrastically lowers the recurrence of H. pylori-associated peptic ulcers. In addition, the observed delayed ulcer healing has been reported to involve H. pylori-induced inflammation, increased apoptosis of epithelial cells at the ulcer margin, overexpression of inflammatory cytokines, and reduced gastric microcirculation [2]. Cyclooxygenase (COX) is a membrane-bound glycoprotein that functions as the rate-limiting enzyme in prostaglandin (PG) synthesis. PGs increase the resistance of the gastric mucosa to injury by downregulating inflammatory responses. Two major COX isoforms have been identified, COX-1, which is constitutively expressed and considered a housekeeping enzyme, and COX-2, whose mRNA levels rise rapidly in response to inflammatory and mitogenic stimuli. There is a known synergism between H. pyloriinfection and nonsteroidal anti-inflammatory drug (NSAID) use in the development of peptic ulcers and ulcer bleeding [3]. These findings indicate possible interactions between H. pyloriinfection, COX activity, and ulcerogenesis. Aberrant methylation of 5′-CpG islands (CGIs) has been implicated in the transcriptional silencing of a wide range of genes involved in various diseases, such as cancer. Human COX-2has CG-rich CGIs in its promoter region, which suggests epigenetic regulation. Here, we report and discuss our recent results on the epigenetic regulation of COX-2activity in H. pylori-infected gastric mucosa of humans and Mongolian gerbils (MGs), and the possible relationship between COX-2methylation and delayed gastric ulcer healing.

Advertisement

2. COX and the gastric mucosal barrier

In 1971, Vane and colleagues first demonstrated that aspirin and other NSAIDs inhibited the synthesis of PGs by blocking COX activity [4]. COX plays pivotal roles in the gastric mucosal barrier [5, 6]. COX catalyzes the conversion of arachidonic acid to the common precursor prostanoids, prostaglandin (PG) H2, and PGG2. The major PGs produced by the human and rodent gastric mucosa are PGE2 and PGI2, with lesser amounts of PGF2 and PGD2. Each of these metabolites binds to a specific G protein-coupled receptor to trigger intracellular responses. PGs have been shown to accelerate ulcer healing in experimental models and humans [7]. COX exists in two isoforms commonly referred to as COX-1 and COX-2. COX-1 is constitutively expressed in various tissues. In the stomach, prostanoids synthesized via the COX-1 pathway are responsible for cytoprotection of the gastric mucosa and the production of thromboxane by platelets. Although COX-2 is generally expressed at very low levels in healthy tissues, including in the stomach, it is expressed at particularly high levels at sites of inflammation.

It was originally thought that only COX-1 was involved in the gastric mucosal defense system; however, several clinical trials have suggested that a COX-2 selective inhibitor produces lesser, but some, gastrointestinal toxicity compared to traditional NSAIDs [8, 9]. In accordance with this finding, animal studies have suggested that both COX-1 and COX-2 are necessary for gastric mucosal healing, and COX-1 inhibition alone, which can be induced pharmacologically by specific inhibitors or genetically by gene targeting [10], does not cause gastric mucosal injury. It has been shown that a combination of selective COX-1 and COX-2 inhibitors is required to cause hemorrhagic erosion of the gastric mucosa, which is comparable to that observed with indomethacin [11]. Prostanoids produced by COX-2, especially PGE2, enhance cell proliferation. The beneficial effects of PGE2 on gastric ulcer healing in rodents appear to be mediated via the EP4 receptor [12]. In addition, COX-2-derived PG stimulates vascular endothelial growth factor (VEGF) release from gastric fibroblasts, which is an important contributor to ulcer healing [13, 14], likely via stimulation of new blood vessel growth. The increase in COX-2 immunoreactivity that is observed in monocytes, macrophages, fibroblasts, and endothelial cells at the ulcer margin is closely correlated, both temporally and spatially, with the increase in cell proliferation [15]. COX-2 appears to represent a second line of defense that is activated during ulcer healing to compensate for the temporary loss of COX-1 in the mucosa adjacent to the ulcer and assists COX-1 in protecting gastric mucosal integrity. The healing-impairment effect of NSAIDs is also observed with selective COX-2 inhibitors [16].

