Results summary of the known field trials carried out in three citrus-growing countries of the Mediterranean area to evaluate the effect of CEVd and HSVd on vegetative growth and yield of different citrus scion and rootstock combinations.
\r\n\tCKs have crucial roles in various viral infections such as influenza, hepatitis B virus (HBV), hepatitis C virus (HCV), viral meningitis, human immunodeficiency virus (HIV), and SARS-CoV-2.
\r\n\tCKs mediate the directing of the transport of leukocyte cells into the tumor microenvironment to generate the host response against cancer. CKs can directly modulate tumor tissue expansion by inducing the proliferation of cancerous cells and inhibiting their apoptosis. They can also indirectly modulate the growth of tumor tissue through the effects of CKs on tumor stromal cells, by inducing the release of growth and angiogenic factors of cells that make up the tumor microenvironment.
The continuous investigation on strategies for size reduction while maintaining, or even increasing, power of technological devices demands cooling systems with higher thermal efficiency and smaller sizes. One approach relied on the modification of heat sinks by incorporating microchannels to increase the heat exchange surface. Despite being a well-adopted strategy, its complex configurations proved to be difficult to manufacture [1, 2]. Other strategies focused on the type of the used fluids for the cooling process. Dielectric fluids [1, 3], two-phase fluids [3, 4], and nanofluids (NFs) [5, 6, 7, 8] have been thoroughly investigated. Among these three, the nanofluids, which are fluids comprised of particles, with size ranging from 1 to 100 nm, suspended in a base fluid, have been reported as presenting a better thermal conductivity than the base fluid [8, 9]. Nevertheless, some challenges regarding their usage, such as agglomeration, long-term stability, and high-costs, still need further investigation [8, 10, 11, 12]. The most commonly used nanoparticles (NPs) for NFs are metallic, such as Cu, Ag, Au, and Fe, or non-metallic such as Al2O3, CuO, TiO2 SiC, and carbon nanotubes. Many authors reported that the heat transfer of NFs is influenced by several factors such as shape, dimensions, volume fractions in the suspensions, and the thermal properties of the particle materials [11, 13, 14]. Therefore, enhancement in heat transfer was also reported, but only for small concentrations of NPs [8, 9].
\nAbareshi et al. [15] have evaluated the thermal conductivity of nanofluids with different volume fractions of Fe3O4 NPs, at different temperatures. The thermal conductivity was reported to increase up to 11.5% for a volume fraction of 3 vol% at 40°C. Xia et al. [16] have investigated the heat transfer coefficient of nanofluids using TiO2 and Al2O3 NPs, with different volume fractions. For a volume fraction of 1%, the heat transfer coefficient was significantly increased for both nanofluids, compared with deionized water. Gavili et al. [17] have studied the thermal conductivity of ferrofluids with Fe3O4 particles of approximately 10 nm in diameter, suspended in deionized water. With the application of a magnetic field, the thermal conductivity was increased up to 200% for a 5% volume fraction. Kim et al. [18] have investigated the thermal conductivity of alumina- and distilled water-based nanofluids, with concentrations of 0.5, 1, and 2 wt%. The conductivity was found to increase with the increasing of the NPs concentration. Al-Rjoub et al. [19] have tested four cooling liquids: deionized water; distilled water; borax buffer; and Al2O3 NPs solution, on a microscale heat exchanger. It was found that the deionized water has presented the lowest heat removal capacity, while the Al2O3 solution showed the highest capacity, corresponding to about 69% increase.
\nThe majority of microchannel heat sink devices that can be found in literature were fabricated in silicon, due to its thermal conductivity. However, the fabrication process of those devices can be laborious and needs extremely expensive facilities. Novel, fast, and low-cost fabrication techniques have been developed by means of different kinds of polymers [20, 21, 22]. PDMS is a silicone elastomer with a set of properties that make it suitable for many applications and is a popular choice for microfluidic devices fabrication [21, 22]. Besides being cheaper than the monocrystalline silicon, it presents a low elasticity change versus temperature, high thermal stability, chemical inertness, dielectric stability, shear stability, high compressibility, and hyperelasticity [23, 24, 25, 26, 27]. Moreover, it is non-toxic and biocompatible [25, 27, 28, 29]. PDMS devices can be manufactured by simple techniques at room temperature, such as replica molding.
\nThe 3D printers are gaining an increased attention by both academic and industrial community to produce microdevices and models at an extremely low cost. Some successful applications can already be found in lab-on-a-chip tools [30], microfluidics [31, 32], and biomedical
This section describes the experimental protocol to develop the nanofluids and the fabrication process to produce the heat sinks, as well as the used experimental setup.
\nTwo different types of NPs were used on the flow and heat experiments: alumina oxide (\n
The co-precipitation was initiated with the preparation of the precipitation agent by adding 0.01 g of cetrimonium bromide (CTAB), diluted in 3 mL of distilled water, to 20 mL of ammonium hydroxide (\n
To conclude the process, the NPs were washed several times with distilled water with the assistance of a strong magnet.
\n\nFigure 1 shows the synthesized NPs and the representative transmission electron microscopy (TEM) image. A detailed description of this process can be found at Cardoso et al. [35].
\nMagnetic iron oxide NPs and representative TEM image, adapted from [
Despite the TEM images show the aggregates of \n
The NPs show a normalized magnetization of ~69 emu.g 1 at ~10 kOe, which corresponds to the saturation magnetization, and also show a superparamagnetic behavior with an extremely low coercivity of 1.6 Oe [35, 36, 37].
\nThe heat sink microchannel device was produced based on a scaffold-removal technique [25]. First, the molds were drawn by using the Autodesk Inventor® software and then printed at the FDM 3D printer Ultimaker 2+ (Ultimaker, Netherlands). The first mold was printed with acrylonitrile butadiene styrene (ABS), whereas the second one was printed with polylactic acid (PLA). The fabrication of the molds was performed with a nozzle with a diameter of 0.4 mm, whereas the layer resolution was about 100 μm. The main dimensions of the ABS master mold can be found in Figure 2.
\nSchematic representation of the main dimensions of the ABS master mold.
Once the 3D models were printed, PDMS was prepared by adding a PDMS curing agent into the pre-polymer with a mixing ratio of 1:10. The PDMS was poured onto the PLA mold with the ABS master mold inside it. Once the PLA mold was filled with PDMS, the elastomer was cured at room temperature for about 1 day. Finally, the PDMS was removed from the PLA mold and immersed in an acetone bath to remove the ABS for approximately 24 h. Figure 3 shows the schematic diagram of all the main steps to produce the PDMS heat sink device. The overall cost to fabricate the PDMS heat sink device is about 3.8 €. This cost includes the printing of the ABS master mold (∼1 €) and PDMS casting process (∼2.8 €).
\nSchematic representation of main steps to fabricate the PDMS heat sink.
Notice that after the PDMS curing process, small holes were made below the inlet and outlet to insert the thermocouples (type K). Figure 4 shows the PDMS heat sink microfluidic device used in the flow and heat experiments.
\nPDMS heat sink microfluidic device with the inserted thermocouples.
The PDMS heat sink was placed on top of a hot plate controlled by a 9400-temperature controller (CAL Controls). The temperature of the plate was set to 60°C, whereas the flow rate of the fluids was controlled by a syringe pump (Harvard) connected to the inlet of the heat sink. The temperature at the entrance and exit of the device was acquired through a data acquisition instrument connected to the thermocouples of the device. Wood and polystyrene blocks were used to minimize the heat losses. Figure 5 shows a schematic diagram of the experimental setup. The flow of the \n
Schematic representation of the experimental setup.
To evaluate the influence of the nanofluids properties in the heat sink microfluid device, the tests were performed using distilled water, \n
The properties of the nanofluids were obtained taken into account fundamental equations described on previous studies [39, 40]. The thermal conductivity of the nanofluid was obtained according to the Maxwell model described by the following Equation [39, 40]:
\nwhere \n
The nanofluid density and heat capacity were calculated through the weighted average of the individual properties of both the NPs and base fluid. The first is expressed by Eq. (3) [14, 41] and the latter by Eq. (4) [11, 14].
\nIn the abovementioned equations, \n
The nanofluid viscosity was determined through the equation proposed by Batchelor [42]:
\n\n\n
where \n
Within the microfluidic device, the heat transfer will occur by convection inside the microchannels and by conduction in the walls between them. Consequently, the mathematical approach that better allowed the evaluation of the heat transfer was described by Ma et al. [10]. The convection heat transfer coefficient was calculated by iterations using the following equations:
\nwhere \n
where \n
In this section, the obtained results are presented and discussed. The temperature measurements and the known properties of the materials were used to calculate the parameters described on the previous section. Using those parameters, the influence of the environment conditions and of the fluid properties in heat transfer was analyzed.
\nAs described previously, the prepared nanofluids with iron oxide (\n
\nFigure 6 shows the temperature difference between the inlet and the outlet as the tested nanofluids flow through the proposed PDMS heat sink. Overall, it is possible to conclude that both tested nanofluids present a bigger temperature difference between the inlet and the outlet in comparison with distilled water. Hence, these measurements indicate that the amount of heat energy absorbed by both nanofluids was bigger than that absorbed by the distilled water. In addition, the amount of heat absorbed by the nanofluids was found to be bigger for smaller flow rates, as shown in Figure 6. These results corroborate the measurements performed by Chein and Chuang [43], where they have investigated the heat performance of nanofluids with CuO NPs in a microchannel heat sink. These results also show that the flow rate affects the amount of heat absorbed by the nanofluids.
\nTemperature difference between the inlet and the outlet for the tested nanofluids at the proposed PDMS heat sink microfluidic device.
In Figure 7, an increase of the convective heat transfer coefficient was registered on both nanofluids, in comparison to the base fluid. The increase was more pronounced for the alumina nanofluid due to the greater stability of the nanofluid and bigger thermal conductivity of these kind of NPs [6]. By increasing the convective heat transfer coefficient, an increase of the heat transfer rate is expected. In Figure 8, it is possible to observe an increase in the heat transfer rate for both tested nanofluids in comparison with distilled water. From these results, it is also possible to conclude that for both nanofluids, the convective heat transfer coefficient and heat transfer rate increase with the flow rate, which agrees with the results obtained by Wen and Ding [44].
\nConvective heat transfer coefficient of distilled water, alumina, and iron oxide nanofluids as the function of the flow rate.
Heat transfer rate of distilled water, alumina, and iron oxide nanofluids as the function of the flow rate.
\nFigure 9 compares the convective heat transfer coefficient for two different concentrations of NPs, i.e., 1 and 2.5% of both \n
Convective heat transfer coefficient of nanofluids as the function of the flow rate, for two different concentrations of alumina and iron oxide NPs.
The biggest advantage of the developed PDMS heat sink device is the ability to visualize the flow phenomena happening inside the microchannels. By using a high-speed video microscopy system, it was possible to visualize several flow phenomena of the nanofluids such as the formation, growing, and breakdown of NPs clusters (see Figure 10). From these observations, it was concluded that one of the main causes for the formation of the clusters was the high roughness of the PDMS surface channels (Figure 11). This verified roughness was caused by the ABS master mold fabricated by the FDM 3D printer. In order to improve the surface roughness, the ABS master molds should undergo an acetone vapor treatment before performing the PDMS casting procedure. More detailed information about this method can be found elsewhere [27].
\nOptical images of the formation, growing, and breakdown of a cluster of NPs.
Optical image of the surface roughness of the heat sink device used in this study.
Another interesting advantage of this PDMS microfluidic device is the ability to visualize both the flow and thermal performance of the system by using a thermographic camera, as shown in Figure 12. Notice that the temperatures acquired were from the surface of the heat sink device and not directly from the working fluid flowing in the microchannels. In fact, PDMS is transparent to visible radiation but partially opaque to the infrared (IR) radiation. Hence, to obtain the temperatures more closely related to the working fluids flowing through the microchannels, the thickness of the upper walls should be reduced in future experiments. A very interesting observation was the ability to detect bubbles that are likely to happen in microfluidic devices. In Figure 13, it is possible to visualize a bubble within the microchannel and the thermal performance of the heat sink device.
\nTemperature gradient analyzed through the thermographic camera at three different instants: t = 0 s; t = 60 s, and t = 120 s.
Formation of a bubble at the entrance of the microchannels, which affects the thermal performance of the microfluidic device.
In this study, a microchannel device was successfully manufactured and used in microfluidic essays. Nevertheless, some limitations arose throughout the work. Despite the advantages of using PDMS, some properties of the material, such as the low conductivity and partial opacity to the infrared (IR) radiation, were not favorable for the experiments. Also, the walls of the heat sink were rough due to the ABS master mold used in the fabrication technique, and the thickness should be reduced. The stability of the nanofluids has yet to be optimized since the deposition of NPs was detected on the heat sink walls. Future works will aim to improve of those limitations.
\nThe main objective of this work was to show the potential of a PDMS heat sink microfluidic device to perform flows and heat transfer studies of nanofluids. The PDMS heat sink device was produced by using the FDM 3D printing process, combined with a PDMS casting technique. This fabrication process allowed to manufacture devices in an easy, low-cost, and reasonable reproductively way. To demonstrate the potential of the produced PDMS heat sink device, fluid flow and heat transfer studies were performed by using two different nanofluids, i.e., alumina (\n
This work was supported by
The authors declare no conflict of interest.
A | area |
cp | heat capacity |
h | convection heat transfer coefficient |
K | thermal conductivity |
N | number of microchannels |
q | volume flow rate |
Q | heat rate |
R | resistance |
Rt | thermic resistance |
T | temperature |
wp | average width of fin |
zc | height of the channel |
Greek symbols | |
η | fin efficiency |
μ | viscosity |
φ | nanoparticle concentration |
ρ | density |
Subscript | |
b | microchannel bottom |
bf | base fluid |
ext. | exterior |
f | fluid |
in | inlet |
l | microchannel sidewall |
nf | nanofluid |
out | outlet |
p | nanoparticles |
Viroids are circular, highly structured, single-stranded RNA (ssRNA) phytopathogens. Although they do not code for any peptide, these enigmatic pathogens have evolved the capacity to replicate within cellular organella, the nucleus and chloroplast for
Citrus exocortis is a destructive disease infecting citrus species [9, 11]. The agent of this disease, citrus exocortis viroid [
Citrus exocortis could affect a various part of the tree including the rootstock (at bark and wood levels), scion, leaves, and fruits, thus causing different types of damages such as bark scaling and cracking, bumps, severe stunting, low fruit-bearing, the poor appearance of the canopy [21, 24, 25, 26, 27], and poor tree performance [28]. CEVd-infected trees in the orchard show typical symptoms. The most characteristic one is bark scaling on trifoliate orange rootstock, yellow stem blotch on trifoliate orange and its hybrids and Rangpur lime (
The major susceptible citrus rootstocks, which show exocortis bark scaling symptoms, are trifoliate orange and its hybrids, Palestine sweet lime (
The type and severity of symptoms induced by citrus exocortis disease depend not just on the selected rootstock as described above, but also on the amount of viroid present in the scion and the infection with other citrus viroids. High temperatures can also accelerate the development of symptoms [30]. The results of a long-term field trial carried out with clementine trees grafted on the trifoliate orange rootstock revealed that CEVd-induced effects might be both reduced or increased when CEVd-infected trees were exposed to mixed viroid infections. In other words, several interactions among viroids including CEVd have been revealed through comparative assays between symptoms developed on trees infected with CEVd alone or co-infected with other viroids. The most clear-cut interaction occurs between CEVd and Citrus viroid IV [
Numerous field trials have been conducted on different citrus species, varieties, and rootstocks under three different agroecosystems, to evaluate the effect of CEVd on vegetative growth and yield (Table 1). The first field trial has been conducted to assess the effect of CEVd infection on commune clementine trees grafted on Pomeroy trifoliate orange. CEVd-infected trees have been periodically monitored for a period of 12 years (from 1990 to 2002) for symptom expression, growth, and fruit yield. CEVd-infected trees showed a significant reduction of growth and yield, which became increasingly apparent over time with infection. Cumulative yield varied from 291,1 to 570,3 kg in 2001 for CEVd and the control, respectively. This equated to 50% cumulative yield lost. This yield attenuation was associated mainly with the loss of large fruit production. Indeed, it has been shown that CEVd reduced fruit production significantly for calibers 2 to 5. Cumulative weights were smaller than the control for caliber 0–1 and small calibers 6 and 7–8, with some significant difference [21]. The quality of fruits from CEVd-infected orange trees (Washington Navel) grafted on Carrizo citrange rootstock has been evaluated from 2004 to 2007. The results of this experiment showed that the quality of the fruit was not affected by CEVd infection [26].
Combination | Effect on | References | |||
---|---|---|---|---|---|
Scion | |||||
CEVd | |||||
Clementine | Orange Pomeroy trifoliate | NSE | [21] | ||
Oranger Washington Navel | Carrizo citrangec | NSE (Reduction of almost 17% and 27% for CEVd-129 and CEVd-117, respectively) | NSE (Low reduction of about 2% and 10% for CEVd-129 and CEVd-117, respectively) | [26] | |
Orange Maltaise demi sanguine | Soor orange ( | NSE | NSE | NSE (Reduction of almost 20%) | [46] |
Alemow | NSE | NSE | NSE | ||
Carrizo citrangec | NSE | NSE | NSE | ||
NSE | NSE (Reduction of almost 20%) | ||||
Cleopatra mandarin ( | NSE | NSE (Reduction of almost 25%) | NSE (Reduction of almost 20%) | ||
Swingle citrumelo (Citru)c | NSE | NSE | NSE | ||
Rangpur lime ( | NSE | NSE (Reduction of almost 28%) | NSE (Reduction of almost 20%) | ||
Trifoliate orangec | NSE | ||||
HSVd | |||||
Clementine | Orange Pomeroy trifoliatec | Little or no real impact | NSE | [21] | |
Orange Washington Navel | Carrizo citrangec | NSE (Reduction of almost 15% for CVd-IIc) | NSE (Reduction of almost 8% for CVd-IIb) | No effect | [26] |
Orange Maltaise demi sanguine | Soor orange ( | NSE | NSE | NSE (Reduction of almost 20%) | [46] |
Alemow | |||||
Carrizo citrangec | NSE | NSE | NSE | ||
NSE | NSE (Reduction of almost 20%) | ||||
Cleopatra mandarin ( | NSE | NSE | NSE (Reduction of almost 20%) | ||
Swingle citrumelo (Citru)c | NSE | NSE | |||
Rangpur lime ( | NSE | NSE | NSE (Reduction of almost 20%) | ||
Trifoliate orangec |
Results summary of the known field trials carried out in three citrus-growing countries of the Mediterranean area to evaluate the effect of CEVd and HSVd on vegetative growth and yield of different citrus scion and rootstock combinations.
Susceptible to citrus tristeza virus [
Susceptible to CTV stem-pitting and cachexia.
CTV tolerant.
A function of the used viroid isolates.
