Open access peer-reviewed chapter

Phenotypic and Genetic Diversity of Uropathogenic Enterococcus faecalis Strains Isolated in the Primorsky Region of Russia

By Zaitseva Elena Aleksandrovna, Komenkova Tatiana Sergeevna, Melnikova Elena Aleksandrovna, Shadrin Andrey Mikhailovich and Luchaninova Valentina Nikolaevna

Submitted: May 3rd 2018Reviewed: July 25th 2018Published: November 5th 2018

DOI: 10.5772/intechopen.80485

Downloaded: 169

Abstract

Urinary tract infection (UTI) is a topical problem of the contemporary pediatrics, pediatric nephrology, and urology. E. faecalis isolated from urine of children was the most important factor in development of UTIs at departments for newborns in Primorsky region. The variability of biochemical and fermentation activities of pathogenicity factors and resistance to antibiotics suggested a phenotypic heterogeneity of E. faecalis. It was found that uropathogenic enterococci characterized with proteolytic activity are resistant to antibacterial agents with different action mechanisms. Clinical isolates of E. faecalis contained two and more studied pathogenicity genes. Eleven variants of genes combinations, which code pathogenicity factors of E. faecalis, were identified. Uropathogenic E. faecalis strains attributed to ST6, ST40, ST179, ST774, and ST116 are resistant to four and more groups of antimicrobial agents. Our research confirmed high virulence properties of E. faecalis isolated from urine of patients with and their manifestations depending on the patient’s age. Clinically significant E. faecalis strains have a complex of virulent properties, which allow the bacteria to materialize their pathogenic potential on all stages of the inflammation process in urinary system.

Keywords

  • urinary tract infections
  • Enterococcus faecalis
  • virulent properties
  • phenotypes
  • genotypes
  • newborns

1. Introduction

Urinary tract infection (UTI) is a topical problem of the contemporary pediatrics, pediatric nephrology, and urology, which takes the second or third place in the structure of children’s morbidity [1, 6, 9, 12]. Risk factors of UTI in children include neonatal period, in particular premature birth, family medical history, abnormalities of urinary tract development, disruptions of urodynamics, including vesicoureteric reflux, obstructive uropathy, neurogenic bladder malfunction, urolithiasis, constipation, fecal and perianal colonization, immunocompromising conditions, including AIDS, immunosuppression therapy, frequent bladder catheterization, diabetes, sexual activity in teenagers [1, 14, 15, 18]. Newborns and infants are under high risk of UTI development, among other factors, since their immune system is not yet sufficiently developed [7]. Among the many factors, which affect development and forecast of UTI, biological properties of microorganisms, which inhabit kidney tissue, are of no small importance [10, 22, 35, 43].

Etiological structure of UTI in children has changed recently. Many studies show the growing etiological significance of Enterococcus faecalis [1, 6, 8, 20, 37]. Clinical significance of enterococci, which were earlier considered in different saprophytes, is being reassessed currently [4, 10].

Increase in etiological significance of enterococci is caused by many reasons, including development of antibiotic resistance, in particular, resistance to cephalosporin, widely used for treating UTIs in children [8]. Enterococci can initiate the infectious process due to their genes coding many pathogenicity factors involved in adhesion and invasion processes, development of biofilms, and hystodamaging effect (Esp, Asa1, EfaA, CylA, CylM, GelE, FsrB, etc.) [6, 13, 16, 30, 35, 42]. It is known that virulence of microorganisms depends upon the quantity of these genes [17]. Scientists from Europe, England, America, India, and Japan are doing research in this area [21, 33, 38, 39, 41]. No research related to characteristics of intraspecific genetic variability, including pathogenicity factors, in uropathogenic E. faecalis isolates from children having UTI, has been done in Russia until now. All the above has been determined in the topic of the research, which was undertaken in the present paper.

The aim of this research was to identify genetic variability and phenotypic features of biologic properties in uropathogenic E. faecalis isolates from children having urinary tract infections to assess its virulent potential and clinical significance.