Advertisement

3. H. pyloriinfection and COX-2 in gastric mucosa

The pathophysiological roles of COX-2 in H. pylori-infected gastric mucosa are intriguing. H. pylorihas been implicated as an inducer of COX-2 in the stomach [17, 18, 19]. In addition, COX-2 expression is elevated within H. pylori-induced gastritis and malignant lesions [20], and H. pyloriinduced COX-2 expression and enhanced PGE2 production in a human gastric carcinoma cell line. Both H. pyloriinfection and NSAID use independently and significantly increase the risk of peptic ulcers and ulcer bleeding. While COX-2 is necessary for gastric mucosal healing [21], H. pyloriinfection is the leading cause of gastric ulceration. To understand the bimodal effects of H. pyloriinfection on COX-2 induction during ulcer healing, we explored the effects of epigenetic regulation and H. pyloriinfection on the induction of COX-2 in vivoand in vitro.

H. pyloriinfection causes aberrant DNA methylation of various genes in the gastric mucosa, including COX-2[22, 23, 24, 25]. Human COX-2has CGIs in its promoter region. Thus, we compared COX-2promoter methylation levels in the gastric mucosa in H. pylori-positive and H. pylori-negative cases [26]. As mentioned above, in qualitative experiments, COX-2gene promoter methylation levels were significantly higher in H. pylori-positive cases than in H. pylori-negative cases (Figure 1). COX-2promoter methylation levels were significantly lower in patients with H. pylorieradication than in those with H. pyloriinfection. We then investigated the effects of COX-2promoter methylation on COX-2mRNA expression in vitrousing the human gastric adenocarcinoma cell line Kato III, in which the COX-2promoter is densely methylated [22]. COX-2mRNA expression was not observed in these cells, despite the addition of the protein kinase C stimulator α-phorbol 12,13-dibutyrate (PDBu). However, COX-2expression was observed after the addition of the demethylating agent 5-Aza-dC, and expression was enhanced by adding PDBu (Figure 2) [26]. These results indicate that H. pyloriinfection causes reversible COX-2promoter methylation in the gastric mucosa, and that COX-2mRNA expression is regulated through an epigenetic mechanism.

Figure 1.

COX-2DNA methylation levels in patients with or withoutH. pyloriinfection, and patients previously with successfully eradicatedH. pyloriinfection. The figure is modified from Ref. [26].

Figure 2.

Effects of a PKC stimulator (α-phorbol 12,13-dibutyrate; PDBu) on COX-2 mRNA expression with or without 5-aza-dC in the human gastric adenocarcinoma cell line KATO-III. KATO-III cells were treated with vehicle (1 μmol/L) with or without 5-Aza-dC for 5 days. The figure is modified from Ref. [26].

Advertisement

4. Acetic acid-induced gastric ulcer healing and COXmRNA levels in Mongolian gerbils with or without H. pyloriinfection

H. pyloriinfection in humans is best modeled in Mongolian gerbils (MGs), and chronic infection with H. pyloriinduces inflammatory cell infiltration in the gastric mucosa in MGs (Figure 3A). It was previously shown that H. pyloriinfection significantly delayed acetic acid-induced ulcer healing in mice and MGs [27, 28, 29]. H. pyloriinfection induces aberrant DNA methylation of several CGIs in MGs [30]. As described above, COX-2-derived PGs are important for gastric ulcer healing, and the COX-2promoter is densely methylated in the human gastric mucosa in the presence of H. pyloriinfection. To investigate the roles of COX-2methylation and H. pyloriinfection in gastric ulcer healing, COXmRNA levels in samples prepared from acetic acid-induced gastric ulcers in MGs were examined. Then, the effects of COX-2methylation on COX-2mRNA expression were also investigated in vitrousing an H. pylori-infected MG stomach-derived cell line.

Figure 3.

A. Microscopic features ofH. pylori-infected gastric mucosa of Mongolian gerbils (MGs). Sections were stained with hematoxylin and eosin. B. Gross appearance 10 days after gastric ulcer induction ofH. pylori-infected MGs. C. Microphotograph 10 days after gastric ulcer induction inH. pylori-infected MGs. D. Serial changes in acetic acid-induced gastric ulcer areas in MGs with or withoutH. pyloriinfection.H. pylori(ATCC43504; American Type Culture Collection, Rockville, MD) was grown in Brucella broth (Becton Dickinson, Cockeysville, MD) containing 10% v/v horse serum for 40 h at 37°C under microaerobic conditions (15% CO2) and high humidity with shaking (150 rpm). Male MGs (MGs/Sea) were purchased from Kyudo (Saga, Japan). At 11 weeks of age,H. pylori(0.8 mL samples of Brucella broth containing 1.0 × 109 colony-forming units) was delivered intragastrically using an oral catheter after fasting for 24 h. Gastric ulcers were induced experimentally in MGs according to the method described by Wang et al. [40]. Briefly, after anesthetization with ketalar, the abdomen was opened through a midline incision, and 50 μL of 25% acetic acid was injected in the subserosa of the anterior wall of the stomach. The MGs were killed at5, 10, and 20 days after ulcer induction, and the stomach was dissected and removed. The maximum and minimum diameters of the ulcers were measured, and the ulcer area, which was approximately elliptical, was calculated and was compared between MGs with and withoutH. pyloriinfection. Values are the mean ± SE. The animal care committee of St. Marianna University approved the experimental design, and the animals were cared for in accordance with institutional guidelines.