All citrus viroids are distributed primarily by the introduction and propagation of infected budwoods and subsequently by mechanical transmission, and CEVd is no exception [11]. Mechanical transmission of CEVd has been already reported. It took place on secateurs, tools, knives, and hedging equipment [9, 11, 27, 29] especially from lemon (
Cachexia is a destructive disease infecting citrus species [11]. The agent of this disease, hop stunt viroid [
Cachexia could affect a various part of the tree including the trunk, bark, twigs, branches, leaves, and fruits, thus causing different types of damages such as bark and trunk gumming with a rough and rugose appearance, bark-cracking, moderate and severe tree stunting, chlorosis, decline and death of severely affected trees, brown stipple spotting on the underside of the leaves, and the appearance of small pits on the wood [9, 21, 24]. Cachexia disease mainly affects some mandarins and their hybrids such as tangelos, and
As mentioned before, for CEVd, the type and severity of citrus cachexia symptoms depend also on the presence of other citrus viroids in the tree. The results of a long-term field trial carried out with clementine trees grafted on the trifoliate orange rootstock revealed that HSVd-induced effects might be both reduced or increased when HSVd-infected trees were exposed to mixed viroid infections. The most clear-cut interaction occurs between HSVd and CVd-IV. This interaction is manifested by a slight increase in fruit yield and reduction of scion circumferences [24].
The same field trials described before to evaluate the effect of CEVd on vegetative growth and yield (Table 1) were used for the same purpose for HSVd. Little or no effect in vegetative growth has been observed on commune clementine trees infected by HSVd as it has been determined by the measure of height and rootstock and scion circumferences [21]. Cumulative yield varied from 377,6 to 570,3 kg in 2001 for HSVd (CVd-IIc isolate) and the control, respectively. This equated to 34% cumulative yield lost [21]. The negative impact of HSVd infection on cumulative yield has been reported in another study carried out on Orange Maltaise demi sanguine grafted on Alemow (
As pointed out before, for CEVd, propagation of infected budwoods and mechanical inoculations with contaminating tools were reported as the principal causes for the omnipresence of multiple viroid species, including HSVd, among citrus orchards [34]. Mechanical transmission of HSVd has been already reported. Indeed, the results of a transmission assay carried out under greenhouse conditions revealed that all HSVd strains are mechanically transmitted from citron to healthy citron by a single slash with a knife blade [32]. As for CEVd, the potential involvement of gots in HSVd spread has been shown under controlled conditions [34]. Top working, a common practice in Mediterranean countries, seems to have largely contributed to HSVd spread in Mediterranean citrus orchards [9]. HSVd is not known to be seed-borne [47] in citrus or to have natural vectors [11, 48].
It is usually accepted that although the mechanisms through which viroids interact with their hosts are beginning to be dissected, the key triggering events and molecular mechanisms underlying viroid pathogenesis remain unclear [49, 50], and CEVd and HSVd are no exception. As demonstrated by various types of citrus pathogens [51, 52], further investigation of the molecular basis of viroid-host interactions is crucial to better understand the pathogenesis of viroids, and thus help to develop effective strategies to combat viroid diseases [50, 53]. Important changes occur in the chloroplast, cell wall, peroxidase, and symporter activities upon infection of Etrog citron with CEVd [54]. The CEVd-infected citron system has been subsequently used for studying the feedback regulation mechanism using transcriptomic analysis. The analysis of the woody host response to CEVd revealed the activation of basic defense and RNA-silencing mechanisms following CEVd infection. In other words, a large number of genes (about 1530) encoding key proteins involved in the RNA silencing pathway, and proteins related to basic defense responses are expressed following CEVd infection [53]. Furthermore, a recent study elucidates the role of phytohormone pathways, particularly those linked to ethylene, in disease development and ribosomal stress caused by CEVd infection by using tomato as an experimental host [55]. For HSVd, a small RNA-mediated gene silencing response has been highlighted upon the infection of lemon by HSVd. The large amounts of HSVd-small interfering RNA (siRNA) from both central and variant domains have been suggested to be involved in interference with host gene and symptom development [56].
Generally, biological assays based on indicator host plants expressing typical symptoms of infection and able to withstand higher levels of viroid replication played an essential role in both viroid detection and characterization [57]. CEVd and HSVd are viroid diseases present in citrus orchards around the world [11]. The biological diagnosis through indexing method is considered as an efficient tool to test the health status of a plant, regarding a disease by inoculation with the grafting of the budwood or any other infected tissue in indicator plants that allow viroid replication, symptoms expression [11, 58], and the enhancement of viroid concentration [59]. However, bioassays for CEVd and HSVd detection and identification may require a panel of indicator host plants [60]. Certain considerations need to be respected for the proper indexing of citrus viroids. These include the use of excellent plants, the work under warm temperatures, and the use of citron index plants grown one per container. As mentioned previously, citrus viroids are highly mechanically transmissible and tools must be disinfected to avoid their spread [9].
The citron test is a very sensitive and diagnostic index for determining the presence of CEVd [9]. However, indexing,
As to cachexia, Parson’s special mandarin budded on vigorous root-stock such as rough lemon or Volkamer lemon is reported as an excellent indicator for the disease [9, 65]. The biological indexing may take up to one year before symptoms are seen. The reaction of Parson’s Special mandarin may differ depending on HSVd isolates. In other words, some isolates are very mild reacting, whereas others are quite severe in their reaction to the indicator plant. Indeed, a mild strain reaction consists of just a slight browning at the bud union or cut back region of the Parson’s Special mandarin while a severe reaction consists of the appearance of gum in the wood that may extend via the entire plant [9]. Cuban Shaddock has been proved to be the best rootstock, compared to rough lemon or Volkamer lemon, for symptom expression on Clemeline 11–20 indicator plants for indexing cachexia. Furthermore, the application of 0,5% foliar urea sprays, alone or in combination with 20 ppm gibberellic acid showed to produce more intense expression of cachexia symptoms in the indicator Clemeline 11–20 than the unsprayed control [64].
Cross protection is a biological assay, in which the infection of a plant with a viroid strain ensures protection from infection with another strain of the same viroid. This bioassay can be used for indirect viroid biological indexing. It has been applied in the diagnosis of several viroids including CEVd and HSVd. Typically, the principle of this method is based on the infection of the plant with a mild strain of a viroid, followed by its inoculation with inoculum from a plant suspected to be infected with a severe strain of the same viroid. Positive indexing of the viroid is revealed by the non-expression of symptoms in the tested plants [60]. It has been shown in a cross-protection assay, performed with CEVd-129 as a “protecting” strain against the severe type strain of CEVd that a mild strain of CEVd could lead to apparent “protection” against challenge inoculation with the severe strain. However, it is important to highlight that variability has been shown in the induced protection effect. The latter varied from only a brief delay to almost total impairment of symptom expression. The level of protection depends on the length of the interval between the inoculations with the mild and severe strains [66].
Since viroids lack a protein capsid, serological techniques used routinely in plant viruses’ detection are not applicable [67]. Nucleic acid-based methods, including polyacrylamide gel electrophoresis (PAGE), hybridization (dot- and northern-blots and micro−/macroarrays), amplification (reverse transcription-polymerase chain reaction (RT-PCR) and reverse transcription loop-mediated isothermal amplification (RT-LAMP)) and sequencing (next-generation sequencing and Sanger sequencing), offer rapid cost-effective, and reliable diagnosis of viroids [60].
PAGE is considered as the first molecular technique used for the rapid (2–3 day period) identification of viroid infected plants. This technique continues to play a crucial role in the identification of new viroids since it is the only diagnostic method that is sequence-independent. PAGE analysis under denaturing conditions showed that many
Since the beginning of their use in the 1980s, dot blot hybridization and hybridization of tissue imprints began to replace PAGE for routine viroid detection. This is mainly because these methods allow the processing of a large number of samples [57]. A northern hybridization protocol, which relied on the analysis of preparations from bark tissues, was proved to be more sensitive than PAGE to detect CEVd and HSVd from field-grown plants of different citrus species and cultivars [70]. A citrus viroids-multiprobe composed of full-length clones of HSVd, CEVd, and two other citrus viroids has been constructed for the simultaneous detection of viroids associated with citrus trees. All the tested viroids were effectively detected with this multiprobe when tested by both northern hybridization and dot blot methods. It is important to highlight that this multiprobe does not allow the identification of the viroid type species resulting in a positive signal [71].
Due to the small size of viroids, numerous RT-PCR approaches can be applied for both their detection and subsequent characterization. In the case of CEVd and HSVd, numerous RT-PCR and real-time RT-PCR approaches have been developed and proved to allow the detection of CEVd and HSVd in both singleplex or multiplex assays [63, 72, 73, 74, 75, 76]. A list of some RT-PCR and related tests developed to detect CEVd and HSVd are presented in Table 2. Some of these tests allow also the discrimination between mild and severe CEVd strains and the identification of HSVd isolates associated with cachexia symptoms [77]. The multiplex one-step RT-PCR assay developed by Wang et al. [75] is considered a good tool streamlining the simultaneous detection of up to five citrus viroids, including CEVd and HSVd. This enables to reduce time and labor without affecting sensitivity and specificity. Indeed, serial dilution experiments showed that the singleplex RT-PCR sensitivity was similar to that of multiplex RT-PCR for all the tested viroids [75]. This type of assay could be used in high throughput screenings of viroids associated with citrus in field surveys, germplasm banks, nurseries, as well as in other viroid disease management programs [74]. Similarly, the multiplex RT-TaqMan PCR assay developed by Papayiannis [76] enables accurate discrimination between CEVd and HSVd with a diagnostic sensitivity and specificity of 100%. It is important to emphasize that in conventional RT-PCR tests, the overall sensitivity and specificity were lower and varied between 97 and 98% for HSVd, and 94 and 95% for CEVd. Therefore, this essay presented 1000-fold more analytical sensitivity [76]. The specificity of the tests described previously was confirmed by including healthy controls and/or plant tissue infected with other citrus graft transmissible virus and bacteria pathogens and non-targeted citrus viroids. Both singleplex and multiplex assays did not cross-react with any non-inoculated negative controls or other citrus pathogens [63, 74, 76]. To date, PCR-based approaches have been proven efficacy on viroid direct detection. However, false positives and negatives due to amplicon contamination and failure to generate cDNA of suitable size during reverse transcription, respectively, are not uncommon and therefore preclude the application of RT-PCR for large scale indexing [70].
Name of RT-PCR test | Sequence 5′-3′ | Tm (°C) | Genomic coordinates | Size of the expected product | References |
---|---|---|---|---|---|
Primer/Probe Name | |||||
RT-PCR | |||||
Singleplex | |||||
CEVd-R | GGGGATCCCTGAAGGACTT | 60 | 80-98a | 371 bp | [72, 85] |
CEVd-F | GGAAACCTGGAGGAAGTCG | 99-117a | |||
HSVd-F 27-mer VP-20 | CGCCCGGGGCAACTCTTCTCAGAATCC | 60 | 78–102 | 251 bp | [37, 73] |
HSVd-R 26-mer VP-19 | GCCCCGGGGCTCCTTTCTCAGGTAAG | 60–85 | |||
HSVd VP-98 | CTCCAGAGCACCGCGGCCCTC | DN | 120–140 | 140 bp | [37] |
HSVd VP-99 | CTGGGGAATTCTCGAGTTGCCGC | 1–23 | |||
Multiplex | |||||
CEVd-F194 | TTTCGCTGCTGGCTCCACA | 58 | 194–212 | 196 bp | [63] |
CEVd-R18 | ACCTCAAGAAAGATCCCGA | 371–18 | |||
HSVd-F1 | GGGGCAACTCTTCTCAGAATCC | 81–102 | 302 bp | ||
HSVd-R1 | GGGGCTCCTTTCTCAGGTAAGTC | 58–80 | |||
CEV-R | CCGGGGATCCCTGAAGGACTT | 58 | 78-98a | 371 bp | [75] |
CEV-F | GGAAACCTGGAGGAAGTCGAG | 99-119a | |||
HSVd-R | CCGGGGCTCCTTTCTCAGGTAAGT | 59-82b | 302 bp | ||
HSVd-F | GGCAACTCTTCTCAGAATCCAGC | 83-105b | |||
Real time-RT-PCR | |||||
Singleplex | |||||
CEVd −161 F | GTCCAGCGGAGAAACAGGAG | 60 | 181-200c | 105 bp | [74]* |
CEVd −258 R | AGAGAAGCTCCGGGCGA | 270-286c | |||
CEVd −187 P FAM | TCCTTCCTTTCGCTGCT | 212-228c | |||
HSVd-208 F | GAGACGCGACCGGTGG | 60 | 216-231d | 88 bp | |
HSVd-295 R | GCTCAAGAGAGGATCCGCG | 286-304d | |||
HSVd-226 P TET | TCACCTCTCGGTTCGTC | 234-250d | |||
Multiplex | |||||
CEVd-RTR_F | GTCGCCGCGGATCACT | 60 | 142–159 | 64 bp | [63] |
CEVd-RTR_R | CCAGCAGCGAAAGGAAGGA | 187–205 | |||
HSVd-RTR_F | GGAATTCTCGAGTTGCCGCA | 5–24 | 127 bp | ||
HSVd-RTR_R | CCGCGGCCCTCTCT | 118–131 | |||
CEVd-RTR_P | CCAGCGGAGAAACAG | 163–177 | — | ||
HSVd-RTR_P | CAACTCTTCTCAGAATCC | 85–102 | — | ||
CEVdF | GCGTCCAGCGGAGAAACA | 60 | 158–175e | 68 bp | [76] |
CEVdR | CAGCGACGATCGGATGTG | 226–208e | |||
CEVdTAQ | {FAM}-TCGTCTCCTTCCTTTCGCTGCTGG-{BHQ1} | 181–204e | |||
HSVdF | GCCTTCGAAACACCATCGA | 159–177f | 71 bp | ||
HSVdR | CACCGGTCGCGTCTCATC | 230–213f | |||
HSVdTAQ | {HEX}-CGTCCCTTCTTCTTTACCTTCTCCTGGCTC-{BHQ2} | 179–208f |
Primer sequences and their annealing temperature (Tm), primer/probe location, and expected size of PCR products for each primer pair when used to amplify CEVd and HSVd by RT-PCR and related tests (this is not a full or exclusive list).
The same primers have been also tested in multiplex Real time-RT-PCR test.
GenBank Accession no. NC-001464.
GenBank Accession no. NC-001351.
GenBank Accession no. CEVd-HQ284019.
GenBank Accession no. HSVd-KJ810553.
GenBank Accession no. U21126.
GenBank Accession no. GQ249348. R: antisense primer. F: sense primer.
Next-generation sequencing (NGS) technologies are currently becoming routinely applied in different fields of virus and viroids studies. These advanced technologies have therefore contributed to a revolution in both the detection and discovery of plant viruses and viroids [78, 79, 80, 81]. NGS has also provided an alternative method to identify viroids in the citrus cultivars. In other words, transcriptome sequencing has shown efficacy in citrus viroid diagnostics. Indeed, this method enabled the simultaneous identification of numerous viroids from various citrus samples, including CEVd and HSVd [82]. A deep sequencing approach, combined with bioinformatics analysis, is already being implemented for HSVd detection in
No naturally occurring durable resistance has been observed in most species, despite non-hosts for viroids exist. Therefore, the effective control methods for viroid diseases consist mainly of detection and eradication, and cultural controls [50].
Exocortis and cachexia are widespread diseases in the Mediterranean region. CEVd and HSVd have been reported in most Mediterranean countries and are among the most prevalent citrus viroids in the region [9]. The development of reliable diagnostic methods facilitated extensive surveys for CEVd and HSVd in different parts of the region. Both viroids were successively identified in many countries, including Morocco [89, 90, 91, 92], Cyprus [33], Spain [26], Egypt [43, 93], Italy [61, 94], Tunisia [46, 95], France [21], Syria [96], and Turkey [42].
In Morocco, exocortis and cachexia are among the major citrus viroid diseases [90, 91]. These diseases are prevalent in citrus orchards and can be found in all
Citrus viroids, including CEVd and HSVd, are distributed mainly by the introduction and propagation of infected budwoods, by top working, and by mechanical transmission [9, 11]. Both viroids are known for their ability to infect a large number of host plants [36]. CEVd and HSVd are destructive to certain citrus varieties and, can cause yield losses that may be as high as 34 to 76 percent depending on the combination viroid-rootstock-scion [21, 46]. The mechanisms through which CEVd and HSVd interact with their hosts and induce pathogenesis are beginning to be deciphered. In other words, the involvement of RNA-silencing and basic defense mechanisms following CEVd and HSVd infection has been highlighted [54, 56].
Once introduced and established in a country, both viroids can spread relatively rapidly because of their ability to be transmitted via mechanical means [9, 11]. Since CEVd and HSVd have a high resistance to heat, the chemical treatment appears to be the best method to disinfect CEVd- and HSVd-contaminated tools. For instance, a 0,25 to 0,5 and a 1 percent solution of sodium hypochlorite appears to be the best option to eliminate CEVd and HSVd, respectively, from contaminated hedging and budwood cutting tools [11, 98]. Like all citrus viroids, CEVd and HSVd seem to be successively eliminated from propagative material by shoot-tip grafting or by the deployment of nucellar budlines. Being extremely tolerant of heat, CEVd and HSVd have not been successfully eliminated from budwood by applying thermotherapy [9]. Certification programs must include measures to control viroid spread in nurseries [32]. The majority of rootstocks that are tolerant to the citrus tristeza virus [
Complicated interactions, including antagonism and synergy, occur between viroids coinfecting the same citrus host. These interactions may lead to different symptoms, canopy volumes, fruit yields, and commercial performance. Although no obvious physiological changes in citrus hosts have been described in mixed infections of CEVd and HSVd and both viroids do not induce severe symptoms in citrus [24, 99], their interaction was intriguing because they are commonly found simultaneously infecting different citrus cultivars and they have identical biological properties within the same host. The relationship between the two viroids has been investigated over 3 years (from 2011 to 2013). Results showed a positive correlation between CEVd and HSVd in specific tissues of two citrus cultivars (blood orange and Murcott mandarin). This result has been supported by three findings: titer enhancement, localization similarity, and lack of symptom aggravation under mixed-infection conditions. Compared to their concentrations under single-infection conditions, a significant increase in the CEVd and HSVd population has been observed under mixed-infection during 6 and only 1 season of the 12 monitored seasons, respectively. This result is somewhat surprising because no competition phenomenon for host resources occurs between the two viroids although they have the same biological functions and share identical cellular and subcellular spaces [27]. This issue merits consideration in future research.
