1. Introduction
1.1. c-fms and breast cancer
In the development and progression of breast cancers, both the
Tumor-associated macrophages bearing CSF-1 promote progression of breast cancer (Pollard 2004). In mice bearing human breast cancer xenografts, targeting mouse (host)
We have reported that glucocorticoids (GC) up-regulate
In the
1.2. Regulation of c-fms expression
Regulation of
1.3. Stability of c-fms transcripts in breast cancer cells
1.4. Post-transcriptional regulation of c-fms expression by 3’UTR
mRNA 3’UTR contains
Human
In metazoans, the 69 nt sequence within the 3'-UTR of
1.5. microRNAs for c-fms mRNA regulation
MicroRNAs (miRNAs) are 21-23 nucleotide single-stranded RNAs, that in general down-regulate translation and enhance mRNA degradation (Huntzinger and Izaurralde, 2011; Braun
Bioinformatics analysis predicted eight miRNAs (miR-339-5p, miR-449, miR-34, miR-610, miR-22, miR-134, miR-155, and miR-217) targeting six regions in
1.6. RNA-binding proteins for c-fms mRNA metabolism and translation
The first evidence supporting post-transcriptional regulation of
Chambers et al. (1993) reported the existence of mRNA regulatory proteins involved in
Furthermore, in breast carcinoma cells (BT20 and SKBR3), Dex-treatment at later time points increased
In human breast-cancer tissues, HuR is expressed mostly in nucleus (>90%), but expression in cytoplasm is also found. High nuclear expression of HuR is a poor prognostic factor both in breast and ovarian cancer (Woo et al, 2009; Yi et al, 2009).
Furthermore, immunoblot analysis showed that vigilin expression was lower in metastatic breast cancer MDA-MB-231BO cells than in non-tumorigenic epithelial breast MCF10A cells (Figure 5B). This indicates that a possible suppressive role of vigilin in invasive characters of breast cancer cells.
Both
1.7. Effects of HuR and vigilin on invasiveness of breast cancer cells
Increased
1.8. Post-translational modification: dimerization and tyrosine-phosphorylation of CSF-1R activation of PIP3/Akt signal transduction pathway
Activation of CSF-1R, product of the
In breast cancer cells, multiple components are known to activate phosphorylation of CSF-1R. Endogenous cytokine CSF-1, functioning as an autocrine signal, can bind to the extracellular domain of CSF-1R and activate the cytoplasmic kinase domain leading to autophosphorylation of tyrosine-residues in CSF-1R. There is evidence to suggest that endogenous CSF-1 can also bind CSF-1R without interaction on the membrane surface. Exogenous CSF-1, from other sources such as macrophages, osteoclasts, or fibroblasts, can function in a paracrine manner to activate CSF-1R on the membrane surface. Consequently, phosphorylation of tyrosine residues in CSF-1R activates cell proliferation and invasive potential (Yu et al, 2012; Sapi et al, 1996). Our study indicates glucocorticoids (dexamethasone) and starvation also activate CSF-1R auto-phosphorylation (Figure 8).
CSF-1R is localized both in the cytoplasm, plasma membrane, and nuclear envelope (Zwaenepoel et al, 2012). CSF-1R in the nuclear envelope becomes phosphorylated in response to CSF-1. Phosphorylated CSF-1R in the nuclear envelope triggers the phosphorylation of Akt and p27 inside the nucleus.