Gastric ulcers were produced by injecting 25% of acetic acid (0.03 mL) into the submucosal layer of the gastric wall of the antral-oxyntic border in MGs 48 weeks after inoculation with an H. pylorisuspension in Brucella broth. The MGs were killed at 5, 10, and 20 days after ulcer induction, and the stomachs were dissected and removed. The maximum and minimum diameters of the ulcers were measured, and the area of each ulcer, which was approximately elliptical, was calculated and compared between MGs with and without H. pyloriinfection. The ulcer area was largest on day 5, and then gradually decreased. In accordance with previous reports [29], the gastric ulcer area was larger in H. pylori-infected MGs than in uninfected MGs (Figure 3B–D). While COX-2mRNA expression at the ulcer edge was increased 5 days after acetic acid injection in MGs without H. pyloriinfection, as was reported in rats and mice [31], no increases in COX-2mRNA levels were observed in H. pylori-infected MGs. In contrast, gastric ulceration was not associated with a change in COX-1mRNA levels in MGs with or without H. pyloriinfection (Figure 4A,B). Thus, H. pyloriinfection caused delayed ulcer healing and impaired COX-2 induction in MG stomachs.

Figure 4.

COXmRNA levels during healing of an acetic acid-induced gastric ulcer in MGs with or withoutH. pyloriinfection.COXmRNA levels in acetic-acid-induced gastric ulcers in MGs were measured by real-time PCR. First-strand cDNA was prepared by reverse transcription of 5 μg of total RNA using superscript III reverse transcriptase (Applied Biosystems, Carlsbad, CA, USA). Real-time quantitative reverse transcription PCR was carried out using TaqMan Gene Expression Assays with a 7500 real-time PCR system (Applied Biosystems) according to the manufacturer’s instructions. Primers forCOX-1,COX-2, andβ-actinwere designed based on their cDNA sequences (GenBank accession nos. AB 044783, AB044784, and AB040445, respectively) and according to previous reports [33]. SDS2.1 software (Applied Biosystems) was used to perform the comparative Δ-Ct analysis. Glyceraldehyde-3-phosphate dehydrogenase was used as an endogenous control. Values are the mean ± SE. β-Actin left: gctacagcttcaccaccaca, right: ccatctcttgctcgaagtcc, 93 bp. COX-1 left: gtggctatttcctgcagctc, right: agtgggtgccagtggtagag, 112 bp. COX-2 left: tgggcgtgaaaggaaataag, right: ggggatcagggatgaacttt, 87 bp.

Advertisement

5. Effects of COX-2methylation on its mRNA expression in MGs in vitro

As discussed above, COX-2mRNA expression is regulated by an epigenetic mechanism in KATO-III human gastric carcinoma cells in which COX-2is densely methylated [22]. To investigate the role of methylation in COX-2mRNA expression in H. pylori-infected gastric mucosa of MGs, we treated MGC2 cells with 5-aza-dC, a methyltransferase inhibitor, or trichostatin A (TSA), a histone deacetylase inhibitor. MGC2 is an adenocarcinoma cell line established from the gastric cancer tissue of a H. pylori-infected MG [32]. COX-2mRNA expression levels in these cells were restored after the addition of 5-aza-dC. In contrast, treatment with TSA did not induce COX-2mRNA expression (Figure 5). These results indicated that COX-2mRNA expression in MGs is regulated via both transcriptional and epigenetic mechanisms. Histone acetylation was not involved in silencing COX-2expression in these cells.

Figure 5.