Regarding the current situation of CEVd and HSVd in Morocco, this chapter provides a general overview of their spread in the Moroccan citrus-growing areas. Preventing the introduction and the establishment of exocortis and cachexia diseases in the Moroccan citrus orchards can be set up through the use of viroid-free (certified) planting material, disinfection of pruning tools, regular monitoring of citrus orchards to ensure early detection of both diseases, and by avoiding top working practice. This review pointers to new research avenues in exocortis and cachexia diseases in Morocco or elsewhere. These research fields could include for instance the characterization of CEVd and HSVd isolates, searching for secondary hosts, and developing sustainable control strategies. Investigating the prevalence of CEVd and HSVd infection in numerous natural host plants, and the characterization of the viroid sequence variants is valuable especially that a cross-transmission phenomenon between different hosts seems to be possible for HSVd [100].
Studying functional genomics through transcriptomic analysis and/or proteomic approaches in citrus-CEVd/HSVd interaction would be an interesting approach to shed more light on the full mechanisms underlying the complex and varied events associated with such interactome, and thus contribute to the development of novel diagnostic methods and plant protection strategies. This further advanced research will expand our understanding of CEVd and HSVd epidemiology and the mechanisms behind their spread across the world in general and Morocco in particular, and could potentially help in devising innovative management strategies of both viroids.
This research was financially supported by INRA Institute (CRRA de Oujda; Qualipole de Berkane) and the Phytopathology Unit of the Department of Plant Protection, Ecole Nationale d’Agriculture de Meknes.
The authors declare no conflict of interest.
As a company committed to the wider dissemination of knowledge, IntechOpen supports the OAI Metadata Harvesting Protocol (OAI-PMH Version 2.0).
',metaTitle:"OAI-PMH",metaDescription:"As a firm believer in the wider dissemination of knowledge, IntechOpen supports the OAI Metadata Harvesting Protocol (OAI-PMH Version 2.0).",metaKeywords:null,canonicalURL:"/page/oai-pmh",contentRaw:'[{"type":"htmlEditorComponent","content":"The OAI-PMH (Open Archives Initiative Protocol for Metadata Harvesting) is used to govern the collection of metadata descriptions and enables other archives to access our database. The Protocol has been developed by the Open Archives Initiative, based on ensuring interoperability standards in order to ease and promote broader and more efficient dissemination of information within the scientific community.
\\n\\nWe have adopted the Protocol to increase the number of readers of our publications. All our Works are more widely accessible, with resulting benefits for scholars, researchers, students, libraries, universities and other academic institutions. Through this method of exposing metadata, IntechOpen enables citation indexes, scientific search engines, scholarly databases, and scientific literature collections to gather metadata from our repository and make our publications available to a broader academic audience.
\\n\\nAs a Registered Data Provider, metadata for published Books and Chapters are available via our interface at the base URL: http://mts.intechopen.com/oai/index.php
\\n\\nREQUESTS
\\n\\nYou can find out more about the Protocol by visiting the Open Archives website. For additional questions please contact us at ai@intechopen.com.
\\n\\nDATABASES
\\n\\nDatabases, repositories and search engines that provide services based on metadata harvested using the OAI metadata harvesting protocol include:
\\n\\nBASE - Bielefeld Academic Search Engine
\\n\\nOne of the world's most powerful search engines, used primarily for academic Open Access web resources.
\\n\\n\\n\\nA search engine for online catalogues of publications from all over the world.
\\n"}]'},components:[{type:"htmlEditorComponent",content:'The OAI-PMH (Open Archives Initiative Protocol for Metadata Harvesting) is used to govern the collection of metadata descriptions and enables other archives to access our database. The Protocol has been developed by the Open Archives Initiative, based on ensuring interoperability standards in order to ease and promote broader and more efficient dissemination of information within the scientific community.
\n\nWe have adopted the Protocol to increase the number of readers of our publications. All our Works are more widely accessible, with resulting benefits for scholars, researchers, students, libraries, universities and other academic institutions. Through this method of exposing metadata, IntechOpen enables citation indexes, scientific search engines, scholarly databases, and scientific literature collections to gather metadata from our repository and make our publications available to a broader academic audience.
\n\nAs a Registered Data Provider, metadata for published Books and Chapters are available via our interface at the base URL: http://mts.intechopen.com/oai/index.php
\n\nREQUESTS
\n\nYou can find out more about the Protocol by visiting the Open Archives website. For additional questions please contact us at ai@intechopen.com.
\n\nDATABASES
\n\nDatabases, repositories and search engines that provide services based on metadata harvested using the OAI metadata harvesting protocol include:
\n\nBASE - Bielefeld Academic Search Engine
\n\nOne of the world's most powerful search engines, used primarily for academic Open Access web resources.
\n\n\n\nA search engine for online catalogues of publications from all over the world.
\n'}]},successStories:{items:[]},authorsAndEditors:{filterParams:{},profiles:[{id:"396",title:"Dr.",name:"Vedran",middleName:null,surname:"Kordic",slug:"vedran-kordic",fullName:"Vedran Kordic",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/396/images/7281_n.png",biography:"After obtaining his Master's degree in Mechanical Engineering he continued his education at the Vienna University of Technology where he obtained his PhD degree in 2004. He worked as a researcher at the Automation and Control Institute, Faculty of Electrical Engineering, Vienna University of Technology until 2008. His studies in robotics lead him not only to a PhD degree but also inspired him to co-found and build the International Journal of Advanced Robotic Systems - world's first Open Access journal in the field of robotics.",institutionString:null,institution:{name:"TU Wien",country:{name:"Austria"}}},{id:"441",title:"Ph.D.",name:"Jaekyu",middleName:null,surname:"Park",slug:"jaekyu-park",fullName:"Jaekyu Park",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/441/images/1881_n.jpg",biography:null,institutionString:null,institution:{name:"LG Corporation (South Korea)",country:{name:"Korea, South"}}},{id:"465",title:"Dr",name:"Christian",middleName:null,surname:"Martens",slug:"christian-martens",fullName:"Christian Martens",position:null,profilePictureURL:"//cdnintech.com/web/frontend/www/assets/author.svg",biography:null,institutionString:null,institution:null},{id:"479",title:"Dr.",name:"Valentina",middleName:null,surname:"Colla",slug:"valentina-colla",fullName:"Valentina Colla",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/479/images/358_n.jpg",biography:null,institutionString:null,institution:{name:"Sant'Anna School of Advanced Studies",country:{name:"Italy"}}},{id:"494",title:"PhD",name:"Loris",middleName:null,surname:"Nanni",slug:"loris-nanni",fullName:"Loris Nanni",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/494/images/system/494.jpg",biography:"Loris Nanni received his Master Degree cum laude on June-2002 from the University of Bologna, and the April 26th 2006 he received his Ph.D. in Computer Engineering at DEIS, University of Bologna. On September, 29th 2006 he has won a post PhD fellowship from the university of Bologna (from October 2006 to October 2008), at the competitive examination he was ranked first in the industrial engineering area. He extensively served as referee for several international journals. He is author/coauthor of more than 100 research papers. He has been involved in some projects supported by MURST and European Community. His research interests include pattern recognition, bioinformatics, and biometric systems (fingerprint classification and recognition, signature verification, face recognition).",institutionString:null,institution:null},{id:"496",title:"Dr.",name:"Carlos",middleName:null,surname:"Leon",slug:"carlos-leon",fullName:"Carlos Leon",position:null,profilePictureURL:"//cdnintech.com/web/frontend/www/assets/author.svg",biography:null,institutionString:null,institution:{name:"University of Seville",country:{name:"Spain"}}},{id:"512",title:"Dr.",name:"Dayang",middleName:null,surname:"Jawawi",slug:"dayang-jawawi",fullName:"Dayang Jawawi",position:null,profilePictureURL:"//cdnintech.com/web/frontend/www/assets/author.svg",biography:null,institutionString:null,institution:{name:"University of Technology Malaysia",country:{name:"Malaysia"}}},{id:"528",title:"Dr.",name:"Kresimir",middleName:null,surname:"Delac",slug:"kresimir-delac",fullName:"Kresimir Delac",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/528/images/system/528.jpg",biography:"K. Delac received his B.Sc.E.E. degree in 2003 and is currentlypursuing a Ph.D. degree at the University of Zagreb, Faculty of Electrical Engineering andComputing. His current research interests are digital image analysis, pattern recognition andbiometrics.",institutionString:null,institution:{name:"University of Zagreb",country:{name:"Croatia"}}},{id:"557",title:"Dr.",name:"Andon",middleName:"Venelinov",surname:"Topalov",slug:"andon-topalov",fullName:"Andon Topalov",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/557/images/1927_n.jpg",biography:"Dr. Andon V. Topalov received the MSc degree in Control Engineering from the Faculty of Information Systems, Technologies, and Automation at Moscow State University of Civil Engineering (MGGU) in 1979. He then received his PhD degree in Control Engineering from the Department of Automation and Remote Control at Moscow State Mining University (MGSU), Moscow, in 1984. From 1985 to 1986, he was a Research Fellow in the Research Institute for Electronic Equipment, ZZU AD, Plovdiv, Bulgaria. In 1986, he joined the Department of Control Systems, Technical University of Sofia at the Plovdiv campus, where he is presently a Full Professor. He has held long-term visiting Professor/Scholar positions at various institutions in South Korea, Turkey, Mexico, Greece, Belgium, UK, and Germany. And he has coauthored one book and authored or coauthored more than 80 research papers in conference proceedings and journals. His current research interests are in the fields of intelligent control and robotics.",institutionString:null,institution:{name:"Technical University of Sofia",country:{name:"Bulgaria"}}},{id:"585",title:"Prof.",name:"Munir",middleName:null,surname:"Merdan",slug:"munir-merdan",fullName:"Munir Merdan",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/585/images/system/585.jpg",biography:"Munir Merdan received the M.Sc. degree in mechanical engineering from the Technical University of Sarajevo, Bosnia and Herzegovina, in 2001, and the Ph.D. degree in electrical engineering from the Vienna University of Technology, Vienna, Austria, in 2009.Since 2005, he has been at the Automation and Control Institute, Vienna University of Technology, where he is currently a Senior Researcher. His research interests include the application of agent technology for achieving agile control in the manufacturing environment.",institutionString:null,institution:null},{id:"605",title:"Prof",name:"Dil",middleName:null,surname:"Hussain",slug:"dil-hussain",fullName:"Dil Hussain",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/605/images/system/605.jpg",biography:"Dr. Dil Muhammad Akbar Hussain is a professor of Electronics Engineering & Computer Science at the Department of Energy Technology, Aalborg University Denmark. Professor Akbar has a Master degree in Digital Electronics from Govt. College University, Lahore Pakistan and a P-hD degree in Control Engineering from the School of Engineering and Applied Sciences, University of Sussex United Kingdom. Aalborg University has Two Satellite Campuses, one in Copenhagen (Aalborg University Copenhagen) and the other in Esbjerg (Aalborg University Esbjerg).\n· He is a member of prestigious IEEE (Institute of Electrical and Electronics Engineers), and IAENG (International Association of Engineers) organizations. \n· He is the chief Editor of the Journal of Software Engineering.\n· He is the member of the Editorial Board of International Journal of Computer Science and Software Technology (IJCSST) and International Journal of Computer Engineering and Information Technology. \n· He is also the Editor of Communication in Computer and Information Science CCIS-20 by Springer.\n· Reviewer For Many Conferences\nHe is the lead person in making collaboration agreements between Aalborg University and many universities of Pakistan, for which the MOU’s (Memorandum of Understanding) have been signed.\nProfessor Akbar is working in Academia since 1990, he started his career as a Lab demonstrator/TA at the University of Sussex. After finishing his P. hD degree in 1992, he served in the Industry as a Scientific Officer and continued his academic career as a visiting scholar for a number of educational institutions. In 1996 he joined National University of Science & Technology Pakistan (NUST) as an Associate Professor; NUST is one of the top few universities in Pakistan. In 1999 he joined an International Company Lineo Inc, Canada as Manager Compiler Group, where he headed the group for developing Compiler Tool Chain and Porting of Operating Systems for the BLACKfin processor. The processor development was a joint venture by Intel and Analog Devices. In 2002 Lineo Inc., was taken over by another company, so he joined Aalborg University Denmark as an Assistant Professor.\nProfessor Akbar has truly a multi-disciplined career and he continued his legacy and making progress in many areas of his interests both in teaching and research. He has contributed in stochastic estimation of control area especially, in the Multiple Target Tracking and Interactive Multiple Model (IMM) research, Ball & Beam Control Problem, Robotics, Levitation Control. He has contributed in developing Algorithms for Fingerprint Matching, Computer Vision and Face Recognition. He has been supervising Pattern Recognition, Formal Languages and Distributed Processing projects for several years. He has reviewed many books on Management, Computer Science. Currently, he is an active and permanent reviewer for many international conferences and symposia and the program committee member for many international conferences.\nIn teaching he has taught the core computer science subjects like, Digital Design, Real Time Embedded System Programming, Operating Systems, Software Engineering, Data Structures, Databases, Compiler Construction. In the Engineering side, Digital Signal Processing, Computer Architecture, Electronics Devices, Digital Filtering and Engineering Management.\nApart from his Academic Interest and activities he loves sport especially, Cricket, Football, Snooker and Squash. He plays cricket for Esbjerg city in the second division team as an opener wicket keeper batsman. He is a very good player of squash but has not played squash since his arrival in Denmark.",institutionString:null,institution:null},{id:"611",title:"Prof.",name:"T",middleName:null,surname:"Nagarajan",slug:"t-nagarajan",fullName:"T Nagarajan",position:null,profilePictureURL:"//cdnintech.com/web/frontend/www/assets/author.svg",biography:null,institutionString:null,institution:{name:"Universiti Teknologi Petronas",country:{name:"Malaysia"}}}],filtersByRegion:[{group:"region",caption:"North America",value:1,count:6675},{group:"region",caption:"Middle and South America",value:2,count:5955},{group:"region",caption:"Africa",value:3,count:2458},{group:"region",caption:"Asia",value:4,count:12717},{group:"region",caption:"Australia and Oceania",value:5,count:1017},{group:"region",caption:"Europe",value:6,count:17720}],offset:12,limit:12,total:134177},chapterEmbeded:{data:{}},editorApplication:{success:null,errors:{}},ofsBooks:{filterParams:{topicId:"22"},books:[{type:"book",id:"11456",title:"Autonomous Mobile Mapping Robots",subtitle:null,isOpenForSubmission:!0,hash:"405e1f7c0ef62700f4d590722cf428be",slug:null,bookSignature:"Dr. Janusz Bȩdkowski",coverURL:"https://cdn.intechopen.com/books/images_new/11456.jpg",editedByType:null,editors:[{id:"63695",title:"Dr.",name:"Janusz",surname:"Bȩdkowski",slug:"janusz-bdkowski",fullName:"Janusz Bȩdkowski"}],productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"11459",title:"Soft Robotics - Recent Advances and Applications",subtitle:null,isOpenForSubmission:!0,hash:"06e947238d5d4ea1162509a5d66de887",slug:null,bookSignature:"Dr. Mahmut Reyhanoglu",coverURL:"https://cdn.intechopen.com/books/images_new/11459.jpg",editedByType:null,editors:[{id:"15068",title:"Dr.",name:"Mahmut",surname:"Reyhanoglu",slug:"mahmut-reyhanoglu",fullName:"Mahmut Reyhanoglu"}],productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"11985",title:"Autonomous Vehicles",subtitle:null,isOpenForSubmission:!0,hash:"c06614cccf990358e3759c9b8873bb27",slug:null,bookSignature:"",coverURL:"https://cdn.intechopen.com/books/images_new/11985.jpg",editedByType:null,editors:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"12254",title:"Humanoid Robots",subtitle:null,isOpenForSubmission:!0,hash:"968799661a2fad845c9b9dc0d4424c99",slug:null,bookSignature:"",coverURL:"https://cdn.intechopen.com/books/images_new/12254.jpg",editedByType:null,editors:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}}],filtersByTopic:[{group:"topic",caption:"Agricultural and Biological Sciences",value:5,count:38},{group:"topic",caption:"Biochemistry, Genetics and Molecular Biology",value:6,count:13},{group:"topic",caption:"Business, Management and Economics",value:7,count:7},{group:"topic",caption:"Chemistry",value:8,count:23},{group:"topic",caption:"Computer and Information Science",value:9,count:24},{group:"topic",caption:"Earth and Planetary Sciences",value:10,count:15},{group:"topic",caption:"Engineering",value:11,count:65},{group:"topic",caption:"Environmental Sciences",value:12,count:10},{group:"topic",caption:"Immunology and Microbiology",value:13,count:16},{group:"topic",caption:"Materials Science",value:14,count:25},{group:"topic",caption:"Mathematics",value:15,count:11},{group:"topic",caption:"Medicine",value:16,count:116},{group:"topic",caption:"Nanotechnology and Nanomaterials",value:17,count:6},{group:"topic",caption:"Neuroscience",value:18,count:4},{group:"topic",caption:"Pharmacology, Toxicology and Pharmaceutical Science",value:19,count:9},{group:"topic",caption:"Physics",value:20,count:9},{group:"topic",caption:"Psychology",value:21,count:10},{group:"topic",caption:"Robotics",value:22,count:2},{group:"topic",caption:"Social Sciences",value:23,count:9},{group:"topic",caption:"Veterinary Medicine and Science",value:25,count:4}],offset:12,limit:12,total:4},popularBooks:{featuredBooks:[{type:"book",id:"10858",title:"MOOC (Massive Open Online Courses)",subtitle:null,isOpenForSubmission:!1,hash:"d32f86793bc72dde32532f509b1ec5b0",slug:"mooc-massive-open-online-courses-",bookSignature:"Dragan Cvetković",coverURL:"https://cdn.intechopen.com/books/images_new/10858.jpg",editors:[{id:"101330",title:"Dr.",name:"Dragan",middleName:"Mladen",surname:"Cvetković",slug:"dragan-cvetkovic",fullName:"Dragan Cvetković"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"10195",title:"Serotonin and the CNS",subtitle:"New Developments in Pharmacology and Therapeutics",isOpenForSubmission:!1,hash:"7ed9d96da98233a885bd2869a8056c36",slug:"serotonin-and-the-cns-new-developments-in-pharmacology-and-therapeutics",bookSignature:"Berend Olivier",coverURL:"https://cdn.intechopen.com/books/images_new/10195.jpg",editors:[{id:"71579",title:"Prof.",name:"Berend",middleName:null,surname:"Olivier",slug:"berend-olivier",fullName:"Berend Olivier"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"10755",title:"Corporate Governance",subtitle:"Recent Advances and Perspectives",isOpenForSubmission:!1,hash:"ffe06d1d5c4bf0fc2e63511825fe1257",slug:"corporate-governance-recent-advances-and-perspectives",bookSignature:"Okechukwu Lawrence Emeagwali and Feyza Bhatti",coverURL:"https://cdn.intechopen.com/books/images_new/10755.jpg",editors:[{id:"196317",title:"Associate Prof.",name:"Okechukwu Lawrence",middleName:null,surname:"Emeagwali",slug:"okechukwu-lawrence-emeagwali",fullName:"Okechukwu Lawrence Emeagwali"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"11120",title:"Environmental Impact and Remediation of Heavy Metals",subtitle:null,isOpenForSubmission:!1,hash:"9e77514288e7394f1e6cd13481af3509",slug:"environmental-impact-and-remediation-of-heavy-metals",bookSignature:"Hosam M. Saleh and Amal I. Hassan",coverURL:"https://cdn.intechopen.com/books/images_new/11120.jpg",editors:[{id:"144691",title:"Prof.",name:"Hosam M.",middleName:null,surname:"Saleh",slug:"hosam-m.