2. Materials and methods

At the first stage, bacterial tests of urine samples (n = 6438) isolated from patients in cases of UTI at the multispecialty regional children’s hospital from 2008 to 2016 were analyzed. Patients were aged from 3 days to 17 years.

At the second stage, biological properties and genetic variability of enterococci were studied. E. faecalis (n = 71) were isolated from urine of children with urinary tract infections and age from 3 days to 17 years in the diagnostic titer from 104 CFU/ml and higher during from 2013 to 2016. E. faecalis NCTC 12697 was used as the typical culture. All strains of uropathogenic E. faecalis were previously investigated using classical microbiological methods [22, 43]. Antimicrobial susceptibility was performed using disk diffusion method on the Muller-Hinton agar according to EUCAST.

Bacterial DNA of E. faecalis was isolated using DNA-express kit (Lytech, Russia). The testing of enterococci (n = 31) pathogenicity genes was made by polymerase chain reaction (PCR), using previously developed primer sets (Table 1) [5, 11, 32, 34], synthesized by Eurogen (Russia), on TProfessional 96 (Biometra, Germany). The amplification products were analyzed in a 1% agarose gel containing 1 μg/ml ethidium bromide in ultraviolet light using BioDocAnalyze (Biometra, Germany).

GenePrimer sequenceProduct size (bp)Reference
cylATGGATGATAGTGATAGGAAGT
TCTACAGTAAATCTTTCGTCA
517[11]
aggAAAGAAAAAGTAGACCAAC
AACGGCAAGACAAGTAAATA
1553[11]
efaAGACAGACCCTCACGAATA
AGTTCATCATGCTGCTGTAGTA
705[11]
eepGAGCGGGTATTTTAGTTCGT
TACTCCAGCATTGGATGCT
937[5]
espTTGCTAATGCTAGTCCACGACC
GCGTCAACACTTGCATTGCCGAA
933[32]
gelEACCCCGTATCATTGGTTT
ACGCATTGCTTTTCCATC
419[34]

Table 1.

Oligonucleotide primers used in the study.

The obtained data were processed using the parametric analysis method. From the indicators of descriptive statistics, the relative values (P, %), their errors (mp, %) were calculated. To evaluate the degree of interrelation, the Pearson correlation analysis (R) was performed with calculation of correlation coefficient (r) and reliability of correlation (p). At statistical processing of the received materials, the software package Statistica 10.0 is used in the operating environment Windows 2010.

The research was approved by Interdisciplinary Committee for Ethics of the Federal State Budgetary Educational Institution of Higher Education “Pacific State Medical University” of the Ministry of Healthcare of the Russian Federation (protocol no. 4, 26.12.2016).

3. Results

The most common uropathogen in children with UTI, who were treated at the multispecialty regional children’s hospital, is Escherichia coli, for which specific gravity equals from 33.92 ± 1.7 to 62.96 ± 1.2%. Most frequently, it was pointed out in outpatients (in 62.96 ± 1.2% cases); less frequently, it was found at departments for newborns (33.92 ± 1.7%). The second significant etiological factor of UTI in children was E. faecalis, for which specific gravity ranged from 16.14 to 32.5% [22]. At the same time, E. faecalis was the most important factor in development of UTIs at departments for newborns: it was found in 57.2% of cases (Figure 1). Frequency of identifying E. faecalis in newborns diagnosed with UTI ranged from 30.8 to 74.5% of cases over 9 years.

Figure 1.

The etiological structure of UTI in newborn.

The present study analyzed the features of phenotypic manifestations of biological properties, including antibiotic resistance of E. faecalis (n = 71) isolated from urine of children with UTI. All analyzed uropathogenic E. faecalis had typical properties—morphology (cocci or oval Gram-positive bacteria), biochemical activity against mannitol, methylene blue, its absence in rhamnose fermentation, variability in glucose, lactose, sucrose and 2,3,5-triphenyltetrazolium chloride (TTC), and lack of mobility and catalase (Table 2).