Effects of 5-aza-dC, a methyltransferase inhibitor, or trichostatin A (TSA), a histone deacetylase inhibitor, onCOX-2mRNA expression in MG gastric adenocarcinoma MGC2 cells. The MGC2 cells [32] were a generous gift from Dr. Tatematsu and were maintained in RPMI-1640 medium supplemented with 10% fetal bovine serum (FBS; Gibco, Grand Island, NY, USA) plus serum expander MITO (0.1%, Collaborative Biomedical Products Bedford, MA, USA) on a type I collagen-coated dish (Asahi Techno Glass, Japan). All the cultures were incubated at 37°C with 95% air and 5% CO2.COX-2mRNA expression was measured by real-time PCR in the cell lines grown in the presence of vehicle with or without 5-Aza-dC (1 μmol/L) or TSA for 5 days. Values shown are the mean ± SE.

Advertisement

6. Cloning the MG COX-2promoter region

As mentioned above, human COX-2has abundant CGIs in the promoter region. To examine whether CGIs are present in the COX-2promoter region of MGs, we performed genomic PCR with primers designed using as previously reported MG cDNA (Accession #: AB177842) [33]. The PCR product has an intron sequence in the promoter region. Then, gene walking was performed using a primer in this intron. The promoter region of the MG COX-2gene was obtained (Figure 6), and the sequence contains more CGIs than the mouse genome, and is comparable to that of the human genome. Pyrosequencing showed several methylated CGIs (>15%) in the MGC2 cells. Treatment with 5-aza-dC decreased the methylation levels in these cells (Figure 7). As was observed in the human stomach, COX-2methylation levels were increased in H. pylori-infected gastric mucosa of MGs when compared to the levels in the control mucosa (Figure 8).

Figure 6.

Human, MG, and mouseCOX-2promoter regions. Genome walking to isolate genomic, theCOX-2promoter region of MGs, was performed by using the Straight Walk Kit [41] according to the manufacturer’s instructions (Bex, Tokyo, Japan). Amplified fragments were cloned into the pSTBlue-1 vector (Novagen, Madison, WI, USA) and sequenced. More abundant CGIs were observed in the MG genome when compared to the mouse genome, and the number was comparable to human genome.

Figure 7.

Effect of 5-aza-dC treatment onCOX-2methylation levels in MGC2 cells. Cells were treated with vehicle (A) with 5-aza-dC (B, 1 μmol/L) for 5 days, and then methylation levels ofCOX-2were analyzed by quantitative bisulfite-pyrosequencing methods as previously reported [42]. Bisulfite treatment of gDNA was performed with the EpiTect bisulfite kit (QIAGEN, Valencia, CA, USA) according to the manufacturer’s protocol. Bisulfite-treated DNA (1 μL) was used as a template in subsequent PCR experiments. For most assays, we used touchdown PCR. All PCR assays included a denaturation step at 95°C for 30 s, followed by annealing at various temperatures for 30 s, and extension at 72°C for 30 s. After PCR, the biotinylated strand was captured on streptavidin-coated beads (Amersham Bioscience, Uppsala, Sweden) and incubated with sequencing primers. Pyrosequencing was performed using PSQ HS 96 Gold single-nucleotide polymorphism reagents on a PyroMark Q24 pyrosequencing machine (QIAGEN). The protocol for pyrosequencing was described in detail previously [42]. Pyrosequencing quantitatively measures the methylation status of CpG sites in a target region. Adjacent sites usually show highly concordant methylation. Therefore, the mean percent methylation in detected sites can be used as a representative value for each gene promoter. Cases with the methylation density > 15% were regarded as methylation positive. Forward primer: tgggtgaggggaattttataga, reverse primer: aaaccctaaccatccttacaa; and sequencing primer: aggagtttgtttaggaag.

Figure 8.

DNA methylation levels atCOX-2in the MG gastric mucosa in the presence or absences ofH. pyloriinfection. Methylation levels atCOX-2in the MG gastric mucosa were analyzed by quantitative bisulfite pyrosequencing.

Advertisement

7. Role of COX-2methylation and H. pyloriinfection in gastric mucosal healing

Nonselective COX inhibitors damage the gastrointestinal mucosa, and gastrointestinal injury represents the most significant side effect of chronic nonsteroidal anti-inflammatory drug (NSAID) use [34]. Thus, selective COX-2 inhibitors have been developed as ideal anti-inflammatory drugs, devoid of GI toxicity, and clinical trials have suggested that selective COX-2 inhibitors produce less gastrointestinal injury than conventional NSAIDs [8, 9]. In support of this, animal studies have also suggested that, in contrast to the initial concept, the importance of COX-2 in the repair of gastric mucosal damage has been recognized [31, 35]. In rat gastric mucosa, markedly elevated levels of COX-2mRNA were observed after induction of damage by ischemia-reperfusion [35, 36]. COX-2 mRNA and protein expression increase during repair of gastric mucosal lesions, and selective COX-2 inhibitors delay mucosal healing in mice [31]. PGs derived from ulceration-induced COX-2 at the ulcer margin enhanced epithelial cell proliferation and increased the expression of growth factors, including hepatocyte growth factor, epidermal growth factor, transforming growth factor-α, and VEGF [16].

