Microbial Community Structure and Metabolic Networks in Polar Glaciers

1. Introduction

Polar glaciers have aroused great interest over the last year, and their study has increased since they are sentinels of climate change. Although both poles are extreme environments (in terms of low temperatures, high UV radiation, lack of light in winter and permanent solar radiation in summer, scarce nutrients, etc.), Arctic and Antarctic glaciers are very different. The North Pole is an ocean surrounded by land, while the South Pole is a continent surrounded by water. This distinction confers them very unique geographical and environmental characteristics.

Metabolically active microbial communities have been identified in both the Arctic [1] and Antarctic glaciers (Figure 1) [2]. These microbial communities include bacteria, archaea, microeukaryotes, and viruses [3].

Arctic glaciers do not reach such distant latitudes or low temperatures as Antarctic glaciers do. These are some of the reasons why they are being extremely affected by global warming. There are glaciers around the entire Arctic Ocean, but polar glaciers in North America [4, 5], Greenland [6, 7, 8], Svalbard [9, 10], and Iceland [11, 12] (Figure 1) have been the most widely studied from a microbiological point of view. Antarctic glaciers present exceptional environmental conditions. Being in higher latitudes allows the existence of very low temperatures and high rates of solar radiation in summer. Some published reports on glacial and subglacial microbiology refer to very extreme latitudes that reach −75°S in the high Antarctic Plateau [13], −77°S in Lake Vostok [14], and −84°S in the West Antarctic ice sheet [15] (Figure 1).

In the study of glacier microbiology, a variety of techniques have been traditionally used, such as microscopy techniques [16], cell cultures, and isolation of microorganisms [17]. However, the most significant advance has been achieved with the application of metagenomics. This discipline has allowed both the knowledge of the microbial communities’ structure and the comprehension of their metabolic potential.

2. Microbial community structure through reconstruction of microbial genomes in polar glaciers

Glaciers have recently been considered authentic biomes [18]. It has been observed that microbial community composition depends on the area of the glacier studied [19]. In most of them, three well-defined and interconnected ecosystems can be defined: supraglacial, englacial, and subglacial ecosystems. These ecosystems are different in their solar radiation, water content, nutrient abundance, and redox potential [20]. These factors influence in the abundance and diversity of microbial populations inhabiting glaciers (Figure 2). They also affect the type of functionality and the biogeochemical cycles in these ecosystems.

3. Metabolic potentials and biogeochemical cycles in polar glaciers through reconstruction of microbial metagenomes

Living in such extreme environments implies coping with low temperatures, desiccation, low nutrients availability, and ultraviolet irradiation [30]. Over the last years, metagenomics have allowed a great understanding of metabolic potentials and biogeochemical cycles in polar glaciers through reconstruction of microbial genomes (Figure 3).

Regarding the supraglacial ecosystem, metagenomic studies have demonstrated the wide diversity of functions in cryoconite holes, with a range of metabolic pathways which depend on their competence to acquire and degrade available nutrients [10]. Functional analyses highlighted the importance of stress responses and efficient carbon and nutrient recycling.

Metagenomic techniques have also been used to identify algal communities in the supraglacial ecosystem and their relationship with geochemical factors [12].

The potential of archaea as important ammonia oxidizers has been another finding achieved by metagenomics [11].

Little is known about the metabolic potential and the biogeochemical cycles of microbial communities inhabiting the englacial ecosystem. It has been reported that microorganisms enclosed in the englacial ice present very low metabolic rates, using energy only to repair damaged biomolecules and not to grow and reproduce [31].

In the subglacial ecosystem, some metagenomics data implied that the most abundant and active component were bacteria within the order Methylococcales[6]. Transcripts of the particulate methane monooxygenase from these taxa were detected, demonstrating that methanotrophic bacteria were functional members of this subglacial ecosystem.

At least three modes of carbon fixation were inferred [14]. The most common mode of carbon fixation was the reductive pentose phosphate cycle. The second in frequency was the reductive tricarboxylic acid pathway. This cycle also produces precursors for nucleic acid and aromatic amino acid syntheses. The third type of carbon fixation, the reductive acetyl-CoA pathway, is the one used by archaea [14].

These investigations did also identify genes that carry out various parts of the nitrogen cycle, including nitrogen fixation (Actinobacteria, Cyanobacteria, Betaproteobacteria, and Gammaproteobacteria), nitrification (Alphaproteobacteriaand Betaproteobacteria), denitrification (Gammaproteobacteria), nitrate reduction (Betaproteobacteriaand Gammaproteobacteria), anammox (Planctomycetes), assimilation (most microorganisms from these investigations), and decomposition (fungi and other heterotrophs) [14].