2. Discussion
Our results have demonstrated presence of vigilin in free mRNP fractions in human BT20 breast cancer cells. While vigilin association with free mRNPs may prevent ‘closed-loop’ formation and consequently inhibit
3. Conclusion
In the design of clinical therapeutics, suppression of pathogenic gene expression requires high specificity to prevent off-target toxicity. In order to achieve this, detailed regulatory mechanisms of target gene expression should be elucidated. Understanding the regulatory mechanisms and specific proteins through which vigilin effects translational down-regulation of proto-oncogene
Based on information available from the last 20 years of research and our recent data, it is now possible to elucidate vigilin’s role in translational down-regulation of
4. Methods
4.1. Cell culture
A human breast carcinoma cell line BT20 was maintained in MEM (Sigma) supplemented with 0.1 mM non-essential amino acids, 2 mM L-glutamine, 1 mM sodium pyruvate, 1.5 g/L sodium bicarbonate, and 10% fetal bovine serum (Invitrogen) in 5% CO2 at 37°C. A human breast carcinoma cell line MDA-MB-231 was cultured in DMEM (Sigma) supplemented with 10% fetal bovine serum. For studies using glucocorticoids, cells were grown in starvation medium with 100 nM Dex (Sigma-Aldrich) for 72 h and collected for immunoblot analysis. A human ovarian cancer cell line Hey was grown in DMEM/F12 (Sigma) supplemented with 10% fetal bovine serum.
4.2. Total RNA isolation for semi-quantitative real-time RT-PCR analysis
Cells were grown in 6-well plate for 2-3 days before harvesting. Total RNA was extracted with 500 ul Trizol (Invitrogen) per well. After Trizol extraction, 150 ul of supernatant was carefully removed to avoid genomic DNA contamination. Supernatant was re-extracted by equal volume of chloroform and 100 ul of supernatant was carefully removed and ethanol precipitated for cDNA synthesis.
4.3. Semi-quantitative real-time RT-PCR analysis for c-fms mRNAs
Total RNA was oligo-dT18 primed by M-MuLV reverse transcriptase (New England Biolab). For PCR analysis, reverse transcriptase reaction was diluted by 10-fold and 2 ul was used for 20 ul PCR reaction. GAPDH mRNA was amplified in PCR reaction as internal loading control.
GAPDH PCR primers (forward primer = 5’-CGGGAAACTGTGGCGTGATGGC-3’, reverse primer = 5’-AGGAGACCACCTGGTGCTCAGTG-3’).
4.4. Stem-loop real-time RT-PCR analysis for miR-610 and miR-155 quantification
miRNA expression was determined by the stem-loop qRT-PCR analysis to increase the specificity of miRNA amplification (Chen et al, 2005). cDNAs for miR-610, miR-155, and tRNAGlu specific were synthesized using sequence specific stem-loop forming primers. After 10-fold dilution of reverse transcriptase reaction, 2 ul was used for 20 ul real-time PCR. tRNAGlu was used as internal loading control.
miR-610 reverse transcription primer = 5’-gtcgtatccagtgcagggtccgaggtattcgcact ggatacgactcccag-3’)
miR-610 PCR primers (forward primer = 5’- ggcgctgagctaaatgtgtgc-3’, reverse primer = 5’- gtgcagggtccgaggt-3’)
miR-155 reverse transcription primer = 5’- gtcgtatccagtgcagggtccgaggtattcgcact ggatacgacacccct-3’
miR-155 PCR primers (forward primer = 5’- ggcgcttaatgctaatcgtgatag-3’, reverse primer = 5’- gtgcagggtccgaggt-3’)
tRNAGlu reverse transcription primer = 5’- gtcgtatccagtgcagggtccgaggtattcgcact ggatacgac GGTGAAAG-3’
tRNAGlu PCR primers (forward primer = 5’- CTGGTTAGTACTTGGACGGGAGAC -3’, reverse primer = 5’- gtgcagggtccgaggt -3’)
4.5. Analysis of c-fms mRNA Half Life
The
4.6. Metabolic labeling and immunoprecipitation of c-fms proteins
The BT20 cultures at 75-80% confluence were washed with PBS and incubated in labeling medium (Met,Cys-free RPMI1640 (Sigma R-7513), 5% dialyzed FCS, 500ug/ml Glutamine) for 40 min to deplete endogenous methionine and cysteine in cell. For metabolic labeling, 5 ml labeling medium and 50 ul (500 uCi) of 35S-Methionine/35S-Cysteine per T75 flask was added and incubated for 30-40 min. After brief chase in chase medium (labeling medium with 500µg/ml Cysteine-HCl and 100µg/ml Methionine), cells were harvested and lysed in IP buffer (1% Triton x-100, 0.05% NP-40 in TBS, protease inhibitors). For immunoprecipitation of c-fms proteins, 5 ug of
4.7. Gain-of-function and loss-of-function assay
Plasmids encoding a control shRNA or shRNA directed against vigilin were purchased from Origene. The shRNAs correspond to coding region nucleotides 614–642 (5'-AAGCTCG GAAGGACATTGTTGCTAGACTG-3') and 829–863 (5'-CATGAAGTCTTACTCATCTCTG CCGAGCAGGACAA-3'), respectively, of human vigilin (GenBank BC001179). An shRNA containing a non-specific 29nt GFP sequence (TR30003, Origene) was used as a transfection control (Empty). For RNAi, 5 ×106 cells were transfected with 10 μg shRNA plasmid using Fugene HD (Roche) according to the manufacturer's instructions. Transfected cells were maintained in culture medium for 3-4 days to permit knockdown before assays.