The release of inflammatory cytokines and recruitment of inflammatory cells have been considered the potential factors for delayed ulcer healing in H. pyloriinfection [2, 28]. Chronic inflammation, including H. pyloriinfection, is known to cause aberrant DNA methylation [37, 38]. Here, we focused on COX-2methylation in H. pylori-infected gastric mucosa. Human COX-2has CGIs in the promoter region, and methylation levels in this region are increased in H. pylori-infected gastric mucosa. In addition, COX-2promoter methylation levels in patients with successfully eradicated H. pyloriinfection are lower than the levels in H. pylori-positive cases. As mentioned above, experiments using rodents have shown that COX-2mRNA expression is enhanced during ulcer healing. Thus, we investigated the influence of H. pyloriinfection on COX-2 expression during stomach ulcer healing in MGs. Acetic acid-induced ulcer healing was delayed in H. pylori-infected MG stomachs when compared to the healing of ulcers without H. pyloriinfection [29]. The COX-2promoter region of MGs also has abundant CGIs, comparable to human COX-2. Thus, MGs are good models for investigating the role of COX-2methylation in gastric mucosal healing. While COX-2mRNA expression at the ulcer edge was increased 5 days after acetic acid injection in MG stomachs without H. pyloriinfection, as was observed in the mouse and rat models, such increases in COX-2mRNA expression were not observed in H. pylori-infected MG gastric mucosa. However, a demethylating agent restored COX-2 mRNA expression in both human and MG gastric carcinoma cell lines in which COX-2 is densely methylated. Accordingly, we demonstrated in vitroand in vivothat COX-2mRNA expression is regulated through an epigenetic mechanism in human and MG gastric mucosa. Aberrant DNA methylation has been extensively investigated in the context of the pathogenesis of various cancers, including stomach cancer. In addition, the involvement of epigenetic modifications has been reported in the pathogenesis of various chronic diseases, such as essential hypertension and cardiovascular disease [39]. Taken together, the epigenetic inhibition of COX-2 expression due to chronic inflammation induced by H. pyloriinfection seems to interfere with ulcer healing and increase the vulnerability of the gastric mucosa. The decrease in COX-2methylation levels after H. pylorieradication may restore gastric mucosal defense.

Advertisement

8. Conclusions

H. pyloriinfection, the leading cause of peptic ulcer disease, induces sustained inflammation in the gastric mucosa. This chronic inflammation causes aberrant DNA methylation in various genes. The COX-2promoter regions in both MGs and humans contain abundant CGIs. COX plays critical roles in peptic ulcer development and healing, and both COX-1 and COX-2 are necessary for the gastric mucosal defense system. COX-1 is a housekeeping enzyme, which maintains microcirculation and mucous production. During ulcer healing, COX-2 is expressed at the margin of an ulcer, and COX-2-derived PGs induce various growth factors to promote mucosal healing and angiogenesis. Ulcer healing is delayed in H. pyloriinfected-MG stomachs, which is the best model of H. pyloriinfection in humans. We showed that COX-2mRNA induction during ulcer healing was impaired in H. pylori-infected-MG stomachs. The COX-2promoter region is methylated in both H. pylori-infected human and MG gastric mucosa. These CGIs are also methylated in human Kato III cells and MGC2 gastric carcinoma cells. COX-2mRNA expression in these cells is restored by treatment with a demethylating agent. In H. pylori-infected gastric mucosa, COX-2promoter methylation appears to be involved in the impaired COX-2mRNA induction typically observed during ulcer healing, which leads to delayed ulcer healing.

Advertisement

Acknowledgments

This work was supported in part by a grant-in-aid for scientific research from the Ministry of Education, Science, and Culture of Japan to HY.

Advertisement

Conflict of interest

There is no conflict of interest to disclose.