-saleh",fullName:"Hosam M. Saleh"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"10901",title:"Grapes and Wine",subtitle:null,isOpenForSubmission:!1,hash:"5d7f2aa74874444bc6986e613ccebd7c",slug:"grapes-and-wine",bookSignature:"Antonio Morata, Iris Loira and Carmen González",coverURL:"https://cdn.intechopen.com/books/images_new/10901.jpg",editors:[{id:"180952",title:"Prof.",name:"Antonio",middleName:null,surname:"Morata",slug:"antonio-morata",fullName:"Antonio Morata"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"11080",title:"Engineering Principles",subtitle:"Welding and Residual Stresses",isOpenForSubmission:!1,hash:"6c07a13a113bce94174b40096f30fb5e",slug:"engineering-principles-welding-and-residual-stresses",bookSignature:"Kavian Omar Cooke and Ronaldo Câmara Cozza",coverURL:"https://cdn.intechopen.com/books/images_new/11080.jpg",editors:[{id:"138778",title:"Dr.",name:"Kavian",middleName:"Omar",surname:"Cooke",slug:"kavian-cooke",fullName:"Kavian Cooke"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"11332",title:"Essential Oils",subtitle:"Advances in Extractions and Biological Applications",isOpenForSubmission:!1,hash:"742e6cae3a35686f975edc8d7f9afa94",slug:"essential-oils-advances-in-extractions-and-biological-applications",bookSignature:"Mozaniel Santana de Oliveira and Eloisa Helena de Aguiar Andrade",coverURL:"https://cdn.intechopen.com/books/images_new/11332.jpg",editors:[{id:"195290",title:"Ph.D.",name:"Mozaniel",middleName:null,surname:"Santana De Oliveira",slug:"mozaniel-santana-de-oliveira",fullName:"Mozaniel Santana De Oliveira"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"11029",title:"Hepatitis B",subtitle:null,isOpenForSubmission:!1,hash:"609701f502efc3538c112ff47a2c2119",slug:"hepatitis-b",bookSignature:"Luis Rodrigo",coverURL:"https://cdn.intechopen.com/books/images_new/11029.jpg",editors:[{id:"73208",title:"Prof.",name:"Luis",middleName:null,surname:"Rodrigo",slug:"luis-rodrigo",fullName:"Luis Rodrigo"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"9537",title:"Human Rights in the Contemporary World",subtitle:null,isOpenForSubmission:!1,hash:"54f05b93812fd434f3962956d6413a6b",slug:"human-rights-in-the-contemporary-world",bookSignature:"Trudy Corrigan",coverURL:"https://cdn.intechopen.com/books/images_new/9537.jpg",editors:[{id:"197557",title:"Dr.",name:"Trudy",middleName:null,surname:"Corrigan",slug:"trudy-corrigan",fullName:"Trudy Corrigan"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"11371",title:"Cerebral Circulation",subtitle:"Updates on Models, Diagnostics and Treatments of Related Diseases",isOpenForSubmission:!1,hash:"e2d3335445d2852d0b906bb9750e939f",slug:"cerebral-circulation-updates-on-models-diagnostics-and-treatments-of-related-diseases",bookSignature:"Alba Scerrati, Luca Ricciardi and Flavia Dones",coverURL:"https://cdn.intechopen.com/books/images_new/11371.jpg",editors:[{id:"182614",title:"Dr.",name:"Alba",middleName:null,surname:"Scerrati",slug:"alba-scerrati",fullName:"Alba Scerrati"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"11012",title:"Radiopharmaceuticals",subtitle:"Current Research for Better Diagnosis and Therapy",isOpenForSubmission:!1,hash:"f9046d6f96148b285e776f384991120d",slug:"radiopharmaceuticals-current-research-for-better-diagnosis-and-therapy",bookSignature:"Farid A. Badria",coverURL:"https://cdn.intechopen.com/books/images_new/11012.jpg",editors:[{id:"41865",title:"Prof.",name:"Farid A.",middleName:null,surname:"Badria",slug:"farid-a.-badria",fullName:"Farid A. Badria"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"9974",title:"E-Learning and Digital Education in the Twenty-First Century",subtitle:null,isOpenForSubmission:!1,hash:"88b58d66e975df20425fc1dfd22d53aa",slug:"e-learning-and-digital-education-in-the-twenty-first-century",bookSignature:"M. Mahruf C. Shohel",coverURL:"https://cdn.intechopen.com/books/images_new/9974.jpg",editors:[{id:"94099",title:"Dr.",name:"M. Mahruf C.",middleName:null,surname:"Shohel",slug:"m.-mahruf-c.-shohel",fullName:"M. Mahruf C. Shohel"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}}],offset:12,limit:12,total:4431},hotBookTopics:{hotBooks:[],offset:0,limit:12,total:null},publish:{},publishingProposal:{success:null,errors:{}},books:{featuredBooks:[{type:"book",id:"10858",title:"MOOC (Massive Open Online Courses)",subtitle:null,isOpenForSubmission:!1,hash:"d32f86793bc72dde32532f509b1ec5b0",slug:"mooc-massive-open-online-courses-",bookSignature:"Dragan Cvetković",coverURL:"https://cdn.intechopen.com/books/images_new/10858.jpg",publishedDate:"June 23rd 2022",numberOfDownloads:1677,editors:[{id:"101330",title:"Dr.",name:"Dragan",middleName:"Mladen",surname:"Cvetković",slug:"dragan-cvetkovic",fullName:"Dragan Cvetković"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"10195",title:"Serotonin and the CNS",subtitle:"New Developments in Pharmacology and Therapeutics",isOpenForSubmission:!1,hash:"7ed9d96da98233a885bd2869a8056c36",slug:"serotonin-and-the-cns-new-developments-in-pharmacology-and-therapeutics",bookSignature:"Berend Olivier",coverURL:"https://cdn.intechopen.com/books/images_new/10195.jpg",publishedDate:"June 23rd 2022",numberOfDownloads:1337,editors:[{id:"71579",title:"Prof.",name:"Berend",middleName:null,surname:"Olivier",slug:"berend-olivier",fullName:"Berend Olivier"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"10755",title:"Corporate Governance",subtitle:"Recent Advances and Perspectives",isOpenForSubmission:!1,hash:"ffe06d1d5c4bf0fc2e63511825fe1257",slug:"corporate-governance-recent-advances-and-perspectives",bookSignature:"Okechukwu Lawrence Emeagwali and Feyza Bhatti",coverURL:"https://cdn.intechopen.com/books/images_new/10755.jpg",publishedDate:"June 23rd 2022",numberOfDownloads:1309,editors:[{id:"196317",title:"Associate Prof.",name:"Okechukwu Lawrence",middleName:null,surname:"Emeagwali",slug:"okechukwu-lawrence-emeagwali",fullName:"Okechukwu Lawrence Emeagwali"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"11120",title:"Environmental Impact and Remediation of Heavy Metals",subtitle:null,isOpenForSubmission:!1,hash:"9e77514288e7394f1e6cd13481af3509",slug:"environmental-impact-and-remediation-of-heavy-metals",bookSignature:"Hosam M. Saleh and Amal I. Hassan",coverURL:"https://cdn.intechopen.com/books/images_new/11120.jpg",publishedDate:"June 23rd 2022",numberOfDownloads:847,editors:[{id:"144691",title:"Prof.",name:"Hosam M.",middleName:null,surname:"Saleh",slug:"hosam-m.-saleh",fullName:"Hosam M. Saleh"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"10901",title:"Grapes and Wine",subtitle:null,isOpenForSubmission:!1,hash:"5d7f2aa74874444bc6986e613ccebd7c",slug:"grapes-and-wine",bookSignature:"Antonio Morata, Iris Loira and Carmen González",coverURL:"https://cdn.intechopen.com/books/images_new/10901.jpg",publishedDate:"June 15th 2022",numberOfDownloads:2273,editors:[{id:"180952",title:"Prof.",name:"Antonio",middleName:null,surname:"Morata",slug:"antonio-morata",fullName:"Antonio Morata"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"11080",title:"Engineering Principles",subtitle:"Welding and Residual Stresses",isOpenForSubmission:!1,hash:"6c07a13a113bce94174b40096f30fb5e",slug:"engineering-principles-welding-and-residual-stresses",bookSignature:"Kavian Omar Cooke and Ronaldo Câmara Cozza",coverURL:"https://cdn.intechopen.com/books/images_new/11080.jpg",publishedDate:"June 23rd 2022",numberOfDownloads:591,editors:[{id:"138778",title:"Dr.",name:"Kavian",middleName:"Omar",surname:"Cooke",slug:"kavian-cooke",fullName:"Kavian Cooke"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"11332",title:"Essential Oils",subtitle:"Advances in Extractions and Biological Applications",isOpenForSubmission:!1,hash:"742e6cae3a35686f975edc8d7f9afa94",slug:"essential-oils-advances-in-extractions-and-biological-applications",bookSignature:"Mozaniel Santana de Oliveira and Eloisa Helena de Aguiar Andrade",coverURL:"https://cdn.intechopen.com/books/images_new/11332.jpg",publishedDate:"June 23rd 2022",numberOfDownloads:515,editors:[{id:"195290",title:"Ph.D.",name:"Mozaniel",middleName:null,surname:"Santana De Oliveira",slug:"mozaniel-santana-de-oliveira",fullName:"Mozaniel Santana De Oliveira"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"11029",title:"Hepatitis B",subtitle:null,isOpenForSubmission:!1,hash:"609701f502efc3538c112ff47a2c2119",slug:"hepatitis-b",bookSignature:"Luis Rodrigo",coverURL:"https://cdn.intechopen.com/books/images_new/11029.jpg",publishedDate:"June 23rd 2022",numberOfDownloads:413,editors:[{id:"73208",title:"Prof.",name:"Luis",middleName:null,surname:"Rodrigo",slug:"luis-rodrigo",fullName:"Luis Rodrigo"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"9537",title:"Human Rights in the Contemporary World",subtitle:null,isOpenForSubmission:!1,hash:"54f05b93812fd434f3962956d6413a6b",slug:"human-rights-in-the-contemporary-world",bookSignature:"Trudy Corrigan",coverURL:"https://cdn.intechopen.com/books/images_new/9537.jpg",publishedDate:"June 8th 2022",numberOfDownloads:2194,editors:[{id:"197557",title:"Dr.",name:"Trudy",middleName:null,surname:"Corrigan",slug:"trudy-corrigan",fullName:"Trudy Corrigan"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"11371",title:"Cerebral Circulation",subtitle:"Updates on Models, Diagnostics and Treatments of Related Diseases",isOpenForSubmission:!1,hash:"e2d3335445d2852d0b906bb9750e939f",slug:"cerebral-circulation-updates-on-models-diagnostics-and-treatments-of-related-diseases",bookSignature:"Alba Scerrati, Luca Ricciardi and Flavia Dones",coverURL:"https://cdn.intechopen.com/books/images_new/11371.jpg",publishedDate:"June 23rd 2022",numberOfDownloads:341,editors:[{id:"182614",title:"Dr.",name:"Alba",middleName:null,surname:"Scerrati",slug:"alba-scerrati",fullName:"Alba Scerrati"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}}],latestBooks:[{type:"book",id:"11043",title:"Endometriosis",subtitle:"Recent Advances, New Perspectives and Treatments",isOpenForSubmission:!1,hash:"7baf1c70b11d41400bb9302ae9411ca4",slug:"endometriosis-recent-advances-new-perspectives-and-treatments",bookSignature:"Giovana Ap. Gonçalves",coverURL:"https://cdn.intechopen.com/books/images_new/11043.jpg",editedByType:"Edited by",publishedDate:"June 28th 2022",editors:[{id:"185930",title:"Associate Prof.",name:"Giovana",middleName:null,surname:"Gonçalves",slug:"giovana-goncalves",fullName:"Giovana Gonçalves"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"10536",title:"Campylobacter",subtitle:null,isOpenForSubmission:!1,hash:"c4b132b741dd0a2ed539b824ab63965f",slug:"campylobacter",bookSignature:"Guillermo Tellez-Isaias and Saeed El-Ashram",coverURL:"https://cdn.intechopen.com/books/images_new/10536.jpg",editedByType:"Edited by",publishedDate:"June 28th 2022",editors:[{id:"73465",title:"Dr.",name:"Guillermo",middleName:null,surname:"Téllez",slug:"guillermo-tellez",fullName:"Guillermo Téllez"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"10798",title:"Starch",subtitle:"Evolution and Recent Advances",isOpenForSubmission:!1,hash:"f197f6062c1574a9a90e50a369271bcf",slug:"starch-evolution-and-recent-advances",bookSignature:"Martins Ochubiojo Emeje",coverURL:"https://cdn.intechopen.com/books/images_new/10798.jpg",editedByType:"Edited by",publishedDate:"June 28th 2022",editors:[{id:"94311",title:"Prof.",name:"Martins",middleName:"Ochubiojo",surname:"Ochubiojo Emeje",slug:"martins-ochubiojo-emeje",fullName:"Martins Ochubiojo Emeje"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"11083",title:"Hazardous Waste Management",subtitle:null,isOpenForSubmission:!1,hash:"d553bd4f6f1c4b115ca69bd19faac7dc",slug:"hazardous-waste-management",bookSignature:"Rajesh Banu Jeyakumar, Kavitha Sankarapandian and Yukesh Kannah Ravi",coverURL:"https://cdn.intechopen.com/books/images_new/11083.jpg",editedByType:"Edited by",publishedDate:"June 28th 2022",editors:[{id:"218539",title:"Dr.",name:"Rajesh Banu",middleName:null,surname:"Jeyakumar",slug:"rajesh-banu-jeyakumar",fullName:"Rajesh Banu Jeyakumar"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"10848",title:"Tribology of Machine Elements",subtitle:"Fundamentals and Applications",isOpenForSubmission:!1,hash:"3c4ca4c4692ca8d4fa749b4ae81ec1fa",slug:"tribology-of-machine-elements-fundamentals-and-applications",bookSignature:"Giuseppe Pintaude, Tiago Cousseau and Anna Rudawska",coverURL:"https://cdn.intechopen.com/books/images_new/10848.jpg",editedByType:"Edited by",publishedDate:"June 28th 2022",editors:[{id:"18347",title:"Prof.",name:"Giuseppe",middleName:null,surname:"Pintaude",slug:"giuseppe-pintaude",fullName:"Giuseppe Pintaude"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"10856",title:"Crude Oil",subtitle:"New Technologies and Recent Approaches",isOpenForSubmission:!1,hash:"8d0a7ca35b3de95b295dc4eab39a087e",slug:"crude-oil-new-technologies-and-recent-approaches",bookSignature:"Manar Elsayed Abdel-Raouf and Mohamed Hasan El-Keshawy",coverURL:"https://cdn.intechopen.com/books/images_new/10856.jpg",editedByType:"Edited by",publishedDate:"June 28th 2022",editors:[{id:"102626",title:"Prof.",name:"Manar",middleName:null,surname:"Elsayed Abdel-Raouf",slug:"manar-elsayed-abdel-raouf",fullName:"Manar Elsayed Abdel-Raouf"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"9625",title:"Spinocerebellar Ataxia",subtitle:"Concepts, Particularities and Generalities",isOpenForSubmission:!1,hash:"365a7025fd46eb45de2549bdd9d50b98",slug:"spinocerebellar-ataxia-concepts-particularities-and-generalities",bookSignature:"Patricia Bozzetto Ambrosi",coverURL:"https://cdn.intechopen.com/books/images_new/9625.jpg",editedByType:"Edited by",publishedDate:"June 28th 2022",editors:[{id:"221787",title:"Dr.",name:"Patricia",middleName:null,surname:"Bozzetto Ambrosi",slug:"patricia-bozzetto-ambrosi",fullName:"Patricia Bozzetto Ambrosi"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"10905",title:"Plant Defense Mechanisms",subtitle:null,isOpenForSubmission:!1,hash:"84ad5b27dde5f01dc76087d0fd6fa834",slug:"plant-defense-mechanisms",bookSignature:"Josphert Ngui Kimatu",coverURL:"https://cdn.intechopen.com/books/images_new/10905.jpg",editedByType:"Edited by",publishedDate:"June 28th 2022",editors:[{id:"224171",title:"Prof.",name:"Josphert N.",middleName:null,surname:"Kimatu",slug:"josphert-n.-kimatu",fullName:"Josphert N. Kimatu"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"10686",title:"Natural Gas",subtitle:"New Perspectives and Future Developments",isOpenForSubmission:!1,hash:"581763788a6a59e653a9d1d9b5a42d79",slug:"natural-gas-new-perspectives-and-future-developments",bookSignature:"Maryam Takht Ravanchi",coverURL:"https://cdn.intechopen.com/books/images_new/10686.jpg",editedByType:"Edited by",publishedDate:"June 28th 2022",editors:[{id:"2416",title:"Dr.",name:"Maryam",middleName:null,surname:"Takht Ravanchi",slug:"maryam-takht-ravanchi",fullName:"Maryam Takht Ravanchi"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"10988",title:"Railway Transport Planning and Manageme",subtitle:null,isOpenForSubmission:!1,hash:"5cb54cc53caedad9ec78372563c82e2c",slug:"railway-transport-planning-and-management",bookSignature:"Stefano de Luca, Roberta Di Pace and Chiara Fiori",coverURL:"https://cdn.intechopen.com/books/images_new/10988.jpg",editedByType:"Edited by",publishedDate:"June 28th 2022",editors:[{id:"271061",title:"Prof.",name:"Stefano",middleName:null,surname:"de Luca",slug:"stefano-de-luca",fullName:"Stefano de Luca"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}}]},subject:{topic:{id:"235",title:"Gerontology",slug:"gerontology",parent:{id:"21",title:"Psychology",slug:"psychology"},numberOfBooks:4,numberOfSeries:0,numberOfAuthorsAndEditors:72,numberOfWosCitations:29,numberOfCrossrefCitations:40,numberOfDimensionsCitations:75,videoUrl:null,fallbackUrl:null,description:null},booksByTopicFilter:{topicId:"235",sort:"-publishedDate",limit:12,offset:0},booksByTopicCollection:[{type:"book",id:"7904",title:"Aging",subtitle:"Life Span and Life Expectancy",isOpenForSubmission:!1,hash:"4507619de679dfa85bc6e073d163f3c8",slug:"aging-life-span-and-life-expectancy",bookSignature:"Robert J. Reynolds and Steven M. Day",coverURL:"https://cdn.intechopen.com/books/images_new/7904.jpg",editedByType:"Edited by",editors:[{id:"220737",title:"Dr.",name:"Robert",middleName:null,surname:"J. Reynolds",slug:"robert-j.