Most E. faecalis isolated from the urine of children with UTI had in vitro enzymatic activity associated with pathogenicity: hemolytic, proteolytic, lipolytic, and lecithinase. A capsule was found in 45.6 ± 6.6% of uropathogenic enterococci. An inverse relationship was established between the presence of a capsule in E. faecalis with α-type hemolysis (r = 0.3, p = 0.0001), fermentation of milk (r = 0.31, p = 0.00), and a positive correlation with the microorganism titer in the urine (r = 0.33, p = 0.0332).

A direct correlation was established among the lecithinase and DNAase activity of E. faecalis (r = 0.31, p = 0.0438), the manifestation of hemolytic activity (α- or β-type) in uropathogenic enterococci, and the presence of the gene gelE (r = 0.49; p˂0.05).

The capsule (р1–2˂0.001; р1–3˂0.01), milk fermentation (р1–2˂0.001; р1–3˂0.01), gelatinous (р1–2˂0.001, р1–3˂0.05), and lipolytic activity with respect to the tween 60 (р1–2˂0.01, р1–3˂0.01) was determined more often in E. faecalis, isolated from the urine of newborn children (group 1) with UTI, than in other age groups.

E. faecalis, isolated from children under 1 year (group 2), have hemolytic activity more often than other age groups (р2–1˂0.05, р2–3˂0.05), but expressed less gelatinous activity (р1–2˂0.001; р2–3˂0.001). In this group, lipolytic activity against Tween 60 was less pronounced, but the differences were significant only between groups 1 and 2 (p˂0.01).

E. faecalis isolated from patients older than 1 year (group 3) showed more lipolytic activity against Tween 80, compared to other age groups (p1–3˂0.001; p2–3˂0.01), gelatin’s fermentation was determined more often than in enterococci of the group 2 (p˂0.001). The hemolytic activity of enterococci in the group 3 differed little compared to the group of newborn children. The other biochemical properties associated with pathogenicity factors of E. faecalis strains of this age group were similar to enterococci isolated from children under 1 year of age (Table 2).

Assessment of antibiotics resistance revealed that all studied cultures of uropathogenic enterococci (n = 71) are sensitive to vancomycin and nitrofurantoin. We found that enterococci are highly resistant to erythromycin (77.1 ± 5.02%), tetracycline (73.2 ± 5.3%), fluoroquinolones of the II and the III generations (ciprofloxacin (55.1 ± 5.9%), norfloxacin (48.6 ± 9.9%), and levofloxacin (46.5 ± 5.9%)). Were identified E. faecalis cultures, which are resistant (20.1 ± 4.9%) and mid-resistant (8.9 ± 3.5%) to the reserve drug linezolid. More than half (59.2 ± 5.8%) of the studied cultures of uropathogenic enterococci were resistant to several antibiotics (four or more antimicrobial agents).

It was found that enterococci, which are sensitive to penicillins, were characterized with lipolytic, lecithinase, and hemolytic (β-type) activity in vitro. Enterococci cultures which are resistant to fluoroquinolones, fermented sucrose, had proteolytic activity, and did not break down lactose. E. faecalis, which are resistant to gentamicin and erythromycin, had a capsule. Furthermore, E. faecalis, which are resistant to linezolid and chloramphenicol, had gelatinase, lecithinase, and lipolytic activities, as compared to other cultures (these data were not published).

In that way, analysis of biological properties of E. faecalis, isolated from urine of children with UTI in Primorsky region, showed that overwhelming majority of cultures had typical properties. The mentioned variability of biochemical and fermentation activities of pathogenicity factors and resistance to antibiotics suggested a certain phenotypic heterogeneity of E. faecalis.

3.1. Molecular genetics typing of E. faecalis

E. faecalis was tested for genes, coding various pathogenicity factors, using PCR method. It was found that clinical strains (n = 30) of enterococci isolated from urine of children with UTI contained two and more studied pathogenicity genes. In this context, 27 out of 30 uropathogenic E. faecalis had four and more of the studied genes (Table 3).