References

  1. 1. Marshall BJ, Warren JR. Unidentified curved bacilli in the stomach of patients with gastritis and peptic ulceration. Lancet. 1984;1:1311-1315
  2. 2. Li H, Kalies I, Mellgard B, Helander HF. A rat model of chronicHelicobacter pyloriinfection. Studies of epithelial cell turnover and gastric ulcer healing. Scandinavian Journal of Gastroenterology. 1998;33:370-378
  3. 3. Huang JQ, Sridhar S, Hunt RH. Role ofHelicobacter pyloriinfection and non-steroidal anti-inflammatory drugs in peptic-ulcer disease: A meta-analysis. Lancet. 2002;359:14-22. DOI: 10.1016/S0140-6736(02)07273-2
  4. 4. Vane JR. Inhibition of prostaglandin synthesis as a mechanism of action for aspirin-like drugs. Nature: New Biology. 1971;231:232-235
  5. 5. Hinz B, Brune K. Cyclooxygenase-2 10 year later. The Journal of Pharmacology and Experimental Therapeutics. 2002;300:367-375
  6. 6. Gudis K, Sakamoto C. The role of cyclooxygenase in gastric mucosal protection. Digestive Diseases and Sciences. 2005;50(Suppl 1):S16-S23. DOI: 10.1007/s10620-005-2802-7
  7. 7. Sontag SJ, Schnell TG, Budiman-Mak E, Adelman K, Fleischmann R, Cohen S, Roth SH, Ipe D, Schwartz KE. Healing of NSAID-induced gastric ulcers with a synthetic prostaglandin analog (enprostil). The American Journal of Gastroenterology. 1994;89:1014-1020
  8. 8. Bombardier C, Laine L, Reicin A, Shapiro D, Burgos-Vargas R, Davis B, Day R, Ferraz MB, Hawkey CJ, Hochberg MC, Kvien TK, Schnitzer TJ, VIGOR Study Group. Comparison of upper gastrointestinal toxicity of rofecoxib and naproxen in patients with rheumatoid arthritis. The New England Journal of Medicine. 2000;343:1520-1528. DOI: 10.1056/NEJM200011233432103
  9. 9. Chan FK, Hung LC, Suen BY, Wu JC, Lee KC, Leung VK, Hui AJ, To KF, Leung WK, Wong VW, Chung SC, Sung JJ. Celecoxib versus diclofenac and omeprazole in reducing the risk of recurrent ulcer bleeding in patients with arthritis. The New England Journal of Medicine. 2002;347:2104-2110. DOI: 10.1056/NEJMoa021907
  10. 10. Langenbach R, Morham SG, Tiano HF, Loftin CD, Ghanayem BI, Chulada PC, Mahler JF, Lee CA, Goulding EH, Kluckman KD, Kim HS, Smithies O. Prostaglandin synthase 1 gene disruption in mice reduces arachidonic acid-induced inflammation and indomethacin-induced gastric ulceration. Cell. 1995;83:483-492
  11. 11. Wallace JL, McKnight W, Reuter BK, Vergnolle N. NSAID induced gastric damage in rats: Requirement for inhibition of both cyclooxygenase 1 and 2. Gastroenterology. 2000;119:706-714
  12. 12. Hatazawa R, Tanaka A, Tanigami M, Amagase K, Kato S, Ashida Y, Takeuchi K. Cyclooxygenase-2/prostaglandin E2 accelerates the healing of gastric ulcers via EP4 receptors. American Journal of Physiology. Gastrointestinal and Liver Physiology. 2007;293:G788-G797. DOI: 10.1152/ajpgi.00131.2007
  13. 13. Miura S, Tatsuguchi A, Wada K, Takeyama H, Shinji Y, Hiratsuka T, Futagami S, Miyake K, Gudis K, Mizokami Y, Matsuoka T, Sakamoto C. Cyclooxygenase-2-regulated vascular endothelial growth factor release in gastric fibroblasts. American Journal of Physiology. Gastrointestinal and Liver Physiology. 2004;287:G444-G451. DOI: 10.1152/ajpgi.00537.2003
  14. 14. Wallace JL, Dicay M, McKnight W, Dudar GK. Platelets accelerate gastric ulcer healing through presentation of vascular endothelial growth factor. British Journal of Pharmacology. 2006;148:274-278. DOI: 10.1038/sj.bjp.0706722
  15. 15. Schmassmann A, Peskar BM, Stettler C, et al. Effects of inhibition of prostaglandin endoperoxide synthase-2 in chronic gastrointestinal ulcer models in rats. British Journal of Pharmacology. 1998;123:795-804