-reynolds",fullName:"Robert J. Reynolds"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"6704",title:"Geriatrics Health",subtitle:null,isOpenForSubmission:!1,hash:"7cac7767e0b34391318cd4a680ca0d68",slug:"geriatrics-health",bookSignature:"Hülya Çakmur",coverURL:"https://cdn.intechopen.com/books/images_new/6704.jpg",editedByType:"Edited by",editors:[{id:"190636",title:"Associate Prof.",name:"Hülya",middleName:null,surname:"Çakmur",slug:"hulya-cakmur",fullName:"Hülya Çakmur"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"6381",title:"Gerontology",subtitle:null,isOpenForSubmission:!1,hash:"bf232563c8fe15ef0848ed6ffb8f832d",slug:"gerontology",bookSignature:"Grazia D’Onofrio, Antonio Greco and Daniele Sancarlo",coverURL:"https://cdn.intechopen.com/books/images_new/6381.jpg",editedByType:"Edited by",editors:[{id:"272628",title:"Dr.",name:"Grazia",middleName:null,surname:"D'Onofrio",slug:"grazia-d'onofrio",fullName:"Grazia D'Onofrio"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"5925",title:"Perception of Beauty",subtitle:null,isOpenForSubmission:!1,hash:"11f483d631557ad26d48b577e23a724f",slug:"perception-of-beauty",bookSignature:"Martha Peaslee Levine",coverURL:"https://cdn.intechopen.com/books/images_new/5925.jpg",editedByType:"Edited by",editors:[{id:"186919",title:"Dr.",name:"Martha",middleName:null,surname:"Peaslee Levine",slug:"martha-peaslee-levine",fullName:"Martha Peaslee Levine"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}}],booksByTopicTotal:4,seriesByTopicCollection:[],seriesByTopicTotal:0,mostCitedChapters:[{id:"60564",doi:"10.5772/intechopen.76249",title:"Ageing Process and Physiological Changes",slug:"ageing-process-and-physiological-changes",totalDownloads:6884,totalCrossrefCites:16,totalDimensionsCites:31,abstract:"Ageing is a natural process. Everyone must undergo this phase of life at his or her own time and pace. In the broader sense, ageing reflects all the changes taking place over the course of life. These changes start from birth—one grows, develops and attains maturity. To the young, ageing is exciting. Middle age is the time when people notice the age-related changes like greying of hair, wrinkled skin and a fair amount of physical decline. Even the healthiest, aesthetically fit cannot escape these changes. Slow and steady physical impairment and functional disability are noticed resulting in increased dependency in the period of old age. According to World Health Organization, ageing is a course of biological reality which starts at conception and ends with death. It has its own dynamics, much beyond human control. However, this process of ageing is also subject to the constructions by which each society makes sense of old age. In most of the developed countries, the age of 60 is considered equivalent to retirement age and it is said to be the beginning of old age. In this chapter, you understand the details of ageing processes and associated physiological changes.",book:{id:"6381",slug:"gerontology",title:"Gerontology",fullTitle:"Gerontology"},signatures:"Shilpa Amarya, Kalyani Singh and Manisha Sabharwal",authors:[{id:"226573",title:"Ph.D.",name:"Shilpa",middleName:null,surname:"Amarya",slug:"shilpa-amarya",fullName:"Shilpa Amarya"},{id:"226593",title:"Dr.",name:"Kalyani",middleName:null,surname:"Singh",slug:"kalyani-singh",fullName:"Kalyani Singh"},{id:"243264",title:"Dr.",name:"Manisha",middleName:null,surname:"Sabharwal",slug:"manisha-sabharwal",fullName:"Manisha Sabharwal"}]},{id:"55388",doi:"10.5772/intechopen.68944",title:"Beauty, Body Image, and the Media",slug:"beauty-body-image-and-the-media",totalDownloads:7678,totalCrossrefCites:5,totalDimensionsCites:12,abstract:"This chapter analyses the role of the mass media in people’s perceptions of beauty. We summarize the research literature on the mass media, both traditional media and online social media, and how they appear to interact with psychological factors to impact appearance concerns and body image disturbances. There is a strong support for the idea that traditional forms of media (e.g. magazines and music videos) affect perceptions of beauty and appearance concerns by leading women to internalize a very slender body type as ideal or beautiful. Rather than simply being passive recipients of unrealistic beauty ideals communicated to them via the media, a great number of individuals actually seek out idealized images in the media. Finally, we review what is known about the role of social media in impacting society’s perception of beauty and notions of idealized physical forms. Social media are more interactive than traditional media and the effects of self‐presentation strategies on perceptions of beauty have just begun to be studied. This is an emerging area of research that is of high relevance to researchers and clinicians interested in body image and appearance concerns.",book:{id:"5925",slug:"perception-of-beauty",title:"Perception of Beauty",fullTitle:"Perception of Beauty"},signatures:"Jennifer S. Mills, Amy Shannon and Jacqueline Hogue",authors:[{id:"202110",title:"Dr.",name:"Jennifer S.",middleName:null,surname:"Mills",slug:"jennifer-s.-mills",fullName:"Jennifer S. Mills"}]},{id:"59227",doi:"10.5772/intechopen.73385",title:"Differentiating Normal Cognitive Aging from Cognitive Impairment No Dementia: A Focus on Constructive and Visuospatial Abilities",slug:"differentiating-normal-cognitive-aging-from-cognitive-impairment-no-dementia-a-focus-on-constructive",totalDownloads:1329,totalCrossrefCites:3,totalDimensionsCites:6,abstract:"Constructive and visuospatial abilities in normal and in pathological aging (cognitive impairment, no dementia, CIND) are investigated. The sample includes 188 participants over 60 years of age, divided in 2 groups: healthy subjects (MMSE ≥28), without cognitive complaints, and individuals with CIND (MMSE between 24 and 27 and subjective cognitive complains). Drawing of cube and drawing of house, Benton Visual Retention Test (BVRT), and Block design are used to test the hypothesis that short visuoconstructive and visuospatial tests can distinguish normal from pathological cognitive aging in its very early stages. Results proved the discriminative sensitivity of BVRT general assessment criteria and of omissions and distortions in CIND. The diagnostic sensitivity of a modification of Moore and Wike [1984] scoring system for house and cube drawing tasks was confirmed as well. Drawing of cube and house could be used for quick screening of CIND in subjects over 60. Principal component analysis with oblimin rotation was performed to explore the different dimensions in the visuospatial and visuoconstructive abilities in old age. A four-factor structure was established, all four factors explaining 71% of the variance.",book:{id:"6381",slug:"gerontology",title:"Gerontology",fullTitle:"Gerontology"},signatures:"Radka Ivanova Massaldjieva",authors:[{id:"75907",title:"Associate Prof.",name:"Radka Ivanova",middleName:null,surname:"Massaldjieva",slug:"radka-ivanova-massaldjieva",fullName:"Radka Ivanova Massaldjieva"}]},{id:"59658",doi:"10.5772/intechopen.74748",title:"Ageing Better in the Netherlands",slug:"ageing-better-in-the-netherlands",totalDownloads:1175,totalCrossrefCites:1,totalDimensionsCites:4,abstract:"The Dutch National Care for the Elderly Programme was an initiative organized by the Netherlands Organisation for Health Research and Development (ZonMw) between 2008 and 2016. The aim of the programme was to collect knowledge about frail elderly, to assess their needs and to provide person-centred and integrated care better suited to their needs. The budget of EUR 88 million was provided by the Dutch Ministry of Health, Welfare and Sports. Putting the needs of elderly people at the heart of the programme and ensuring their active participation were key to the programme’s success. The programme outcomes included the establishment of eight geriatric networks around the medical universities with 650 organisations and the completion of 218 projects. These projects, involving 43,000 elderly people and 8500 central caregivers, resulted in the completion of 45 PhD theses and the publication of more than 400 articles and the development of 300 practice toolkits, one database and a website, www.beteroud.nl. The Dutch National Care for the Elderly Programme has since developed into a movement and continues under the consortium Ageing Better, made up of eight organisations. Through the use of ambassadors, Ageing Better promotes the message that ageing is not a disease but a new phase of life.",book:{id:"6381",slug:"gerontology",title:"Gerontology",fullTitle:"Gerontology"},signatures:"Betty Meyboom-de Jong, Klaske Wynia and Anjo Geluk-Bleumink",authors:[{id:"224997",title:"Emeritus Prof.",name:"Betty",middleName:null,surname:"Meyboom-De Jong",slug:"betty-meyboom-de-jong",fullName:"Betty Meyboom-De Jong"},{id:"232900",title:"Dr.",name:"Klaske",middleName:null,surname:"Wynia",slug:"klaske-wynia",fullName:"Klaske Wynia"},{id:"232901",title:"Mrs.",name:"Anjo",middleName:null,surname:"Geluk-Bleumink",slug:"anjo-geluk-bleumink",fullName:"Anjo Geluk-Bleumink"}]},{id:"57952",doi:"10.5772/intechopen.71904",title:"Neurocognitive Implications of Tangential Speech in Patients with Focal Brain Damage",slug:"neurocognitive-implications-of-tangential-speech-in-patients-with-focal-brain-damage",totalDownloads:1574,totalCrossrefCites:0,totalDimensionsCites:3,abstract:"There are no studies on the neurocognitive implications of tangential speech (TS). This research aims to take a step forward in the study of narrative processing, by evaluating TS in a sample that helps to detect this deficit when it is neurogenic and recently manifested. The relationship between TS, secondary to focal brain injury, and neuropsychological and neuroanatomical variables was explored. A comprehensive neuropsychological battery was administered to 175 volunteers: 95 alert inpatients, without aphasia, without psychiatric history and without TS history, and 80 healthy participants, without TS. Results: TS (prevalence 16%) was independent of type or site of injury. An adverse effect of TS on global neuropsychological performance was observed. This effect was significantly related to attentional errors along with prolonged processing times but not to correct responses. Reliability and validity indices for the present TS screening scale were provided. Conclusion: Present results support the hypothesis that this neurogenic inability to spontaneously find, organize and communicate verbal information, beyond single words, depends on extended brain networks involving processes such as sustained attention, complex-syntax comprehension, the (implicit) interpretation and spontaneous recall of a narrative, and emotional and behavioral alterations. Early TS detection is advisable for prevention and treatment at any age.",book:{id:"6381",slug:"gerontology",title:"Gerontology",fullTitle:"Gerontology"},signatures:"Nora Silvana Vigliecca",authors:[{id:"202008",title:"Dr.",name:"Nora",middleName:"Silvana",surname:"Vigliecca",slug:"nora-vigliecca",fullName:"Nora Vigliecca"}]}],mostDownloadedChaptersLast30Days:[{id:"60564",title:"Ageing Process and Physiological Changes",slug:"ageing-process-and-physiological-changes",totalDownloads:6884,totalCrossrefCites:16,totalDimensionsCites:31,abstract:"Ageing is a natural process. Everyone must undergo this phase of life at his or her own time and pace. In the broader sense, ageing reflects all the changes taking place over the course of life. These changes start from birth—one grows, develops and attains maturity. To the young, ageing is exciting. Middle age is the time when people notice the age-related changes like greying of hair, wrinkled skin and a fair amount of physical decline. Even the healthiest, aesthetically fit cannot escape these changes. Slow and steady physical impairment and functional disability are noticed resulting in increased dependency in the period of old age. According to World Health Organization, ageing is a course of biological reality which starts at conception and ends with death. It has its own dynamics, much beyond human control. However, this process of ageing is also subject to the constructions by which each society makes sense of old age. In most of the developed countries, the age of 60 is considered equivalent to retirement age and it is said to be the beginning of old age. In this chapter, you understand the details of ageing processes and associated physiological changes.",book:{id:"6381",slug:"gerontology",title:"Gerontology",fullTitle:"Gerontology"},signatures:"Shilpa Amarya, Kalyani Singh and Manisha Sabharwal",authors:[{id:"226573",title:"Ph.D.",name:"Shilpa",middleName:null,surname:"Amarya",slug:"shilpa-amarya",fullName:"Shilpa Amarya"},{id:"226593",title:"Dr.",name:"Kalyani",middleName:null,surname:"Singh",slug:"kalyani-singh",fullName:"Kalyani Singh"},{id:"243264",title:"Dr.",name:"Manisha",middleName:null,surname:"Sabharwal",slug:"manisha-sabharwal",fullName:"Manisha Sabharwal"}]},{id:"55388",title:"Beauty, Body Image, and the Media",slug:"beauty-body-image-and-the-media",totalDownloads:7678,totalCrossrefCites:5,totalDimensionsCites:12,abstract:"This chapter analyses the role of the mass media in people’s perceptions of beauty. We summarize the research literature on the mass media, both traditional media and online social media, and how they appear to interact with psychological factors to impact appearance concerns and body image disturbances. There is a strong support for the idea that traditional forms of media (e.g. magazines and music videos) affect perceptions of beauty and appearance concerns by leading women to internalize a very slender body type as ideal or beautiful. Rather than simply being passive recipients of unrealistic beauty ideals communicated to them via the media, a great number of individuals actually seek out idealized images in the media. Finally, we review what is known about the role of social media in impacting society’s perception of beauty and notions of idealized physical forms. Social media are more interactive than traditional media and the effects of self‐presentation strategies on perceptions of beauty have just begun to be studied. This is an emerging area of research that is of high relevance to researchers and clinicians interested in body image and appearance concerns.",book:{id:"5925",slug:"perception-of-beauty",title:"Perception of Beauty",fullTitle:"Perception of Beauty"},signatures:"Jennifer S. Mills, Amy Shannon and Jacqueline Hogue",authors:[{id:"202110",title:"Dr.",name:"Jennifer S.",middleName:null,surname:"Mills",slug:"jennifer-s.-mills",fullName:"Jennifer S. Mills"}]},{id:"56505",title:"Aesthetics of the Naked Human Body: From Pornography (Sexualised Lust Object) to Iconography (Aesthetics of Human Nobility and Wisdom) in an Anthropology of Physical Beauty",slug:"aesthetics-of-the-naked-human-body-from-pornography-sexualised-lust-object-to-iconography-aesthetics",totalDownloads:2081,totalCrossrefCites:0,totalDimensionsCites:0,abstract:"In many religious circles and philosophies of life, the human body is excluded from the realm of spirituality and meaning. Due to a dualistic approach, nudity is viewed as merely a physical and corporeal category. In social media, there is the real danger that the naked human body is exploited for commercial gain. Advertisements often leave the impression that the body, very specifically the genitals, is designed merely for physical desire and corporeal chemistry. They become easily objects for lust, excluded from the beauty of graceful existence and noble courage. It is argued that the naked human body is not designed for pornographic exploitation and promiscuous sensuality but for compassionate intimacy and nurturing care in order to instil a humane dimension in human and sexual encounters. In this regard, antiquity and the Michelangelesque perspective can contribute to a paradigm shift from abusive exploitation to the beauty of vulnerable sensitivity. In order to foster an integrative approach to theory formation in anthropology, the methodology of stereometric thinking is proposed.",book:{id:"5925",slug:"perception-of-beauty",title:"Perception of Beauty",fullTitle:"Perception of Beauty"},signatures:"Daniel J Louw",authors:[{id:"200645",title:"Prof.",name:"Daniel",middleName:"Johannes",surname:"Louw",slug:"daniel-louw",fullName:"Daniel Louw"}]},{id:"56059",title:"A Plastic Surgeon’s Perspective on Stereotyping and the Perception of Beauty",slug:"a-plastic-surgeon-s-perspective-on-stereotyping-and-the-perception-of-beauty",totalDownloads:1890,totalCrossrefCites:0,totalDimensionsCites:0,abstract:"In the world of plastic surgery, misconceptions may lead to irrational requests or outcomes not appreciated by patients. Those who manage aesthetics should always listen and recognize the variability of cultural identities, desires, attitudes, anxieties and uncertainties of the patient. Emerging from a diversity of cultures and its transforming trends, the scope of cosmetic surgery and its practice reflect not only the individual’s personality, but also the culture as a whole. When counseling an individual, one has to recognize that even in groups of seemingly identical social or cultural standards; there are subtle differences in expectations. To illustrate the potential for inaccuracy of ethnic profiling in the field of plastic surgery authors quote their own work on Asian subjects and facial beauty and resort to experience of others. To reaffirm their opinion and to exemplify how sometimes “fine” differences in the perception of beauty exist, an original study that evaluates the preferences among selected groups of Latina women in respect to buttock aesthetics has been included. This dissertation will focus on how cultural factors influence beauty perception; strengthen the fact that beauty is in the eye of the beholder and how variable differences exist even between small subgroups.",book:{id:"5925",slug:"perception-of-beauty",title:"Perception of Beauty",fullTitle:"Perception of Beauty"},signatures:"Johanna D’Agostino and Marek Dobke",authors:[{id:"17590",title:"Dr.",name:"Marek K.",middleName:null,surname:"Dobke",slug:"marek-k.