Biological propertiesEnzymatic activity of E. faecalis
Newborns (n = 21)Children from 29 days to 1 year (n = 18)Children over 1 year old (n = 21)
Number of examined cultures, nAbs. (Р ± mр, %)Number of examined cultures, nAbs. (Р ± mр, %)Number of examined cultures, nAbs. (Р ± mр, %)
Reduction of TTC *■1918 (94.7 ± 5.1)1411 (78.6 ± 11.0)2120 (95.2 ± 4.7)
Reduction of methylene blue1919 (100)1414 (100)2121 (100)
Biochemical activity in relation to:
Mannitol2020 (100)1313 (100)1919 (100)
Glucose ▲2019 (95.0 ± 4.9)1312 (92.3 ± 7.4)1919 (100)
Lactose ▲2019 (95.0 ± 4.9)1312 (92.3 ± 7.4)1916 (84.2 ± 8.4)
Rhamnose210130190
Sucrose2017 (85.0 ± 8.0)1311 (84.6 ± 10.0)1916 (84.2 ± 8.4)
Presence of a capsule *▲2112 (57.1 ± 10.8)176 (35.3 ± 11.6)198 (42.1 ± 11.3)
Proteolytic activity in relation to:
Milk *▲2118 (85.7 ± 7.6)189 (50.0 ± 11.8)2110 (47.6 ± 10.9)
Gelatin *▲■209 (45.0 ± 11.1)172 (11.8 ± 7.8)217 (33.3 ± 10.3)
Lecithinase activity195 (26.3 ± 10.1)154 (26.7 ± 11.4)216 (28.6 ± 9.9)
Lipolytic activity in relation to:
Tween 201714 (82.4 ± 9.2)1211 (91.7 ± 7.9)1817 (94.4 ± 5.4)
Tween 60 *▲84 (50.0 ± 17.2)61 (16.7 ± 15.2)113 (27.3 ± 13.4)
Tween 80 ▲■2114 (66.7 ± 10.3)1712 (70.6 ± 11.0)1916 (84.2 ± 8.4)

Table 2.

Peculiarities of phenotypic manifestations biological properties of E. faecalis depending on the patient’s age.

Note: *, p < 0.05 between 1 and 2 groups; ▲, p < 0.05 between 1 and 3 groups; ■, p < 0.05 between groups 2 and 3; Abs., absolute.

IdSTIsolateGenotypeTotal number of genes
aggAespcylAefaAeepgelE
1787ST116PR042++++++6
1789ST179PRV 052++++++6
1791ST179PRV100++++++6
1790ST179PRV105++++++6
ndPRV086++++++6
ndPR 230++++++6
1788ST179PRU047+++++5
ndPR 181+++++5
1781ST16PR050+++++5
1786ST41PRV049+++++5
ndPRL079+++++5
ndPRV080+++++5
1793ST774PRAs81+++++5
ndPR 198++++4
ndPR 158++++4
1780ST6PRV054++++4
1779ST6PRN030++++4
1795ST774PRA029++++4
1792ST774PR51++++4
1784ST40PR055++++4
1785ST40PRA038++++4
ndPR 228++++4
1782ST16PRV092++++4
ndPR 215++++4
ndPR 223++++4
1794ST774PR040++++4
ndNCTC 12697++++4
ndPR 97++++4
ndPR 161+++3
ndPR 206+++3
1783ST21PRV082++2

Table 3.

Genotypes of uropathogenic E. faecalis in Primorsky region.

Note: nd, not determined.

Eleven variants of genes combinations, which code pathogenicity factors of E. faecalis, were identified. The most common variants are (aggA-esp-cylA-efaA-eep-gelE) and (aggA, efaA, eep, gelE).

Multilocus sequence typing (MLST) divided 17 E. faecalis strains into eight (ST6, ST16, ST21, ST40, ST41, ST116, ST179, and ST774) sequence types (The results have not been published.) It was noticed that uropathogenic E. faecalis strains attributed to ST6, ST40, ST179, ST774, and ST116 are resistant to four and more groups of antimicrobial agents (Table 4).