Characterization of the Antarctic Blood Falls microbial assemblage revealed taxa that could participate in active sulfur cycling, including autotrophs and heterotrophs such as Desulfocapsa, Geopsychrobacter, Thiomicrospira, and Thermacetogenium[32]. Although these microorganisms usually inhabit the subglacial ecosystem, in Blood Falls, they have been identified in brines collected from outflowing fluids (Figure 3).

4. Comparison of metagenome analysis techniques

The metagenome of polar microorganisms has been widely studied in recent years. Their results can provide a great amount of information about the biodiversity, survival capacity, and functioning of microbial communities in these extreme environments. In addition, information about ancient communities preserved within glacial ice through time can be obtained [33].

4.1 Sanger

Between 1975 and 2005, most of the DNA sequences were obtained through the application of the Sanger techniques [34], which led to the first generation of automated DNA sequencers [35] (Figure 4). For 16S or 18S rRNA sequencing, PCR amplification was carried out with specific primers (Table 1) and sequencing instruments based on capillary electrophoresis. Nowadays, Sanger sequencing achieves high read lengths of up to 1000 bp and per base and accuracies of 99.999% [36]. In the de novo metagenomics, randomly fragmented DNA was cloned into a high-copy-number plasmid and then transformed in Escherichia coli. However, whole-genome sequencing by this technology was extremely expensive and time consuming.

	Specificity	Primers	Sequence (5′ to 3′)	Product length (bp)	Authors	Reference
Sanger	Bacteria	16S-F	AGAGTTTGATCCTGGCTCAG	1000	Lane, 1991	[45]
	Bacteria	16S-R	CACGAGCTGACGACAGCC	1000	Lane, 1991	[45]
	Archaea	20F	TTCCGGTTGATCCYGCCRG	1372	Massana et al., 1997	[46]
	Archaea	U1392R	ACGGGCGGTGTGTRC	1372	Massana et al., 1997	[46]
	Eukarya	Euka1F	CTGGTTGATCCTGCCAG	500	Lefranc et al., 2005	[47]
	Eukarya	Euk502R	TGATCCTTCTGCAGGTTCACCTAC	500	Amann et al., 1990	[48]
NGS	Bacteria	(V3–V4) 341F	ACACTGACGACATGGTTCTACACCTACGGGNGGCWGCAG	100	Herlemann et al., 2011	[49]
	Bacteria	(V3–V4) 805R	TACGGTAGCAGAGACTTGGTCTGACTACHVGGGTATCTAATCC	100	Herlemann et al., 2011	[49]
	Eukarya	(V9) 1380F	GCCTCCCTCGCGCCATCAGXXXXXCCCTGCCHTTTGTACACAC	43	Amaral-Zettler et al., 2009	[50]
	Eukarya	(V9) 1510R	GCCTTGCCAGCCCGCTCAGCCTTCYGCAGGTTCACCTAC	39	Amaral-Zettler et al., 2009	[50]

Table 1.

Primer sequences for 16S or 18S rRNA sequencing.

Some examples of microorganisms from polar glaciers analyzed with these technologies were Antarctic bacteria from the Dry Valleys [37] and the Arctic ice pack [38]. In general, the number of sequences identified by this technique was scarce. However, this method has the advantage of generating long reference sequences, which are very useful for studies of taxonomy and biodiversity.

5. Conclusions

• Extraordinary advances in metagenomics have allowed a great understanding of microbial ecology and function of polar glacier microbial communities.

• Important novel tools to study environmental microbiology based on metagenomics are being developed.

• Third-generation technologies may further revolutionize metagenomic research.

• The application of new technologies to metagenomic studies of polar glaciers will enable to link the diversity and functionality of these habitats.

• Significant challenges for metagenomics remain, especially in data processing and genome analysis.

Acknowledgments

This research was supported by the Spanish Ministerio de Ciencia, Innovación y Universidades (Grants CTM 2010-12134-E/ANT and CTM2011-16003-E) and the Institute of Health Carlos III (Grant PI14/00705). E.G.L. is a recipient of a Ciencia, Innovación y Universidades Fellowship (Grant PTA2016-12325-I, Programa Nacional de Contratación e Incorporación de RRHH). We thank Paula Alcazar for reading this manuscript and for her helpful suggestions and revisions.

Conflict of interest

The authors declare that none of us has any competing commercial interests in relation to the submitted work.