-dobke",fullName:"Marek K. Dobke"},{id:"201244",title:"Dr.",name:"Johanna",middleName:null,surname:"D'Agostino",slug:"johanna-d'agostino",fullName:"Johanna D'Agostino"}]},{id:"80326",title:"Anti-Senescence Therapy",slug:"anti-senescence-therapy",totalDownloads:102,totalCrossrefCites:0,totalDimensionsCites:0,abstract:"The development of therapeutic strategies aimed at the aging process of cells has attracted increasing attention in recent decades due to the involvement of this process in the development of many chronic and age-related diseases. Interestingly, preclinical studies have shown the success of a number of anti-aging approaches in the treatment of a range of chronic diseases. These approaches are directed against aging processes such as oxidative stress, telomerase shortening, inflammation, and deficient autophagy. Many strategies has been shown to be effective in delaying aging, including antiaging strategies based on establishing healthy lifestyle habits and pharmacological interventions aimed at disrupting senescent cells and senescent-associated secretory phenotype. Caloric restriction and intermittent fasting were reported to activate autophagy and reduce inflammation. In turn, immune-based strategies, senolytic agents, and senomorphics mediate their effects either by eliminating senescent cells through inducing apoptosis or by disrupting pathways by which senescent cells mediate their detrimental effects. In addition, given the association of the decline in the regenerative potential of stem cells with aging, many experimental and clinical studies indicate the effectiveness of stem cell transplantation in preventing or slowing the progress of age-related diseases by enhancing the repairing mechanisms and the secretion of many growth factors and cytokines.",book:{id:"10935",slug:null,title:"Mechanisms and Management of Senescence",fullTitle:"Mechanisms and Management of Senescence"},signatures:"Raghad Alshadidi",authors:null}],onlineFirstChaptersFilter:{topicId:"235",limit:6,offset:0},onlineFirstChaptersCollection:[{id:"82112",title:"Comparative Senescence and Lifespan",slug:"comparative-senescence-and-lifespan",totalDownloads:8,totalDimensionsCites:0,doi:"10.5772/intechopen.105137",abstract:"The word senescence is derived from the Latin word “senex” (meaning old). In biology, senescence is a process by which a cell ages and permanently stops dividing. Senescence is a natural universal phenomenon affecting all living organisms (e.g., humans, animals, and plants). It is the process of growing old (aging). The underlying mechanisms of senescence and aging at the cellular level are not fully understood. Senescence is a multifactorial process that can be induced by several stimuli including cellular stress, DNA damage, telomere shortening, and oncogene activation. The most popular theory to explain aging is the free radical theory. Senescence plays a role in the development of several age-related chronic diseases in humans (e.g., ischemic heart disease, osteoporosis, and cancer). Lifespan is a biological characteristic of every species. The lifespan of living organisms ranges from few hours (with mayfly) to potential eternity (with jellyfish and hydra). The maximum theoretical lifespan in humans is around 120 years. The lifespan in humans is influenced by multiple factors including genetic, epigenetic, lifestyle, environmental, metabolic, and endocrine factors. There are several ways to potentially extend the lifespan of humans and eventually surpass the maximum theoretical lifespan of 120 years. The tools that can be proposed include lifestyle, reduction of several life-threatening diseases and disabilities, hormonal replacement, antioxidants, autophagy inducers, senolytic drugs, stem cell therapy, and gene therapy.",book:{id:"10935",title:"Mechanisms and Management of Senescence",coverURL:"https://cdn.intechopen.com/books/images_new/10935.jpg"},signatures:"Hassan M. Heshmati"},{id:"81638",title:"Aging and Neuropsychiatric Disease: A General Overview of Prevalence and Trends",slug:"aging-and-neuropsychiatric-disease-a-general-overview-of-prevalence-and-trends",totalDownloads:25,totalDimensionsCites:0,doi:"10.5772/intechopen.103102",abstract:"The increasing trend of life-expectancy is becoming a significant demographic, societal and economic challenge. Currently, global number of people above sixty years of age is 900 million, while United Nations expect this number to rise to over 1.4 billion in 2030 and over 2.5 billion by 2050. Concordant to this trend, numerous physiological changes are associated with aging and brain-related ones are associated with neuropsychiatric diseases. The main goal of this chapter is to identify the most important neuropsychiatric diseases to assess in older patients to help to promote health and prevent diseases and complications associated with chronic illness, as these changes are progressive and require important psychological and setting-related social adjustments. Findings identify several health-aspects highly present in elderly: stroke, white matter lesions, dementia rise with age, changes in levels of neurotransmitters and hormones, depression as well as the bereavement following loss of the loved one, and the most common neurodegenerative disease—Alzheimer’s disease and Parkinson’s. In conclusion, studying the aging process should include all developmental, circumstantial, and individual aspects of aging. This offers opportunities to improve the health of elderly by using a wide range of skills and knowledge. Thus, further studies are necessary to elucidate what can be done do to improve the aging process and health of elderly in the future.",book:{id:"10935",title:"Mechanisms and Management of Senescence",coverURL:"https://cdn.intechopen.com/books/images_new/10935.jpg"},signatures:"Jelena Milić"},{id:"80326",title:"Anti-Senescence Therapy",slug:"anti-senescence-therapy",totalDownloads:103,totalDimensionsCites:0,doi:"10.5772/intechopen.101585",abstract:"The development of therapeutic strategies aimed at the aging process of cells has attracted increasing attention in recent decades due to the involvement of this process in the development of many chronic and age-related diseases. Interestingly, preclinical studies have shown the success of a number of anti-aging approaches in the treatment of a range of chronic diseases. These approaches are directed against aging processes such as oxidative stress, telomerase shortening, inflammation, and deficient autophagy. Many strategies has been shown to be effective in delaying aging, including antiaging strategies based on establishing healthy lifestyle habits and pharmacological interventions aimed at disrupting senescent cells and senescent-associated secretory phenotype. Caloric restriction and intermittent fasting were reported to activate autophagy and reduce inflammation. In turn, immune-based strategies, senolytic agents, and senomorphics mediate their effects either by eliminating senescent cells through inducing apoptosis or by disrupting pathways by which senescent cells mediate their detrimental effects. In addition, given the association of the decline in the regenerative potential of stem cells with aging, many experimental and clinical studies indicate the effectiveness of stem cell transplantation in preventing or slowing the progress of age-related diseases by enhancing the repairing mechanisms and the secretion of many growth factors and cytokines.",book:{id:"10935",title:"Mechanisms and Management of Senescence",coverURL:"https://cdn.intechopen.com/books/images_new/10935.jpg"},signatures:"Raghad Alshadidi"},{id:"79828",title:"Cellular Senescence in Bone",slug:"cellular-senescence-in-bone",totalDownloads:109,totalDimensionsCites:0,doi:"10.5772/intechopen.101803",abstract:"Senescence is an irreversible cell-cycle arrest process induced by environmental, genetic, and epigenetic factors. An accumulation of senescent cells in bone results in age-related disorders, and one of the common problems is osteoporosis. Deciphering the basic mechanisms contributing to the chronic ailments of aging may uncover new avenues for targeted treatment. This review focuses on the mechanisms and the most relevant research advancements in skeletal cellular senescence. To identify new options for the treatment or prevention of age-related chronic diseases, researchers have targeted hallmarks of aging, including telomere attrition, genomic instability, cellular senescence, and epigenetic alterations. First, this chapter provides an overview of the fundamentals of bone tissue, the causes of skeletal involution, and the role of cellular senescence in bone and bone diseases such as osteoporosis. Next, this review will discuss the utilization of pharmacological interventions in aging tissues and, more specifically, highlight the role of senescent cells to identify the most effective and safe strategies.",book:{id:"10935",title:"Mechanisms and Management of Senescence",coverURL:"https://cdn.intechopen.com/books/images_new/10935.jpg"},signatures:"Danielle Wang and Haitao Wang"},{id:"79668",title:"Identification of RNA Species That Bind to the hnRNP A1 in Normal and Senescent Human Fibroblasts",slug:"identification-of-rna-species-that-bind-to-the-hnrnp-a1-in-normal-and-senescent-human-fibroblasts",totalDownloads:74,totalDimensionsCites:0,doi:"10.5772/intechopen.101525",abstract:"hnRNP A1 is a member of the hnRNPs (heterogeneous nuclear ribonucleoproteins) family of proteins that play a central role in regulating genes responsible for cell proliferation, DNA repair, apoptosis, and telomere biogenesis. Previous studies have shown that hnRNPA1 had reduced protein levels and increased cytoplasmic accumulation in senescent human diploid fibroblasts. The consequence of reduced protein expression and altered cellular localization may account for the alterations in gene expression observed during senescence. There is limited information for gene targets of hnRNP A1 as well as its in vivo function. In these studies, we performed RNA co-immunoprecipitation experiments using hnRNP A1 as the target protein to identify potential mRNA species in ribonucleoprotein (RNP) complexes. Using this approach, we identified the human double minute 2 (HDM2) mRNA as a binding target for hnRNP A1 in young and senescent human diploid fibroblasts cells. It was also observed that alterations of hnRNP A1 expression modulate HDM2 mRNA levels in young IMR-90 cells. We also demonstrated that the levels of HDM2 mRNA increased with the downregulation of hnRNP A1 and decrease with the overexpression of hnRNP A1. Although we did not observe a significant decrease in HDM2 protein level, a concomitant increase in p53 protein level was detected with the overexpression of hnRNP A1. Our studies also show that hnRNP A1 directly interacts with HDM2 mRNA at a region corresponding to its 3′ UTR (untranslated region of a gene). The results from this study demonstrate that hnRNP A1 has a novel role in participating in the regulation of HDM2 gene expression.",book:{id:"10935",title:"Mechanisms and Management of Senescence",coverURL:"https://cdn.intechopen.com/books/images_new/10935.jpg"},signatures:"Heriberto Moran, Shanaz A. Ghandhi, Naoko Shimada and Karen Hubbard"},{id:"79295",title:"Genetic and Epigenetic Influences on Cutaneous Cellular Senescence",slug:"genetic-and-epigenetic-influences-on-cutaneous-cellular-senescence",totalDownloads:123,totalDimensionsCites:0,doi:"10.5772/intechopen.101152",abstract:"Skin is the largest human organ system, and its protective function is critical to survival. The epithelial, dermal, and subcutaneous compartments are heterogeneous mixtures of cell types, yet they all display age-related skin dysfunction through the accumulation of an altered phenotypic cellular state called senescence. Cellular senescence is triggered by complex and dynamic genetic and epigenetic processes. A senescence steady state is achieved in different cell types under various and overlapping conditions of chronological age, toxic injury, oxidative stress, replicative exhaustion, DNA damage, metabolic dysfunction, and chromosomal structural changes. These inputs lead to outputs of cell-cycle withdrawal and the appearance of a senescence-associated secretory phenotype, both of which accumulate as tissue pathology observed clinically in aged skin. This review details the influence of genetic and epigenetic factors that converge on normal cutaneous cellular processes to create the senescent state, thereby dictating the response of the skin to the forces of both intrinsic and extrinsic aging. From this work, it is clear that no single biomarker or process leads to senescence, but that it is a convergence of factors resulting in an overt aging phenotype.",book:{id:"10935",title:"Mechanisms and Management of Senescence",coverURL:"https://cdn.intechopen.com/books/images_new/10935.jpg"},signatures:"Tapash Jay Sarkar, Maiko Hermsmeier, Jessica L. Ross and G. Scott Herron"}],onlineFirstChaptersTotal:6},preDownload:{success:null,errors:{}},subscriptionForm:{success:null,errors:{}},aboutIntechopen:{},privacyPolicy:{},peerReviewing:{},howOpenAccessPublishingWithIntechopenWorks:{},sponsorshipBooks:{sponsorshipBooks:[],offset:0,limit:8,total:null},allSeries:{pteSeriesList:[{id:"14",title:"Artificial Intelligence",numberOfPublishedBooks:9,numberOfPublishedChapters:89,numberOfOpenTopics:6,numberOfUpcomingTopics:0,issn:"2633-1403",doi:"10.5772/intechopen.79920",isOpenForSubmission:!0},{id:"7",title:"Biomedical Engineering",numberOfPublishedBooks:12,numberOfPublishedChapters:104,numberOfOpenTopics:3,numberOfUpcomingTopics:0,issn:"2631-5343",doi:"10.5772/intechopen.71985",isOpenForSubmission:!0}],lsSeriesList:[{id:"11",title:"Biochemistry",numberOfPublishedBooks:32,numberOfPublishedChapters:318,numberOfOpenTopics:4,numberOfUpcomingTopics:0,issn:"2632-0983",doi:"10.5772/intechopen.72877",isOpenForSubmission:!0},{id:"25",title:"Environmental Sciences",numberOfPublishedBooks:1,numberOfPublishedChapters:12,numberOfOpenTopics:4,numberOfUpcomingTopics:0,issn:"2754-6713",doi:"10.5772/intechopen.100362",isOpenForSubmission:!0},{id:"10",title:"Physiology",numberOfPublishedBooks:11,numberOfPublishedChapters:141,numberOfOpenTopics:4,numberOfUpcomingTopics:0,issn:"2631-8261",doi:"10.5772/intechopen.72796",isOpenForSubmission:!0}],hsSeriesList:[{id:"3",title:"Dentistry",numberOfPublishedBooks:8,numberOfPublishedChapters:129,numberOfOpenTopics:2,numberOfUpcomingTopics:0,issn:"2631-6218",doi:"10.5772/intechopen.71199",isOpenForSubmission:!0},{id:"6",title:"Infectious Diseases",numberOfPublishedBooks:13,numberOfPublishedChapters:113,numberOfOpenTopics:3,numberOfUpcomingTopics:1,issn:"2631-6188",doi:"10.5772/intechopen.71852",isOpenForSubmission:!0},{id:"13",title:"Veterinary Medicine and Science",numberOfPublishedBooks:11,numberOfPublishedChapters:106,numberOfOpenTopics:3,numberOfUpcomingTopics:0,issn:"2632-0517",doi:"10.5772/intechopen.73681",isOpenForSubmission:!0}],sshSeriesList:[{id:"22",title:"Business, Management and Economics",numberOfPublishedBooks:1,numberOfPublishedChapters:19,numberOfOpenTopics:3,numberOfUpcomingTopics:0,issn:"2753-894X",doi:"10.5772/intechopen.100359",isOpenForSubmission:!0},{id:"23",title:"Education and Human Development",numberOfPublishedBooks:0,numberOfPublishedChapters:5,numberOfOpenTopics:1,numberOfUpcomingTopics:1,issn:null,doi:"10.5772/intechopen.100360",isOpenForSubmission:!0},{id:"24",title:"Sustainable Development",numberOfPublishedBooks:0,numberOfPublishedChapters:15,numberOfOpenTopics:5,numberOfUpcomingTopics:0,issn:null,doi:"10.5772/intechopen.100361",isOpenForSubmission:!0}],testimonialsList:[{id:"6",text:"It is great to work with the IntechOpen to produce a worthwhile collection of research that also becomes a great educational resource and guide for future research endeavors.",author:{id:"259298",name:"Edward",surname:"Narayan",institutionString:null,profilePictureURL:"https://mts.intechopen.com/storage/users/259298/images/system/259298.jpeg",slug:"edward-narayan",institution:{id:"3",name:"University of Queensland",country:{id:null,name:"Australia"}}}},{id:"13",text:"The collaboration with and support of the technical staff of IntechOpen is fantastic. The whole process of submitting an article and editing of the submitted article goes extremely smooth and fast, the number of reads and downloads of chapters is high, and the contributions are also frequently cited.",author:{id:"55578",name:"Antonio",surname:"Jurado-Navas",institutionString:null,profilePictureURL:"https://s3.us-east-1.amazonaws.com/intech-files/0030O00002bRisIQAS/Profile_Picture_1626166543950",slug:"antonio-jurado-navas",institution:{id:"720",name:"University of Malaga",country:{id:null,name:"Spain"}}}}]},series:{item:{id:"13",title:"Veterinary Medicine and Science",doi:"10.5772/intechopen.73681",issn:"2632-0517",scope:"Paralleling similar advances in the medical field, astounding advances occurred in Veterinary Medicine and Science in recent decades. These advances have helped foster better support for animal health, more humane animal production, and a better understanding of the physiology of endangered species to improve the assisted reproductive technologies or the pathogenesis of certain diseases, where animals can be used as models for human diseases (like cancer, degenerative diseases or fertility), and even as a guarantee of public health. Bridging Human, Animal, and Environmental health, the holistic and integrative “One Health” concept intimately associates the developments within those fields, projecting its advancements into practice. This book series aims to tackle various animal-related medicine and sciences fields, providing thematic volumes consisting of high-quality significant research directed to researchers and postgraduates. It aims to give us a glimpse into the new accomplishments in the Veterinary Medicine and Science field. By addressing hot topics in veterinary sciences, we aim to gather authoritative texts within each issue of this series, providing in-depth overviews and analysis for graduates, academics, and practitioners and foreseeing a deeper understanding of the subject. Forthcoming texts, written and edited by experienced researchers from both industry and academia, will also discuss scientific challenges faced today in Veterinary Medicine and Science. In brief, we hope that books in this series will provide accessible references for those interested or working in this field and encourage learning in a range of different topics.",coverUrl:"https://cdn.intechopen.com/series/covers/13.jpg",latestPublicationDate:"June 29th, 2022",hasOnlineFirst:!0,numberOfPublishedBooks:11,editor:{id:"38652",title:"Prof.",name:"Rita",middleName:null,surname:"Payan-Carreira",slug:"rita-payan-carreira",fullName:"Rita Payan-Carreira",profilePictureURL:"https://s3.us-east-1.amazonaws.com/intech-files/0030O00002bRiFPQA0/Profile_Picture_1614601496313",biography:"Rita