IdIsolateSTPhenotype of antibiotic resistanceGenotype
1785PRA03840ТЕТ-ERT-AmG-CHL-LZDesp-efaA-eep-gelE
1784PR055ТЕТ-ERT-AmG-CHL
1780PRV0546ТЕТ-ERT-AmG-CHL-FLQaggA-efaA-eep-gelE
1779PRN030ТЕТ-ERT-AmG-CHL-FLQ
1788PRU047179ТЕТ-ERT-AmG-LZDaggA-cylA-efaA-eep-gelE
1789PRV052ТЕТ-ERT-AmGaggA-esp-cylA-efaA-eep-gelE
1791PRV100ТЕТ-ERT-AmG-CHL
1790PRV105ERT-AmG-CHL-FLQ
1787PR042116ТЕТ-ERT-AmG-CHL-LZD
1781PR05016ТЕТ-ERTaggA-esp-cylA-efaA-eep
1782PRV092ТЕТ-ERT-AmGaggA-cylA-efaA-eep
1794PR040774AmG-FXaggA-esp-efaA-eep
1793PRAs081ТЕТ-ERT-PEN-AmG-FLQaggA-esp-efaA-eep-gelE
1795PRA029ТЕТ-ERT-PEN-FLQaggA-efaA-eep-gelE
1792PR051ТЕТ-ERT-AmG-FLQ
1786PRV04941ТЕТaggA-esp-efaA-eep-gelE
1783PRV08221FLQefaA-eep

Table 4.

Antibiotic resistance of uropathogenic E. faecalis depending on the sequence type.

Note: TET, tetracycline; ERT, erythromycin; AmG, aminoglycosides; FLQ, fluoroquinolones; CHL, chloramphenicol; LZD, linezolid; PEN, penicillins.

The results demonstrate broad variability of the range of genes, which code pathogenicity factors and reveal sequence types with multiple resistances to antimicrobial agents among uropathogenic E. faecalis isolated from children with UTI in Primorsky region.

4. Discussion

Urinary tract infection is an inflammatory process in the organs of the urinary system without specifying the level of damage or growth of microorganisms in the urinary tract with possible development of local inflammatory changes. UTI refers to the factors that initiate the development of chronic kidney disease and depends on the age of the children [27]. Etiological multifactority is peculiarity of these infections. For a long time, commonly recognized pathogens of uroinfections are Gram-negative enterobacteria, among which Escherichia coli is prevalent [25, 26, 29, 31, 40, 44].

Interest to studying enterococci as participants of infectious diseases has increased in recent years. Our research has shown that E. faecalis are a common pathogen, which causes UTI in children, most often in newborns (from 30.8 up to 75% of cases). Perhaps this is not accidental, as according to some authors, this microorganism is detected in children from the first days of life and its amount exceeds the content of E. coli in the newborn period [19]. The reason for this microbial composition of urine appears to be functional immunodeficiency in this category of patients.

However, until now, the true etiological significance of these microorganisms in the development of the infectious process and unfavorable outcomes remains uncertain due to the ever-changing properties of E. faecalis. It is known that the ability of bacteria to affect the kidneys and urinary tract is determined not by one but by a complex of properties necessary for this process, that at the different stages of the infectious process in the urinary system organs from the microorganism, priority expression of certain pathogenetically significant traits and/or their combinations is required [6].

All analyzed uropathogenic E. faecalis had typical properties—morphology, biochemical activity against mannitol, methylene blue, its absence in rhamnose fermentation, variability in glucose, lactose, sucrose and 2,3,5-TTC, and lack of mobility and catalase.

At the same time, weak and delayed acid formation from lactose was in three cultures (only on the third day), and in 12 isolates during fermentation of sucrose (by day 10). The results obtained with respect to a number of carbohydrates differ from the literature data, as it is known that E. faecalis ferment lactose and sucrose, and in relation to other sugars can be variable (Berdzhi). Possibly, this is associated with the spread of certain E. faecalis biovars in the territory of Primorsky Krai or within a single multispecialty hospital.