For vigilin overexpression, pTetCMV-Fo(AS)-vigilin (Cunningham et al, 2000) was transfected using Fugene HD (Roche). The BT20 cells at 75-80% confluence in 6-well plates were transfected with 5 μg of plasmids. The overexpression effects were monitored for 3-4 days by qRT-PCR and western blot analyses.
4.8. UV crosslinking and label transfer with c-fms mRNA 3’UTR
UV cross-linking of HuR and vigilin was performed as described previously (Urlaub et al, 2000) with modifications. RNAs of
4.9. Invasion assay
The Membrane Invasion Culture System (MICS chamber) was used to quantitate, the degree of invasion of MDA-MB-231 transiently transfected vigilin or HuR overexpressing clones. Breast cancer cells were cultured in the presence of 100 nM Dex and remained under starved conditions for transfection duration prior to the invasion assays. Parent or transfected cells, 1x105 per well in a 6-well plate, were seeded onto 10-μm pore filters coated with a human defined matrix containing 50 μg/ml human laminin, 50 μg/ml human collagen IV, and 2 mg/ml gelatin in 10 mM acetic acid.
Acknowledgement
This work was supported by Department of Defense grant DAMD 17-02-1-0633 (to S.K.C), by Arizona Biomedical Research Commission grant 07-061 (to S.K.C.), and the Rodel Foundation (to S.K.C.).
References
- 1.
Aharinejad S Paulus P Sioud M Hofmann M Zins K Schafer R Stanley E. R Abraham D 2004 Colony-stimulating factor-1 blockade by antisense oligonucleotides and small interfering RNAs suppresses growth of human mammary tumor xenografts in mice. Cancer Res.64 5378 5384 - 2.
Allegra J. C Lippman M. E Thompson E. B Simon R Barlock A Green L Huff K. K Do H. M Aitken S. C 1979 Distribution, frequency, and quantitative analysis of estrogen, progesterone, androgen, and glucocorticoids receptors in human breast cancer.39 1447 1454 - 3.
Arcaro A Guerreiro A. S 2007 The Phosphoinositide 3-kinase pathway in human cancer: genetic alterations and therapeutic implications. 8 271 306 - 4.
Balagopal V Parker R 2009 Polysomes, P bodies and stress granules: states and fates of eukaryotic mRNAs 21 403 408 - 5.
and associated factors: are there unifying principles? .Barreau C Paillard L Osborne B 2005 A. U-r. i. c. h Elements 33 7138 7150 - 6.
Bashirullah A Cooperstock R. L Lipshitz H. D 2001 Spatial and temporal control of RNA stability 98 7025 7028 - 7.
Bazzini A Lee M. T Giraldez A. J 2012 Ribosome profiling shows that miR-430 reduces translation before causing mRNA decay in Zebrafish 336 233 237 - 8.
Bevilacqua A Cerian M. C Capaccioli S Nicolin A 2003 Post-transcriptional regulation of gene expression by degradation of messenger RNAs. 195 356 372 - 9.
Bhattacharyya S. N Habermacher R Martine U Closs E. I Filipowicz W 2006 Relief of microRNA-mediated translational repression in human cells subjected to stress. 125 1111 1124 - 10.