Payan Carreira earned her Veterinary Degree from the Faculty of Veterinary Medicine in Lisbon, Portugal, in 1985. She obtained her Ph.D. in Veterinary Sciences from the University of Trás-os-Montes e Alto Douro, Portugal. After almost 32 years of teaching at the University of Trás-os-Montes and Alto Douro, she recently moved to the University of Évora, Department of Veterinary Medicine, where she teaches in the field of Animal Reproduction and Clinics. Her primary research areas include the molecular markers of the endometrial cycle and the embryo–maternal interaction, including oxidative stress and the reproductive physiology and disorders of sexual development, besides the molecular determinants of male and female fertility. She often supervises students preparing their master's or doctoral theses. She is also a frequent referee for various journals.",institutionString:null,institution:{name:"University of Évora",institutionURL:null,country:{name:"Portugal"}}},editorTwo:null,editorThree:null},subseries:{paginationCount:3,paginationItems:[{id:"19",title:"Animal Science",coverUrl:"https://cdn.intechopen.com/series_topics/covers/19.jpg",isOpenForSubmission:!0,editor:{id:"259298",title:"Dr.",name:"Edward",middleName:null,surname:"Narayan",slug:"edward-narayan",fullName:"Edward Narayan",profilePictureURL:"https://mts.intechopen.com/storage/users/259298/images/system/259298.jpeg",biography:"Dr. Edward Narayan graduated with Ph.D. degree in Biology from the University of the South Pacific and pioneered non-invasive reproductive and stress endocrinology tools for amphibians - the novel development and validation of non-invasive enzyme immunoassays for the evaluation of reproductive hormonal cycle and stress hormone responses to environmental stressors. \nDr. Narayan leads the Stress Lab (Comparative Physiology and Endocrinology) at the University of Queensland. A dynamic career research platform which is based on the thematic areas of comparative vertebrate physiology, stress endocrinology, reproductive endocrinology, animal health and welfare, and conservation biology. \nEdward has supervised 40 research students and published over 60 peer reviewed research.",institutionString:null,institution:{name:"University of Queensland",institutionURL:null,country:{name:"Australia"}}},editorTwo:null,editorThree:null},{id:"20",title:"Animal Nutrition",coverUrl:"https://cdn.intechopen.com/series_topics/covers/20.jpg",isOpenForSubmission:!0,editor:{id:"175967",title:"Dr.",name:"Manuel",middleName:null,surname:"Gonzalez Ronquillo",slug:"manuel-gonzalez-ronquillo",fullName:"Manuel Gonzalez Ronquillo",profilePictureURL:"https://mts.intechopen.com/storage/users/175967/images/system/175967.png",biography:"Dr. Manuel González Ronquillo obtained his doctorate degree from the University of Zaragoza, Spain, in 2001. He is a research professor at the Faculty of Veterinary Medicine and Animal Husbandry, Autonomous University of the State of Mexico. He is also a level-2 researcher. He received a Fulbright-Garcia Robles fellowship for a postdoctoral stay at the US Dairy Forage Research Center, Madison, Wisconsin, USA in 2008–2009. He received grants from Alianza del Pacifico for a stay at the University of Magallanes, Chile, in 2014, and from Consejo Nacional de Ciencia y Tecnología (CONACyT) to work in the Food and Agriculture Organization’s Animal Production and Health Division (AGA), Rome, Italy, in 2014–2015. He has collaborated with researchers from different countries and published ninety-eight journal articles. He teaches various degree courses in zootechnics, sheep production, and agricultural sciences and natural resources.\n\nDr. Ronquillo’s research focuses on the evaluation of sustainable animal diets (StAnD), using native resources of the region, decreasing carbon footprint, and applying meta-analysis and mathematical models for a better understanding of animal production.",institutionString:null,institution:{name:"Universidad Autónoma del Estado de México",institutionURL:null,country:{name:"Mexico"}}},editorTwo:null,editorThree:null},{id:"28",title:"Animal Reproductive Biology and Technology",coverUrl:"https://cdn.intechopen.com/series_topics/covers/28.jpg",isOpenForSubmission:!0,editor:{id:"177225",title:"Prof.",name:"Rosa Maria Lino Neto",middleName:null,surname:"Pereira",slug:"rosa-maria-lino-neto-pereira",fullName:"Rosa Maria Lino Neto Pereira",profilePictureURL:"https://s3.us-east-1.amazonaws.com/intech-files/0030O00002bS9wkQAC/Profile_Picture_1624519982291",biography:"Rosa Maria Lino Neto Pereira (DVM, MsC, PhD and) is currently a researcher at the Genetic Resources and Biotechnology Unit of the National Institute of Agrarian and Veterinarian Research (INIAV, Portugal). She is the head of the Reproduction and Embryology Laboratories and was lecturer of Reproduction and Reproductive Biotechnologies at Veterinary Medicine Faculty. She has over 25 years of experience working in reproductive biology and biotechnology areas with a special emphasis on embryo and gamete cryopreservation, for research and animal genetic resources conservation, leading research projects with several peer-reviewed papers. Rosa Pereira is member of the ERFP-FAO Ex situ Working Group and of the Management Commission of the Portuguese Animal Germplasm Bank.",institutionString:"The National Institute for Agricultural and Veterinary Research. Portugal",institution:null},editorTwo:null,editorThree:null}]},overviewPageOFChapters:{paginationCount:14,paginationItems:[{id:"82457",title:"Canine Hearing Management",doi:"10.5772/intechopen.105515",signatures:"Peter M. Skip Scheifele, Devan Marshall, Stephen Lee, Paul Reid, Thomas McCreery and David Byrne",slug:"canine-hearing-management",totalDownloads:1,totalCrossrefCites:0,totalDimensionsCites:0,authors:null,book:{title:"Recent Advances in Canine Medicine",coverURL:"https://cdn.intechopen.com/books/images_new/11580.jpg",subseries:{id:"19",title:"Animal Science"}}},{id:"82285",title:"Parvovirus Vectors: The Future of Gene Therapy",doi:"10.5772/intechopen.105085",signatures:"Megha Gupta",slug:"parvovirus-vectors-the-future-of-gene-therapy",totalDownloads:5,totalCrossrefCites:0,totalDimensionsCites:0,authors:null,book:{title:"Recent Advances in Canine Medicine",coverURL:"https://cdn.intechopen.com/books/images_new/11580.jpg",subseries:{id:"19",title:"Animal Science"}}},{id:"81793",title:"Canine parvovirus-2: An Emerging Threat to Young Pets",doi:"10.5772/intechopen.104846",signatures:"Mithilesh Singh, Rajendran Manikandan, Ujjwal Kumar De, Vishal Chander, Babul Rudra Paul, Saravanan Ramakrishnan and Darshini Maramreddy",slug:"canine-parvovirus-2-an-emerging-threat-to-young-pets",totalDownloads:17,totalCrossrefCites:0,totalDimensionsCites:0,authors:null,book:{title:"Recent Advances in Canine Medicine",coverURL:"https://cdn.intechopen.com/books/images_new/11580.jpg",subseries:{id:"19",title:"Animal Science"}}},{id:"81271",title:"The Diversity of Parvovirus Telomeres",doi:"10.5772/intechopen.102684",signatures:"Marianne Laugel, Emilie Lecomte, Eduard Ayuso, Oumeya Adjali, Mathieu Mével and Magalie Penaud-Budloo",slug:"the-diversity-of-parvovirus-telomeres",totalDownloads:38,totalCrossrefCites:0,totalDimensionsCites:0,authors:null,book:{title:"Recent Advances in Canine Medicine",coverURL:"https://cdn.intechopen.com/books/images_new/11580.jpg",subseries:{id:"19",title:"Animal Science"}}}]},overviewPagePublishedBooks:{paginationCount:11,paginationItems:[{type:"book",id:"7233",title:"New Insights into Theriogenology",subtitle:null,coverURL:"https://cdn.intechopen.com/books/images_new/7233.jpg",slug:"new-insights-into-theriogenology",publishedDate:"December 5th 2018",editedByType:"Edited by",bookSignature:"Rita Payan-Carreira",hash:"74f4147e3fb214dd050e5edd3aaf53bc",volumeInSeries:1,fullTitle:"New Insights into Theriogenology",editors:[{id:"38652",title:"Prof.",name:"Rita",middleName:null,surname:"Payan-Carreira",slug:"rita-payan-carreira",fullName:"Rita Payan-Carreira",profilePictureURL:"https://s3.us-east-1.amazonaws.com/intech-files/0030O00002bRiFPQA0/Profile_Picture_1614601496313",biography:"Rita Payan Carreira earned her Veterinary Degree from the Faculty of Veterinary Medicine in Lisbon, Portugal, in 1985. She obtained her Ph.D. in Veterinary Sciences from the University of Trás-os-Montes e Alto Douro, Portugal. After almost 32 years of teaching at the University of Trás-os-Montes and Alto Douro, she recently moved to the University of Évora, Department of Veterinary Medicine, where she teaches in the field of Animal Reproduction and Clinics. Her primary research areas include the molecular markers of the endometrial cycle and the embryo–maternal interaction, including oxidative stress and the reproductive physiology and disorders of sexual development, besides the molecular determinants of male and female fertility. She often supervises students preparing their master's or doctoral theses. She is also a frequent referee for various journals.",institutionString:null,institution:{name:"University of Évora",institutionURL:null,country:{name:"Portugal"}}}]},{type:"book",id:"7144",title:"Veterinary Anatomy and Physiology",subtitle:null,coverURL:"https://cdn.intechopen.com/books/images_new/7144.jpg",slug:"veterinary-anatomy-and-physiology",publishedDate:"March 13th 2019",editedByType:"Edited by",bookSignature:"Catrin Sian Rutland and Valentina Kubale",hash:"75cdacb570e0e6d15a5f6e69640d87c9",volumeInSeries:2,fullTitle:"Veterinary Anatomy and Physiology",editors:[{id:"202192",title:"Dr.",name:"Catrin",middleName:null,surname:"Rutland",slug:"catrin-rutland",fullName:"Catrin Rutland",profilePictureURL:"https://mts.intechopen.com/storage/users/202192/images/system/202192.png",biography:"Catrin Rutland is an Associate Professor of Anatomy and Developmental Genetics at the University of Nottingham, UK. She obtained a BSc from the University of Derby, England, a master’s degree from Technische Universität München, Germany, and a Ph.D. from the University of Nottingham. She undertook a post-doctoral research fellowship in the School of Medicine before accepting tenure in Veterinary Medicine and Science. Dr. Rutland also obtained an MMedSci (Medical Education) and a Postgraduate Certificate in Higher Education (PGCHE). She is the author of more than sixty peer-reviewed journal articles, twelve books/book chapters, and more than 100 research abstracts in cardiovascular biology and oncology. She is a board member of the European Association of Veterinary Anatomists, Fellow of the Anatomical Society, and Senior Fellow of the Higher Education Academy. Dr. Rutland has also written popular science books for the public. https://orcid.org/0000-0002-2009-4898. www.nottingham.ac.uk/vet/people/catrin.rutland",institutionString:null,institution:{name:"University of Nottingham",institutionURL:null,country:{name:"United Kingdom"}}}]},{type:"book",id:"8524",title:"Lactation in Farm Animals",subtitle:"Biology, Physiological Basis, Nutritional Requirements, and Modelization",coverURL:"https://cdn.intechopen.com/books/images_new/8524.jpg",slug:"lactation-in-farm-animals-biology-physiological-basis-nutritional-requirements-and-modelization",publishedDate:"January 22nd 2020",editedByType:"Edited by",bookSignature:"Naceur M'Hamdi",hash:"2aa2a9a0ec13040bbf0455e34625504e",volumeInSeries:3,fullTitle:"Lactation in Farm Animals - Biology, Physiological Basis, Nutritional Requirements, and Modelization",editors:[{id:"73376",title:"Dr.",name:"Naceur",middleName:null,surname:"M'Hamdi",slug:"naceur-m'hamdi",fullName:"Naceur M'Hamdi",profilePictureURL:"https://mts.intechopen.com/storage/users/73376/images/system/73376.jpg",biography:"Naceur M’HAMDI is Associate Professor at the National Agronomic Institute of Tunisia, University of Carthage. He is also Member of the Laboratory of genetic, animal and feed resource and member of Animal science Department of INAT. He graduated from Higher School of Agriculture of Mateur, University of Carthage, in 2002 and completed his masters in 2006. Dr. M’HAMDI completed his PhD thesis in Genetic welfare indicators of dairy cattle at Higher Institute of Agronomy of Chott-Meriem, University of Sousse, in 2011. He worked as assistant Professor of Genetic, biostatistics and animal biotechnology at INAT since 2013.",institutionString:null,institution:null}]},{type:"book",id:"8460",title:"Reproductive Biology and Technology in Animals",subtitle:null,coverURL:"https://cdn.intechopen.com/books/images_new/8460.jpg",slug:"reproductive-biology-and-technology-in-animals",publishedDate:"April 15th 2020",editedByType:"Edited by",bookSignature:"Juan Carlos Gardón Poggi and Katy Satué Ambrojo",hash:"32ef5fe73998dd723d308225d756fa1e",volumeInSeries:4,fullTitle:"Reproductive Biology and Technology in Animals",editors:[{id:"251314",title:"Dr.",name:"Juan Carlos",middleName:null,surname:"Gardón",slug:"juan-carlos-gardon",fullName:"Juan Carlos Gardón",profilePictureURL:"https://mts.intechopen.com/storage/users/251314/images/system/251314.jpeg",biography:"Juan Carlos Gardón Poggi received University degree from the Faculty of Agrarian Science in Argentina, in 1983. Also he received Masters Degree and PhD from Córdoba University, Spain. He is currently a Professor at the Catholic University of Valencia San Vicente Mártir, at the Department of Medicine and Animal Surgery. He teaches diverse courses in the field of Animal Reproduction and he is the Director of the Veterinary Farm. He also participates in academic postgraduate activities at the Veterinary Faculty of Murcia University, Spain. His research areas include animal physiology, physiology and biotechnology of reproduction either in males or females, the study of gametes under in vitro conditions and the use of ultrasound as a complement to physiological studies and development of applied biotechnologies. Routinely, he supervises students preparing their doctoral, master thesis or final degree projects.",institutionString:"Catholic University of Valencia San Vicente Mártir, Spain",institution:null}]}]},openForSubmissionBooks:{paginationCount:3,paginationItems:[{id:"11578",title:"Antibiotics and Probiotics in Animal Food - Impact and Regulation",coverURL:"https://cdn.intechopen.com/books/images_new/11578.jpg",hash:"3731c009f474c6ed4293f348ca7b27ac",secondStepPassed:!0,currentStepOfPublishingProcess:3,submissionDeadline:"June 3rd 2022",isOpenForSubmission:!0,editors:[{id:"225390",title:"Dr.",name:"Asghar Ali",surname:"Kamboh",slug:"asghar-ali-kamboh",fullName:"Asghar Ali Kamboh"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null},{id:"12086",title:"Cattle Diseases - Molecular and Biochemical Approach",coverURL:"https://cdn.intechopen.com/books/images_new/12086.jpg",hash:"afdbf57e32d996556a94528c06623cf3",secondStepPassed:!1,currentStepOfPublishingProcess:2,submissionDeadline:"July 5th 2022",isOpenForSubmission:!0,editors:[{id:"219081",title:"Dr.",name:"Abdulsamed",surname:"Kükürt",slug:"abdulsamed-kukurt",fullName:"Abdulsamed Kükürt"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null},{id:"11579",title:"Animal Welfare - New Insights",coverURL:"https://cdn.intechopen.com/books/images_new/11579.jpg",hash:"12e4f41264cbe99028655e5463fa941a",secondStepPassed:!1,currentStepOfPublishingProcess:2,submissionDeadline:"July 8th 2022",isOpenForSubmission:!0,editors:[{id:"51520",title:"Dr.",name:"Shao-Wen",surname:"Hung",slug:"shao-wen-hung",fullName:"Shao-Wen Hung"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null}]},onlineFirstChapters:{paginationCount:14,paginationItems:[{id:"82457",title:"Canine Hearing Management",doi:"10.5772/intechopen.105515",signatures:"Peter M. Skip Scheifele, Devan Marshall, Stephen Lee, Paul Reid, Thomas McCreery and David Byrne",slug:"canine-hearing-management",totalDownloads:1,totalCrossrefCites:0,totalDimensionsCites:0,authors:null,book:{title:"Recent Advances in Canine Medicine",coverURL:"https://cdn.intechopen.com/books/images_new/11580.jpg",subseries:{id:"19",title:"Animal Science"}}},{id:"82285",title:"Parvovirus Vectors: The Future of Gene Therapy",doi:"10.5772/intechopen.105085",signatures:"Megha Gupta",slug:"parvovirus-vectors-the-future-of-gene-therapy",totalDownloads:5,totalCrossrefCites:0,totalDimensionsCites:0,authors:null,book:{title:"Recent Advances in Canine Medicine",coverURL:"https://cdn.intechopen.com/books/images_new/11580.jpg",subseries:{id:"19",title:"Animal Science"}}},{id:"81793",title:"Canine parvovirus-2: An Emerging Threat to Young Pets",doi:"10.5772/intechopen.104846",signatures:"Mithilesh Singh, Rajendran Manikandan, Ujjwal Kumar De, Vishal Chander, Babul Rudra Paul, Saravanan Ramakrishnan and Darshini Maramreddy",slug:"canine-parvovirus-2-an-emerging-threat-to-young-pets",totalDownloads:17,totalCrossrefCites:0,totalDimensionsCites:0,authors:null,book:{title:"Recent Advances in Canine Medicine",coverURL:"https://cdn.intechopen.com/books/images_new/11580.jpg",subseries:{id:"19",title:"Animal Science"}}},{id:"81271",title:"The Diversity of Parvovirus Telomeres",doi:"10.5772/intechopen.102684",signatures:"Marianne Laugel, Emilie Lecomte, Eduard Ayuso, Oumeya Adjali, Mathieu Mével and Magalie Penaud-Budloo",slug:"the-diversity-of-parvovirus-telomeres",totalDownloads:38,totalCrossrefCites:0,totalDimensionsCites:0,authors:null,book:{title:"Recent Advances in Canine Medicine",coverURL:"https://cdn.intechopen.com/books/images_new/11580.jpg",subseries:{id:"19",title:"Animal Science"}}},{id:"79209",title:"Virtual Physiology: A Tool for the 21st Century",doi:"10.5772/intechopen.99671",signatures:"Carmen Nóbrega, Maria Aires Pereira, Catarina Coelho, Isabel Brás, Ana Cristina Mega, Carla Santos, Fernando Esteves, Rita Cruz, Ana I. Faustino-Rocha, Paula A. Oliveira, João Mesquita and Helena Vala",slug:"virtual-physiology-a-tool-for-the-21st-century",totalDownloads:153,totalCrossrefCites:0,totalDimensionsCites:0,authors:null,book:{title:"Updates on Veterinary Anatomy and Physiology",coverURL:"https://cdn.intechopen.com/books/images_new/10665.jpg",subseries:{id:"19",title:"Animal Science"}}},{id:"78849",title:"Application of Vermicompost Fertilizer in Aquaculture Nutrition: Review",doi:"10.5772/intechopen.100326",signatures:"Sonnia Nzilani Musyoka and Rita Nairuti",slug:"application-of-vermicompost-fertilizer-in-aquaculture-nutrition-review",totalDownloads:71,totalCrossrefCites:0,totalDimensionsCites:0,authors:null,book:{title:"Animal Nutrition - Annual Volume 2022",coverURL:"https://cdn.intechopen.com/books/images_new/11416.jpg",subseries:{id:"20",title:"Animal Nutrition"}}},{id:"78543",title:"Pulmonary Vein: Embryology, Anatomy, Function and Disease",doi:"10.5772/intechopen.100051",signatures:"Chan I-Ping