According to results of research conducted in recent years, it was determined that enterococci produce many virulence factors, which conduce to development of the infectious process (hemolysin, gelatinase, enterococcal surface protein, aggregation substance, serine protease, capsule, etc.). The greatest number of virulence factors was found in E. faecalis isolated from urine. High proteolytic activity of E. faecalis (hydrolysis of gelatinase, casein, and collagen) causes toxic damage to tissues and conduce to cicatricial changes in kidney [6, 19, 43].

Moreover, the change in the properties of the microorganisms, causing the urinary tract infection, such as the development of resistance factors to antimicrobial drugs and the biofilm formation, makes it difficult to manage patients, especially with chronic persistent and often recurrent infection.

Our research confirmed high virulence properties of E. faecalis isolated from urine of patients with and their manifestations depending on the patient’s age. For example, there is a negative correlation between the proteolytic activity of E. faecalis and the age of the children (r = 0.28, р = 0.002). Most E. faecalis isolated from the urine of children with UTI had in vitro enzymatic activity associated with pathogenicity: hemolytic, proteolytic, lipolytic, and lecithinase.

Currently, lipase is referred to understudied factors of enterococcal persistence, although it is known that lipase may be a potential virulence factor of E. faecalis [12]. Among the studied enterococci isolated from children with UTI, lipolytic activity was determined in 85.0 ± 8.2% of the cultures (more often with respect to Tween 20 and Tween 80). Enterococcus cultures showed heterogeneity in proteolytic and hemolytic activity. A reliable direct correlation between the phenotypic manifestation of β-type hemolytic activity with hydrolysis of gelatin (r = 0.58, p = 0.0001) and lecithinase activity (r = 0.52, p = 0.0004) of this uropathogen has been established. This confirms the combined effect of these pathogenic factors at a certain stage of the inflammatory process. A relationship was established between the phenotypic manifestation of pathogenicity factors and the age of patients.

The most common properties of E. faecalis isolated from urine of newborn children were a capsule, proteolytic, and lipolytic (in relation to Tween 60) activity. Enterococci isolated from 1-year-old children with UTI most frequently were characterized with hemolytic activity. Lipolytic (in relation to Tween 80) activity was most frequently found in cultures isolated from patients older than 1 year. The prevalence of these virulence factors suggests that they are associated with virulence of this species in UTI. Such features of the manifestation of biological properties in vitro indicate the selection of etiologically significant E. faecalis at the level of the macroorganism.

Furthermore, connection between sensitivity to antimicrobial drugs of E. faecalis and its biological properties was identified. It was found that uropathogenic enterococci characterized with proteolytic activity are resistant to antibacterial agents with different action mechanisms. In the work, it was found that E. faecalis, resistant to linezolid and chloramphenicol drugs that suppress protein synthesis at the level of the 50S subunit of the bacterial ribosome, possess a high pathogenic potential. These results require further research in this direction.

Interesting data were obtained with regard to the sensitivity of uropathogenic E. faecalis to the reserve drug linezolid, recommended for treatment of infections caused by strains, which are resistant to vancomycin, aminoglycosides, and betalactams. In Primorsky Krai, E. faecalis cultures were found resistant and intermediate sensitivity to linezolid. However, in Russia in the period from 2005 to 2013, there were isolated single enterococcal strains with reduced sensitivity to linezolid.

This way, the mentioned variability of biochemical and fermentation activity of factors related to pathogenicity demonstrated phenotypic heterogeneity of enterococci and might have a certain diagnostic significance.

Pathogenicity factors of bacteria are genetically determined by properties which are localized in genome of microorganisms in the form of “pathogenicity islands” [17]. These genetic elements can contain various sets of virulence genes, which are important for the development of the enterococcal infectious process, including genes of antibiotics resistance [17, 24]. At the present stage, the association of antibiotic resistance of E. faecalis with pathogenic factors is actively studied. It is known that strains of enterococci resistant to ampicillin, ciprofloxacin, and gentamicin, but sensitive to vancomycin and nitrofurantoin have more pathogenicity factors (hemolysin, gelatinase, hyaluronidase, form biofilms) than vancomycin resistant [2, 28]. E. faecalis having the asa1 gene are more resistant to fluoroquinolones (norfloxacin, ciprofloxacin, and levofloxacin) than isolates lacking this gene. Resistance to ciprofloxacin is significantly higher in E. faecalis having the genes cylL and cylS than in strains with their absence [23, 28]. esp gene-positive E. faecalis are more resistant to doxycycline than esp gene-negative cultures [3]. Among the strains with multidrug resistance, a high prevalence of genes asa1 and esp was observed [23, 36].