A ribonuclease protection assay,Bordonaro M F Saccomanno C. F. , L Nordstrom J. L 1994 An Improved T 16 428 430 - 11.
Buchan J. R Parker R 2009 Eukaryotic stress granules: the ins and outs of translation 36 932 941 - 12.
Chambers S. K 2009 Role of CSF-1 in progression of epithelial ovarian cancer .5 1429 1440 - 13.
. ( .,Chambers ,S.K .,Kacinski ,B.M . &Ivins ,C.M Carcangiu ,M.L 1997 ). Overexpression of epithelial CSF-1 and CSF-1 receptor: a poor prognostic factor in epithelial ovarian cancer; contrasted to a protective effect of stromal CSF-1. Clin. Cancer Res.3 999 1007 . - 14.
Jr, & Kacinski, B.M. (Chambers S. K Gilmore-hebert M Wang Y Rodov S Benz E. J 1993 Posttranscriptional regulation of colony-stimulating factor-1 (CSF-1) and CSF-1 receptor gene expression during inhibition of phorbol-ester-induced monocytic differentiation by dexamethasone and cyclosporin A: potential involvement of a destabilizing protein. .21 1328 1334 - 15.
Chambers S. K Wang Y Gilmore-hebert M Kacinski M 1994 Post-transcriptional regulation of c-fms proto-oncogene expression by dexamethasone and of CSF-1 in human breast carcinomas in vitro. 59 514 522 - 16.
Chen C Ridzon D. A Broomer A. J et al 2005 Real-time quantification of microRNAs by stem-loop RT-PCR 33:e179 EOF - 17.
Fe´rec. & Cooper D.N. (Chen J-M 2006 A systematic analysis of disease-associated variants in the 3’ regulatory regions of human protein-coding genes II: the importance of mRNA secondary structure in assessing the functionality of 3’ UTR variants. 120 301 333 - 18.
untranslated region of messenger RNA: A molecular ‘hotspot’ for pathology? Nature MedConne B Stutz A Vassalli J D 2000 The 6 637 641 - 19.
Cunningham K. S Dodson R. E Nagel M. A Shapiro D. J Schoenberg D. R 2000 Vigilin binding selectively inhibits cleavage of the vitellogenin mRNA 3’-untranslated region by the mRNA endonucleases polysomal ribonuclease 1. PNAS97 12498 12502 - 20.
Dai X-M Ryan G. R Hapel A. J Dominguez M. G Russell R. G Kapp S Sylvestre V Stanley E. R 2002 Targeted disruption of the mouse colony-stimulating factor 1 receptor gene results in osteopetrosis, mononuclear phagocyte deficiency, increased primitive progenitor cell frequencies, and reproductive defects. 99 111 120 - 21.
De Leeuw F Zhang T Wauquier C Huez G Kruys V Gueydan C 2007 The cold-inducible RNA-binding protein migrates from the nucleus to cytoplasmic stress granules by a methylation-dependent mechanism and acts as a translational repressor .313 4130 4144 - 22.
Djuranovic S Nahvi A Green R 2012 miRNA-mediated gene silencing by translational repression followed by mRNA deadenylation and decay 336 237 240 - 23.
Fenger M Fillman C Norrild B Lykke-anderson J 2005 Multiple processing body factors and the ARE binding protein TTP activate mRNA decapping. 20 905 915 - 24.
Filderman A. E Bruckner A Kacinski B. M Deng N Remold H. G 1992 Macrophage colony-stimulating factor (CSF-1) enhances invasiveness in CSF-1 receptor-positive carcinoma cell lines. .52 3661 3666 - 25.
Flick M. B Sapi E Perrotta P. L Maher M. G Halaban R Carter D Kacinski B. M 1997 Recognition of activated CSF-1 receptor in breast carcinomas by a tyrosine 723 phosphospecific antibody. 14 2553 2561 - 26.