  16. 16. Halter F, Tarnawski AS, Schmassmann A, Peskar BM. Cyclooxygenase 2-implications on maintenance of gastric mucosal integrity and ulcer healing: Controversial issues and perspectives. Gut. 2001;49:443-453
  17. 17. Romano M, Vittorio R, Memoli A, Tuccilli C, Di Popolo A, Sommi P, Acquaviva AM, CDV B, Bruni CB, Zarrilli R.Helicobacter pyloriup-regulates cyclooxygenase-2 mRNA expression and prostaglandin E2 synthesis in MKN 28 gastric mucosal cells in vitro. The Journal of Biological Chemistry. 1998;273:28560-28563
  18. 18. Fu S, Ramanujam KS, Wong A, Wong A, Fantry GT, Drachenberg CB, James SP, Meltzer SJ, Wilson KT. Increased expression and cellular localization of inducible nitric oxide synthase and cyclooxygenase 2 inHelicobacter pylorigastritis. Gastroenterologia. 1999;116:1319-1329
  19. 19. McCarthy CJ, Crofford LJ, Greenson J, Scheiman JM. Cyclooxygenase-2 expression in gastric antral mucosa before and after eradication ofHelicobacter pyloriinfection. The American Journal of Gastroenterology. 1999;94:1218-1223
  20. 20. Yasuda H, Yamada M, Endo Y, Inoue K, Yoshiba M. Elevated cyclooxygenase-2 expression in patients with early gastric cancer in the gastric pylorus. Journal of Gastroenterology. 2005;40:690-697. DOI: 10.1007/s00535-005-1612-1
  21. 21. Wallace JL. Prostaglandins, NSAIDs, and gastric mucosal protection: Why doesn’t the stomach digest itself? Physiological Reviews. 2008;88:1547-1565. DOI: 10.1152/physrev.00004.2008
  22. 22. Kikuchi T, Itoh F, Toyota M, Suzuki H, Yamamoto H, Fujita M, Hosokawa M, Imai K. Aberrant methylation and histone deacetylation of cyclooxygenase 2 in gastric cancer. International Journal of Cancer. 2002;97:272-277
  23. 23. Chan AO, Peng JZ, Lam SK, Lai KC, Yuen MF, Cheung HKL, Kwong YL, Rashid A, Chan CK, Wong BC. Promoter methylation of E-cadherin gene in gastric mucosa associated withHelicobacter pyloriinfection and in gastric cancer. Gut. 2003;52:502-506
  24. 24. Maekita T, Nakazawa K, Mihara M, Nakajima T, Yanaoka K, Iguchi M, Arii K, Kaneda A, Tsukamoto T, Tatematsu M, Tamura G, Saito D, Sugimura T, Ichinose M, Ushijima T. High levels of aberrant DNA methylation inHelicobacter pylori-infected gastric mucosae and its possible association with gastric cancer risk. Clinical Cancer Research. 2006;12:989-995. DOI: 10.1158/1078-0432.CCR-05-2096
  25. 25. Perri F, Cotugno R, Piepoli A, Merla A, Quitadamo M, Gentile A, Pilotto A, Annese V, Andriulli A. Aberrant DNA methylation in non-neoplastic gastric mucosa ofH. Pyloriinfected patients and effect of eradication. The American Journal of Gastroenterology. 2007;102:1361-1371. DOI: 10.1111/j.1572-0241.2007.01284.x
  26. 26. Michikawa Y, Yasuda H, Watanabe Y, Oikawa R, Ohishi Y, Maehata T, Itoh F. COX-2 gene promoter methylation in patients infected withHelicobacter pylori. Clinical Medicine Insights: Gastroenterology. 2013;6:13-19. DOI: 10.4137/CGast.S11917
  27. 27. Makino M, Koga T, Ito K, Kawada H, Tabata K. Delayed healing of chronic gastric ulcer afterHelicobacter pyloriinfection in mice. The Journal of Pharmacy and Pharmacology. 1998;50:943-994
  28. 28. Konturek PC, Brzozowski T, Konturek SJ, Stachura J, Karczewska E, Panjdo R, Ghiara P, Hahn EG. Mouse model ofHelicobacter pyloriinfection: Studies of gastric function and ulcer healing. Alimentary Pharmacology & Therapeutics. 1999;13:333-346
  29. 29. Keto Y, Ebata M, Tomita K, Okabe S. Influence ofHelicobacter pyloriinfection on healing and relapse of acetic acid ulcers in Mongolian gerbils. Digestive Diseases and Sciences. 2002;47:837-849