The research implemented using PCR method enabled to characterize in greater detail the structure of E. faecalis population isolated from children with UTI from Primorsky region. In our research, significant variability in occurrence frequency of the studied genes was found. Two of them—efaA (coding the surface antigen A (EfaA), which initiates the infectious process) and eep (coding Eep protein, which conduces to formation of a biofilm, making it resistant to various biological stress factors) were found in all studied uropathogenic E. faecalis, which proves their involvement in certain stages of the infectious process.

MLST analysis conducted earlier revealed eight sequence types, five of which were characterized by multidrug resistant.

This way, clinically significant E. faecalis strains have a complex of virulent properties, which allow the bacteria to materialize their pathogenic potential on all stages of the inflammation process in urinary system. This makes further research of the listed factors in clinical E. faecalis necessary to estimate objectively the contribution of these properties of the agent into pathophysiologic mechanism of infectious and inflammatory diseases.

5. Conclusions

  1. Important role in the etiology of UTI is played not only by Gram-negative bacteria of the Enterobacteriaceae family, but also by gram-positive E. faecalis, which are of paramount importance in the development of UTI in newborns.

  2. E. faecalis, isolated from the urine of children with UTI, have a complex of pathogenicity factors necessary for the development of the inflammatory process and their prolonged persistence in the urinary tract. The relationship between E. faecalis pathogenicity factors and the age of patients was determined.

  3. Uropathogenic E. faecalis possess a polyantibiotic resistance, which is associated with its biological properties and belonging to a particular sequence type.

  4. A set of phenotypic manifestations of the biological properties of E. faecalis (the presence/absence of hemolytic, gelatinase, lecithinase, lipolytic activities) established in the study may determine its clinical significance and serve as an in vitro diagnostic marker of resistance of the studied uropathogen to certain groups of antibacterial drugs.

Acknowledgments

The research was supported with an internal grant from the university (registration No. AAAA-A18-118031390014-9).

Conflict of interest

The authors declare that there is no conflict of interests.

© 2018 The Author(s). Licensee IntechOpen. This chapter is distributed under the terms of the Creative Commons Attribution 3.0 License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

How to cite and reference

Link to this chapter Copy to clipboard

Cite this chapter Copy to clipboard

Zaitseva Elena Aleksandrovna, Komenkova Tatiana Sergeevna, Melnikova Elena Aleksandrovna, Shadrin Andrey Mikhailovich and Luchaninova Valentina Nikolaevna (November 5th 2018). Phenotypic and Genetic Diversity of Uropathogenic Enterococcus faecalis Strains Isolated in the Primorsky Region of Russia, Microbiology of Urinary Tract Infections - Microbial Agents and Predisposing Factors, Payam Behzadi, IntechOpen, DOI: 10.5772/intechopen.80485. Available from:

chapter statistics

169total chapter downloads

More statistics for editors and authors

Login to your personal dashboard for more detailed statistics on your publications.

Access personal reporting

Related Content

This Book

Next chapter

Introductory Chapter: An Overview on Urinary Tract Infections, Pathogens, and Risk Factors

By Payam Behzadi

Related Book

First chapter

Introductory Chapter: Gene Regulation, an RNA Network-Dependent Architecture

By Payam Behzadi and Lernik Issakhanian

We are IntechOpen, the world's leading publisher of Open Access books. Built by scientists, for scientists. Our readership spans scientists, professors, researchers, librarians, and students, as well as business professionals. We share our knowledge and peer-reveiwed research papers with libraries, scientific and engineering societies, and also work with corporate R&D departments and government entities.

More about us