Flick M. B Sapi E Kacinski B. M 2002 Hormonal regulation of the c-fms proto-oncogene in breast cancer cells is mediated by a composite glucocorticoid response element. .85 10 23 - 27.
Franks T. M Lykke-anderson J 2008 The control of mRNA decapping and P-body formation 32 605 615 - 28.
Friedman R. C Farh K. K Burge C. B Bartel D. P 2009 Most mammalian mRNAs are conserved targets of microRNAs .19 92 105 - 29.
Gherzi R K. Y Lee P Briata D Wegmüller C Moroni M Karin Chen C. Y 2004 A KH domain RNA binding protein, KSRP, promotes ARE-directed mRNA turnover by recruiting the degradation machinery. 14 571 583 - 30.
Goolsby K. M Shapiro D. J 2003 RNAi-mediated depletion of the 15 KH domain protein, vigilin, induces death of dividing and non-dividing human cells but does not initially inhibit protein synthesis 31 5644 5653 - 31.
Guo H Ingolia N. T Weissman J. S Bartel D. P 2010 Mammalian microRNAs predominantly act to decrease target mRNA levels 466 835 840 - 32.
Huntzinger E Izaurralde E 2011 Gene silencing by microRNAs: contributions of translational repression and mRNA decay 12 99 110 - 33.
Ide H Seligson D. B Memarzadeh S Xin L Horvath S Dubey P Flick M. B Kacinski B. M Palotie A Witte O. N 2002 Expression of colony-stimulating factor 1 receptor during prostate development and prostate cancer progression. .99 14404 14409 - 34.
Jansen R 2001 mRNA localization: message on the move. - 35.
Kacinski B. M Flick M. B Sapi E 2001 RU-486 can abolish glucocorticoid-induced increases in CSF-1 receptor expression in primary human breast carcinoma specimens .8 114 116 - 36.
Kacinski B. M Carter D Mittal K Kohorn E. I Bloodgood R. S Donahue J Donofrio L Edwards R Schwartz P. E Chambers J. T Chambers S. K 1988 High level expression of fms proto-oncogene mRNA is observed in clinically aggressive human endometrial adenocarcinomas. .15 823 829 - 37.
Kacinski B. M Carter D Mittal K Yee L. D Scata K. A Donofrio L Chambers S. K Wang K Yang-feng T Rohrschneider L. R Rothwell V. M 1990 Ovarian adenocarcinomas express fms-complementary transcripts and fms antigen, often with coexpression of CSF-1 137 135 147 - 38.
Kacinski B. M Scata K. A Carter D Yee L. D Sapi E King B. L Chambers S. K Jones M. A Pirro M. H Stanley E. R Rohrschneider L. R 1991 FMS (CSF-1 receptor) and CSF-1 transcripts and protein are expressed by human breast carcinomas in vivo and in vitro. 6 941 952 - 39.
Kanamori H Dodson R. E Shapiro D. J 1998 In vitro genetic analysis of the RNA binding site of vigilin, a multi-KH-domain protein 18 3991 4003 - 40.
Kim V. N 2005 MicroRNA biogenesis: coordinated cropping and dicing. .6 376 385 - 41.
Kluger H. M Dolled-filhart M. D Rodov S Kacinski B. M Camp R. L Rimm D. L 2004 Macrophage colony-stimulating factor-1 receptor expression is associated with poor outcome in breast cancer by large cohort tissue microarray analysis. .10 173 177 - 42.
Kruse C Willkomm D Gebken J Schuh A Stossberg H Vollbrandt T Müller P. K 2003 The multi-KH protein vigilin associates with free and membrane-bound ribosomes. 60 2219 2227 - 43.
Li W Stanley E. R 1991 Role of dimerization and modification of the CSF-1 receptor in its activation and internalization during the CSF-1 response. .10 277 288 - 44.
Lin E. Y Nguyen A. V Russell R. G Pollard J. W 2001 Colony-stimulating factor 1 promotes progression of mammary tumors to malignancy. .193 727 739 - 45.