  30. 30. Niwa T, Tsukamoto T, Toyoda T, Mori M, Tanaka H, Maekita T, Ichinose M, Tatematsu M, Ushijima T. Inflammatory processes triggered byHelicobacter pyloriinfection cause aberrant DNA methylation in gastric epithelial cells. Cancer Research. 2010;70:1430-1440. DOI: 10.1158/0008-5472.CAN-09-2755
  31. 31. Mizuno H, Sakamoto C, Matsuda K, Wada K, Uchida T, Noguchi H, Akamatsu T, Kasuga M. Induction of cyclooxygenase 2 in gastric mucosal lesions and its inhibition by the specific antagonist delays healing in mice. Gastroenterology. 1997;112:387-397
  32. 32. Nozaki K, Tanaka H, Ikehara Y, Cao X, Nakanishi H, Azuma T, Yamazaki S, Yamaoka Y, Shimizu N, Mafune K, Kaminishi M, Tatematsu M.Helicobacter pylori-dependent NF-kappa B activation in newly established Mongolian gerbil gastric cancer cell lines. Cancer Science. 2005;96:170-175. DOI: 10.1111/j.1349-7006.2005.00030.x
  33. 33. Matsubara S, Shibata H, Takahashi M, Ishikawa F, Yokokura T, Sugimura T, Wakabayashi K. Cloning of Mongolian gerbil cDNAs encoding inflammatory proteins, and their expression in glandular stomach duringH. pyloriinfection. Cancer Science. 2004;95:798-802
  34. 34. Wallace JL. Nonsteroidal anti-inflammatory drugs and gastroenteropathy: The second hundred years. Gastroenterology. 1997;112:1000-1016
  35. 35. Maricic N, Ehrlich K, Gretzer B, Schuligoi R, Respondek M, Peskar BM. Selective cyclo-oxygenase-2 inhibitors aggravate ischemia-reperfusion injury in the rat stomach. British Journal of Pharmacology. 1999;128:1659-1666
  36. 36. Kishimoto Y, Wada K, Nakamoto K, Ashida K, Kamisaki Y, Kawasaki H, Itoh T. Quantitative analysis of cyclooxygenase-2 gene expression on acute gastric injury induced by ischemia-reperfusion in rats. Life Sciences. 1997;60:PL127-PL133
  37. 37. Chiba T, Marusawa H, Ushijima T. Inflammation-associated cancer development in digestive organs: Mechanisms and roles for genetic and epigenetic modulation. Gastroenterology. 2012;143:550-563. DOI: 10.1053/j.gastro.2012.07.009
  38. 38. Asada K, Nakajima T, Shimazu T, Yamamichi N, Maekita T, Yokoi C, Oda I, Ando T, Yoshida T, Nanjo S, Fujishiro M, Gotoda T, Ichinose M, Ushijima T. Demonstration of the usefulness of epigenetic cancer risk prediction by a multicentre prospective cohort study. Gut. 2015;64:388-396. DOI: 10.1136/gutjnl-2014-307094
  39. 39. Fan R, Wang WJ, Zhong QL, Duan SW, Xu XT, Hao LM, Zhao J, Zhang LN. Aberrant methylation of the GCK gene body is associated with the risk of essential hypertension. Molecular Medicine Reports. 2015;12:2390-2394. DOI: 10.3892/mmr.2015.3631
  40. 40. Wang JY, Yamasaki S, Takeuchi K, Okabe S. Delayed healing of acetic acid-induced gastric ulcers in rats by indomethacin. Gastroenterology. 1989;96:393-402
  41. 41. Tsuchiya T, Kameya N, Nakamura I. Straight walk: A modified method of ligation-mediated genome walking for plant species with large genomes. Analytical Biochemistry. 2009;388:158-160. DOI: 10.1016/j.ab.2009.02.002
  42. 42. Watanabe Y, Kim H-S, Castoro RJ, Chung W, Estecio MRH, Kondo K, Guo Y, Ahmed SS, Toyota M, Itoh F, Suk KT, Cho M-Y, Shen L, Jelinek J, Issa J-JJ. Sensitive and specific detection of early gastric cancer with DNA methylation analysis of gastric washes. Gastroenterologia. 2009;136:2149-2158. DOI: 10.1053/j.gastro.2009.02.085

Written By

Hiroshi Yasuda, Yoshiyuki Watanabe, Ritsuko Oikawa and Fumio Itoh

Submitted: October 30th, 2017 Reviewed: July 5th, 2018 Published: November 5th, 2018