Loya A Pnueli L Yosefzon Y Wexler Y Ziv-ukelson M Arava Y 2008 The 39-UTR mediates the cellular localization of an mRNA encoding a short plasma membrane protein.14 1352 1365 - 46.
Maher M. G Sapi E Turner B Gumbs A Perrotta P. L Carter D Kacinski B. M Haffty B. G 1998 Prognostic significance of colony-stimulating factor receptor expression in Ipsilateral breast cancer recurrence. .4 1851 1856 - 47.
Mignone F Gissi C Liuni S Pesole G 2003 Untranslated regions of mRNAs 3: 0004.1 0004 - 48.
Moncini S Bevilacqua A Venturin M Fallini C Ratti A Nicolin A Riva P 2007 The 3’ untranslated region of human cyclin-dependent kinase 5 regulatory subunit 1 contains regulatory elements affecting transcript stability. 111 EOF - 49.
Nissan T Rajyaguru P She M Song H Parker R 2010 Decapping activators in Saccharomyces cerevisiae act by multiple mechanisms 39 773 783 - 50.
Paulus P Stanley E. R Schafer R Abraham D Aharinejad S 2006 Colony-Stimulating Factor-1 Antibody Reverses Chemoresistance in Human MCF-7 Breast Cancer Xenografts. 66 4349 4356 - 51.
Pollard J. W Stanley E. R Paul M. W 1996 Pleiotropic roles for CSF-1 in development defined by the mouse mutation osteopetrotic. .4 153 193 - 52.
Pollard J. W 2004 Tumour-educated macrophages promote tumour progression and metastasis. Nat. Rev. Cancer4 71 78 - 53.
Price F. V Chambers S. K Chambers J. T Carcangiu M. L Schwartz P. E Kohorn E. I Stanley E. R Kacinski B. M 1993 CSF-1 concentration in primary ascites of ovarian cancer is a significant predictor of survival.168 520 527 - 54.
Rettenmier C. W Sacca R Furman W. L Roussel M. F Holt J. T Nienhuis A. W Stanley E. R Sherr C. J 1989 Expression of the human c-fms proto-oncogene product (colony-stimulating factor-1 receptor) on peripheral blood mononuclear cells and choriocarcinoma cell lines. .77 1740 1746 - 55.
Roberts W. M Shapiro L. H Ashmun R. A Look A. T 1992 Transcription of the human colony-stimulating factor-1 receptor gene is regulated by separate tissue-specific promoters. 79 586 593 - 56.
Sapi E Flick M. B Rodov S Gilmore-hebert M Kelley M Rockwell S Kacinski B. M 1996 Independent regulation of invasion and anchorage-independent growth by different autophosphorylation sites of the macrophage colony-stimulating factor 1 receptor. .56 5704 5712 - 57.
Sapi E Flick M. B Gilmore-hebert M Rodov S Kacinski B. M 1995 Transcriptional regulation of the c-fms (CSF-1R) proto-oncogene in human breast carcinoma cells by glucocorticoids. 10 529 42 - 58.
Sapi E 2004 The role of CSF-1 in normal physiology of mammary gland and breast cancer: an update. 229 1 1 11 - 59.
Schmittgen T. D Livak K. J 2008 Analyzing real-time PCR data by the comparative CT method. Nature Pr otocol3 1101 1108 - 60.
Scholl S. M Mosseri V Tang R Beuvon F Palud C Lidereau R Pouillart P 1993 Expression of colony-stimulating factor-1 and its receptor (the protein product of c-fms) in invasive breast tumor cells. Induction of urokinase production via this pathway? Ann N Y Acad Sci.698 131 135 - 61.
Scholl S. M Pallud C Beuvon F Hacene K Stanley E. R Rohrschneider L Tang R Pouillart P Lidereau R 1994 Anti-colony-stimulating factor-1 antibody staining in primary breast adenocarcinomas correlates with marked inflammatory cell infiltrates and prognosis. 86 120 126 - 62.
Shurtleff S. A Downing J. R Rock C. O Hawkins S. A Roussel M. F Sherr C. J 1990 Structural features of the colony-stimulating factor receptor that affect its association with phosphatidylinositol 3-kinase. T he EMBO J.9 2415 2421 - 63.
Shyu A. B Wilkinson M. F Van Hoof A 2008 Messenger RNA regulation: to translate or to degrade .27 471 481 - 64.
Sonenberg N Hinnebusch A. G 2009 Regulation of translation initiation in eukaryotes: mechanisms and biological targets 136 731 745 - 65.
Srikantan S Gorospe M 2011 Unclipsing HuR nuclear function. .43 319 321 - 66.
Stark A Brennecke J Bushati N Russell R. B Cohen S. M 2005 Animal MicroRNAs confer robustness to gene expression and have a significant impact on 3’UTR evolution. 123 1133 1146 - 67.
Tang R Kacinski B Validire P Beuvon F Sastre X Benoit P De La Rochefordiere A Mosseri V Pouillart P Scholl S 1990 Oncogene amplification correlates with dense lymphocyte infiltration in human breast cancers: a role for hematopoietic growth factor release by tumor cells? .44 189 198 - 68.
Toy E. P Bonafe N Savlu A Zeiss C Zheng W Flick M Chambers S. K 2005 Correlation of tumor phenotype with c-fms proto-oncogene expression in an in vivo intraperitoneal model for experimental human breast cancer metastasis .22 1 9 - 69.
Toy E. P Lamb L Azodi M Roy W. J Woo H. H Chambers S. K 2010 Inhibition of the c-fms proto-oncogene autocrine loop and tumor phenotype in glucocorticoid stimulated human breast carcinoma cells 129 411 419 - 70.
Urlaub H Hartmuth K Kostka S Grelle G. M Luhrmann R 2000 A general approach for identification of RNA-protein cross-linking sites within native human spliceosomal small nuclear ribonucleoproteins (snRNPs). Analysis of RNA-protein contacts in native U1 and U4/U6.U5 snRNPs. 275 41458 41468 - 71.
Vollbrandt T Willkomm D Stossberg H Kruse C 2004 Vigilin is co-localized with 80S ribosomes and binds to the ribosomal complex through its C-terminal domain. 36 1306 1318 - 72.
Weber B Horiguchi J Luebbers R Sherman M Kufe D 1989 Posttranscriptional stabilization of c-fms mRNA by a labile protein during human monocytic differentiation. Mol. Cell Biol.9 769 775 - 73.
Woo H. H Zhou Y Yi X David C. L Zheng W Gilmore-hebert M Klugger H. M Ulukus E. C Baker T Stoffer J. B Chambers S. K 2009 Regulation of non-AU-rich element containing c-fms proto-oncogene expression by HuR in breast cancer 28 1176 1186 - 74.
Woo H. H Yi X Lamb T Menzl I Baker T Shapiro D. J Chambers S. K 2011 Posttranscriptional suppression of proto-oncogene c-fms expression by vigilin in breast cancer 31 215 225 - 75.
Receptor Phosphotyrosine 559 Signaling Pathway regulates Receptor ubiquitination and tyrosine phosphorylation.Xiong Y Song D Cai Y Yu W Yeung Y G Stanley E. R. ( 2011 ACsf-1 286 952 960 - 76.
E.R. (Yu W Chen J Xiong Y Pixley F. J Yeung Y G Stanley 2012 Macrophage proliferation is regulated through CSF-1 receptor tyrosines 544, 559 and 807. M112.355610. - 77.
Yi X Zhou Y Zheng W Chambers S 2009 HuR expression in the nucleus correlates with high histological grade and poor disease-free survival in ovarian cancer 49 93 98 - 78.
Zwaenepoel O Tzenaki N Vergetaki A Makrigiannakis A Vanhaesebroeck B Papakonstanti E. A 2012 Functional CSF-1 receptors are located at the nuclear envelope and activated via the110 isoform of PI 3-kinase. 26: 691-706. - 79.
Zheng D Ezzeddine N Chen C. Y Zhu W He X Shyu A. B 2008 Deadenylation is prerequisite for P-body formation and mRNA decay in mammalian cells 182 89 101