and Hsueh Tung",slug:"pulmonary-vein-embryology-anatomy-function-and-disease",totalDownloads:183,totalCrossrefCites:0,totalDimensionsCites:0,authors:null,book:{title:"Updates on Veterinary Anatomy and Physiology",coverURL:"https://cdn.intechopen.com/books/images_new/10665.jpg",subseries:{id:"19",title:"Animal Science"}}},{id:"78564",title:"Anatomy of the Rhesus Monkey (Macaca mulatta): The Essentials for the Biomedical Researcher",doi:"10.5772/intechopen.99067",signatures:"Christophe Casteleyn and Jaco Bakker",slug:"anatomy-of-the-rhesus-monkey-macaca-mulatta-the-essentials-for-the-biomedical-researcher",totalDownloads:349,totalCrossrefCites:0,totalDimensionsCites:0,authors:null,book:{title:"Updates on Veterinary Anatomy and Physiology",coverURL:"https://cdn.intechopen.com/books/images_new/10665.jpg",subseries:{id:"19",title:"Animal Science"}}},{id:"77999",title:"Bronchus-Associated Lymphoid Tissue (BALT) Histology and Its Role in Various Pathologies",doi:"10.5772/intechopen.99366",signatures:"Tuba Parlak Ak",slug:"bronchus-associated-lymphoid-tissue-balt-histology-and-its-role-in-various-pathologies",totalDownloads:212,totalCrossrefCites:0,totalDimensionsCites:0,authors:null,book:{title:"Updates on Veterinary Anatomy and Physiology",coverURL:"https://cdn.intechopen.com/books/images_new/10665.jpg",subseries:{id:"19",title:"Animal Science"}}},{id:"78242",title:"Genomic Instability and Cyto-Genotoxic Damage in Animal Species",doi:"10.5772/intechopen.99685",signatures:"María Evarista Arellano-García, Olivia Torres-Bugarín, Maritza Roxana García-García, Daniel García-Flores, Yanis Toledano-Magaña, Cinthya Sofia Sanabria-Mora, Sandra Castro-Gamboa and Juan Carlos García-Ramos",slug:"genomic-instability-and-cyto-genotoxic-damage-in-animal-species",totalDownloads:150,totalCrossrefCites:0,totalDimensionsCites:0,authors:null,book:{title:"Updates on Veterinary Anatomy and Physiology",coverURL:"https://cdn.intechopen.com/books/images_new/10665.jpg",subseries:{id:"19",title:"Animal Science"}}}]},subseriesFiltersForOFChapters:[{caption:"Animal Nutrition",value:20,count:1,group:"subseries"},{caption:"Animal Science",value:19,count:13,group:"subseries"}],publishedBooks:{paginationCount:9,paginationItems:[{type:"book",id:"10654",title:"Brain-Computer Interface",subtitle:null,coverURL:"https://cdn.intechopen.com/books/images_new/10654.jpg",slug:"brain-computer-interface",publishedDate:"May 18th 2022",editedByType:"Edited by",bookSignature:"Vahid Asadpour",hash:"a5308884068cc53ed31c6baba756857f",volumeInSeries:9,fullTitle:"Brain-Computer Interface",editors:[{id:"165328",title:"Dr.",name:"Vahid",middleName:null,surname:"Asadpour",slug:"vahid-asadpour",fullName:"Vahid Asadpour",profilePictureURL:"https://mts.intechopen.com/storage/users/165328/images/system/165328.jpg",institutionString:"Kaiser Permanente Southern California",institution:null}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null},{type:"book",id:"10859",title:"Data Mining",subtitle:"Concepts and Applications",coverURL:"https://cdn.intechopen.com/books/images_new/10859.jpg",slug:"data-mining-concepts-and-applications",publishedDate:"March 30th 2022",editedByType:"Edited by",bookSignature:"Ciza Thomas",hash:"63a4e514e537d3962cf53ef1c6b9d5eb",volumeInSeries:8,fullTitle:"Data Mining - Concepts and Applications",editors:[{id:"43680",title:"Prof.",name:"Ciza",middleName:null,surname:"Thomas",slug:"ciza-thomas",fullName:"Ciza Thomas",profilePictureURL:"https://mts.intechopen.com/storage/users/43680/images/system/43680.jpeg",institutionString:null,institution:{name:"Government of Kerala",institutionURL:null,country:{name:"India"}}}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null},{type:"book",id:"10651",title:"Machine Learning",subtitle:"Algorithms, Models and Applications",coverURL:"https://cdn.intechopen.com/books/images_new/10651.jpg",slug:"machine-learning-algorithms-models-and-applications",publishedDate:"December 22nd 2021",editedByType:"Edited by",bookSignature:"Jaydip Sen",hash:"6208156401c496e0a4ca5ff4265324cc",volumeInSeries:7,fullTitle:"Machine Learning - Algorithms, Models and Applications",editors:[{id:"4519",title:"Prof.",name:"Jaydip",middleName:null,surname:"Sen",slug:"jaydip-sen",fullName:"Jaydip Sen",profilePictureURL:"https://mts.intechopen.com/storage/users/4519/images/system/4519.jpeg",institutionString:"Praxis Business School",institution:null}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null},{type:"book",id:"9869",title:"Self-Driving Vehicles and Enabling Technologies",subtitle:null,coverURL:"https://cdn.intechopen.com/books/images_new/9869.jpg",slug:"self-driving-vehicles-and-enabling-technologies",publishedDate:"September 22nd 2021",editedByType:"Edited by",bookSignature:"Marian Găiceanu",hash:"fd451ca2e4785ef098e04b7d695a18d9",volumeInSeries:6,fullTitle:"Self-Driving Vehicles and Enabling Technologies",editors:[{id:"169608",title:"Prof.",name:"Marian",middleName:null,surname:"Găiceanu",slug:"marian-gaiceanu",fullName:"Marian Găiceanu",profilePictureURL:"https://mts.intechopen.com/storage/users/169608/images/system/169608.png",institutionString:'"Dunarea de Jos" University of Galati',institution:{name:'"Dunarea de Jos" University of Galati',institutionURL:null,country:{name:"Romania"}}}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null},{type:"book",id:"9958",title:"Artificial Intelligence",subtitle:"Latest Advances, New Paradigms and Novel Applications",coverURL:"https://cdn.intechopen.com/books/images_new/9958.jpg",slug:"artificial-intelligence-latest-advances-new-paradigms-and-novel-applications",publishedDate:"September 1st 2021",editedByType:"Edited by",bookSignature:"Eneko Osaba, Esther Villar, Jesús L. Lobo and Ibai Laña",hash:"39648fbfdaa11385097d62b1f13aad54",volumeInSeries:5,fullTitle:"Artificial Intelligence - Latest Advances, New Paradigms and Novel Applications",editors:[{id:"221364",title:"Dr.",name:"Eneko",middleName:null,surname:"Osaba",slug:"eneko-osaba",fullName:"Eneko Osaba",profilePictureURL:"https://mts.intechopen.com/storage/users/221364/images/system/221364.jpg",institutionString:"TECNALIA Research & Innovation",institution:{name:"Tecnalia",institutionURL:null,country:{name:"Spain"}}}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null},{type:"book",id:"9963",title:"Advances and Applications in Deep Learning",subtitle:null,coverURL:"https://cdn.intechopen.com/books/images_new/9963.jpg",slug:"advances-and-applications-in-deep-learning",publishedDate:"December 9th 2020",editedByType:"Edited by",bookSignature:"Marco Antonio Aceves-Fernandez",hash:"0d51ba46f22e55cb89140f60d86a071e",volumeInSeries:4,fullTitle:"Advances and Applications in Deep Learning",editors:[{id:"24555",title:"Dr.",name:"Marco Antonio",middleName:null,surname:"Aceves Fernandez",slug:"marco-antonio-aceves-fernandez",fullName:"Marco Antonio Aceves Fernandez",profilePictureURL:"https://mts.intechopen.com/storage/users/24555/images/system/24555.jpg",institutionString:"Universidad Autonoma de Queretaro",institution:{name:"Autonomous University of Queretaro",institutionURL:null,country:{name:"Mexico"}}}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null},{type:"book",id:"7656",title:"Fuzzy Logic",subtitle:null,coverURL:"https://cdn.intechopen.com/books/images_new/7656.jpg",slug:"fuzzy-logic",publishedDate:"February 5th 2020",editedByType:"Edited by",bookSignature:"Constantin Volosencu",hash:"54f092d4ffe0abf5e4172a80025019bc",volumeInSeries:3,fullTitle:"Fuzzy Logic",editors:[{id:"1063",title:"Prof.",name:"Constantin",middleName:null,surname:"Volosencu",slug:"constantin-volosencu",fullName:"Constantin Volosencu",profilePictureURL:"https://mts.intechopen.com/storage/users/1063/images/system/1063.png",institutionString:"Polytechnic University of Timişoara",institution:{name:"Polytechnic University of Timişoara",institutionURL:null,country:{name:"Romania"}}}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null},{type:"book",id:"7726",title:"Swarm Intelligence",subtitle:"Recent Advances, New Perspectives and Applications",coverURL:"https://cdn.intechopen.com/books/images_new/7726.jpg",slug:"swarm-intelligence-recent-advances-new-perspectives-and-applications",publishedDate:"December 4th 2019",editedByType:"Edited by",bookSignature:"Javier Del Ser, Esther Villar and Eneko Osaba",hash:"e7ea7e74ce7a7a8e5359629e07c68d31",volumeInSeries:2,fullTitle:"Swarm Intelligence - Recent Advances, New Perspectives and Applications",editors:[{id:"49813",title:"Dr.",name:"Javier",middleName:null,surname:"Del Ser",slug:"javier-del-ser",fullName:"Javier Del Ser",profilePictureURL:"https://mts.intechopen.com/storage/users/49813/images/system/49813.png",institutionString:"Tecnalia Research & Innovation",institution:null}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null},{type:"book",id:"7723",title:"Artificial Intelligence",subtitle:"Applications in Medicine and Biology",coverURL:"https://cdn.intechopen.com/books/images_new/7723.jpg",slug:"artificial-intelligence-applications-in-medicine-and-biology",publishedDate:"July 31st 2019",editedByType:"Edited by",bookSignature:"Marco Antonio Aceves-Fernandez",hash:"a3852659e727f95c98c740ed98146011",volumeInSeries:1,fullTitle:"Artificial Intelligence - Applications in Medicine and Biology",editors:[{id:"24555",title:"Dr.",name:"Marco Antonio",middleName:null,surname:"Aceves Fernandez",slug:"marco-antonio-aceves-fernandez",fullName:"Marco Antonio Aceves Fernandez",profilePictureURL:"https://mts.intechopen.com/storage/users/24555/images/system/24555.jpg",institutionString:"Universidad Autonoma de Queretaro",institution:{name:"Autonomous University of Queretaro",institutionURL:null,country:{name:"Mexico"}}}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null}]},subseriesFiltersForPublishedBooks:[{group:"subseries",caption:"Computational Neuroscience",value:23,count:1},{group:"subseries",caption:"Evolutionary Computation",value:25,count:1},{group:"subseries",caption:"Machine Learning and Data Mining",value:26,count:3},{group:"subseries",caption:"Applied Intelligence",value:22,count:4}],publicationYearFilters:[{group:"publicationYear",caption:"2022",value:2022,count:2},{group:"publicationYear",caption:"2021",value:2021,count:3},{group:"publicationYear",caption:"2020",value:2020,count:2},{group:"publicationYear",caption:"2019",value:2019,count:2}],authors:{paginationCount:0,paginationItems:[]}},subseries:{item:{id:"10",type:"subseries",title:"Animal Physiology",keywords:"Physiology, Comparative, Evolution, Biomolecules, Organ, Homeostasis, Anatomy, Pathology, Medical, Cell Division, Cell Signaling, Cell Growth, Cell Metabolism, Endocrine, Neuroscience, Cardiovascular, Development, Aging, Development",scope:"Physiology, the scientific study of functions and mechanisms of living systems, is an essential area of research in its own right, but also in relation to medicine and health sciences. The scope of this topic will range from molecular, biochemical, cellular, and physiological processes in all animal species. Work pertaining to the whole organism, organ systems, individual organs and tissues, cells, and biomolecules will be included. Medical, animal, cell, and comparative physiology and allied fields such as anatomy, histology, and pathology with physiology links will be covered in this topic. Physiology research may be linked to development, aging, environment, regular and pathological processes, adaptation and evolution, exercise, or several other factors affecting, or involved with, animal physiology.",coverUrl:"https://cdn.intechopen.com/series_topics/covers/10.jpg",hasOnlineFirst:!1,hasPublishedBooks:!1,annualVolume:11406,editor:{id:"202192",title:"Dr.",name:"Catrin",middleName:null,surname:"Rutland",slug:"catrin-rutland",fullName:"Catrin Rutland",profilePictureURL:"https://mts.intechopen.com/storage/users/202192/images/system/202192.png",biography:"Catrin Rutland is an Associate Professor of Anatomy and Developmental Genetics at the University of Nottingham, UK. She obtained a BSc from the University of Derby, England, a master’s degree from Technische Universität München, Germany, and a Ph.D. from the University of Nottingham. She undertook a post-doctoral research fellowship in the School of Medicine before accepting tenure in Veterinary Medicine and Science. Dr. Rutland also obtained an MMedSci (Medical Education) and a Postgraduate Certificate in Higher Education (PGCHE). She is the author of more than sixty peer-reviewed journal articles, twelve books/book chapters, and more than 100 research abstracts in cardiovascular biology and oncology. She is a board member of the European Association of Veterinary Anatomists, Fellow of the Anatomical Society, and Senior Fellow of the Higher Education Academy. Dr. Rutland has also written popular science books for the public. https://orcid.org/0000-0002-2009-4898. www.nottingham.ac.uk/vet/people/catrin.rutland",institutionString:null,institution:{name:"University of Nottingham",institutionURL:null,country:{name:"United Kingdom"}}},editorTwo:null,editorThree:null,series:{id:"10",title:"Physiology",doi:"10.5772/intechopen.72796",issn:"2631-8261"},editorialBoard:[{id:"306970",title:"Mr.",name:"Amin",middleName:null,surname:"Tamadon",slug:"amin-tamadon",fullName:"Amin Tamadon",profilePictureURL:"https://s3.us-east-1.amazonaws.com/intech-files/0030O00002oHR5wQAG/Profile_Picture_1623910304139",institutionString:null,institution:{name:"Bushehr University of Medical Sciences",institutionURL:null,country:{name:"Iran"}}},{id:"251314",title:"Dr.",name:"Juan Carlos",middleName:null,surname:"Gardón",slug:"juan-carlos-gardon",fullName:"Juan Carlos Gardón",profilePictureURL:"https://mts.intechopen.com/storage/users/251314/images/system/251314.jpeg",institutionString:"Catholic University of Valencia San Vicente Mártir, Spain",institution:null},{id:"245306",title:"Dr.",name:"María Luz",middleName:null,surname:"Garcia Pardo",slug:"maria-luz-garcia-pardo",fullName:"María Luz Garcia Pardo",profilePictureURL:"https://mts.intechopen.com/storage/users/245306/images/system/245306.png",institutionString:null,institution:{name:"Miguel Hernandez University",institutionURL:null,country:{name:"Spain"}}},{id:"283315",title:"Prof.",name:"Samir",middleName:null,surname:"El-Gendy",slug:"samir-el-gendy",fullName:"Samir El-Gendy",profilePictureURL:"https://s3.us-east-1.amazonaws.com/intech-files/0030O00002bRduYQAS/Profile_Picture_1606215849748",institutionString:null,institution:{name:"Alexandria University",institutionURL:null,country:{name:"Egypt"}}},{id:"178366",title:"Dr.",name:"Volkan",middleName:null,surname:"Gelen",slug:"volkan-gelen",fullName:"Volkan Gelen",profilePictureURL:"https://mts.intechopen.com/storage/users/178366/images/system/178366.jpg",institutionString:"Kafkas University",institution:{name:"Kafkas University",institutionURL:null,country:{name:"Turkey"}}}]},onlineFirstChapters:{paginationCount:13,paginationItems:[{id:"82457",title:"Canine Hearing Management",doi:"10.5772/intechopen.105515",signatures:"Peter M. Skip Scheifele, Devan Marshall, Stephen Lee, Paul Reid, Thomas McCreery and David Byrne",slug:"canine-hearing-management",totalDownloads:1,totalCrossrefCites:0,totalDimensionsCites:0,authors:null,book:{title:"Recent Advances in Canine Medicine",coverURL:"https://cdn.intechopen.com/books/images_new/11580.jpg",subseries:{id:"19",title:"Animal Science"}}},{id:"82285",title:"Parvovirus Vectors: The Future of Gene Therapy",doi:"10.5772/intechopen.105085",signatures:"Megha Gupta",slug:"parvovirus-vectors-the-future-of-gene-therapy",totalDownloads:5,totalCrossrefCites:0,totalDimensionsCites:0,authors:null,book:{title:"Recent Advances in Canine Medicine",coverURL:"https://cdn.intechopen.com/books/images_new/11580.jpg",subseries:{id:"19",title:"Animal Science"}}},{id:"81793",title:"Canine parvovirus-2: An Emerging Threat to Young Pets",doi:"10.5772/intechopen.104846",signatures:"Mithilesh Singh, Rajendran Manikandan, Ujjwal Kumar De, Vishal Chander, Babul Rudra Paul, Saravanan Ramakrishnan and Darshini Maramreddy",slug:"canine-parvovirus-2-an-emerging-threat-to-young-pets",totalDownloads:17,totalCrossrefCites:0,totalDimensionsCites:0,authors:null,book:{title:"Recent Advances in Canine Medicine",coverURL:"https://cdn.intechopen.com/books/images_new/11580.jpg",subseries:{id:"19",title:"Animal Science"}}},{id:"81271",title:"The Diversity of Parvovirus Telomeres",doi:"10.5772/intechopen.102684",signatures:"Marianne Laugel, Emilie Lecomte, Eduard Ayuso, Oumeya Adjali, Mathieu Mével and Magalie Penaud-Budloo",slug:"the-diversity-of-parvovirus-telomeres",totalDownloads:38,totalCrossrefCites:0,totalDimensionsCites:0,authors:null,book:{title:"Recent Advances in Canine Medicine",coverURL:"https://cdn.intechopen.com/books/images_new/11580.jpg",subseries:{id:"19",title:"Animal Science"}}},{id:"79209",title:"Virtual Physiology: A Tool for the 21st Century",doi:"10.5772/intechopen.99671",signatures:"Carmen Nóbrega, Maria Aires Pereira, Catarina Coelho, Isabel Brás, Ana Cristina Mega, Carla Santos, Fernando Esteves, Rita Cruz, Ana I. Faustino-Rocha, Paula A. Oliveira, João Mesquita and Helena Vala",slug:"virtual-physiology-a-tool-for-the-21st-century",totalDownloads:153,totalCrossrefCites:0,totalDimensionsCites:0,authors:null,book:{title:"Updates on Veterinary Anatomy and Physiology",coverURL:"https://cdn.intechopen.com/books/images_new/10665.jpg",subseries:{id:"19",title:"Animal Science"}}},{id:"78543",title:"Pulmonary Vein: Embryology, Anatomy, Function and Disease",doi:"10.5772/intechopen.100051",signatures:"Chan I-Ping and Hsueh Tung",slug:"pulmonary-vein-embryology-anatomy-function-and-disease",totalDownloads:183,totalCrossrefCites:0,totalDimensionsCites:0,authors:null,book:{title:"Updates on Veterinary Anatomy and Physiology",coverURL:"https://cdn.intechopen.com/books/images_new/10665.jpg",subseries:{id:"19",title:"Animal Science"}}},{id:"78564",title:"Anatomy of the Rhesus Monkey (Macaca mulatta): The Essentials for the Biomedical Researcher",doi:"10.5772/intechopen.99067",signatures:"Christophe Casteleyn and Jaco Bakker",slug:"anatomy-of-the-rhesus-monkey-macaca-mulatta-the-essentials-for-the-biomedical-researcher",totalDownloads:349,totalCrossrefCites:0,totalDimensionsCites:0,authors:null,book:{title:"Updates on Veterinary Anatomy and Physiology",coverURL:"https://cdn.intechopen.com/books/images_new/10665.jpg",subseries:{id:"19",title:"Animal Science"}}},{id:"77999",title:"Bronchus-Associated Lymphoid Tissue (BALT) Histology and Its Role in Various Pathologies",doi:"10.5772/intechopen.99366",signatures:"Tuba Parlak Ak",slug:"bronchus-associated-lymphoid-tissue-balt-histology-and-its-role-in-various-pathologies",totalDownloads:212,totalCrossrefCites:0,totalDimensionsCites:0,authors:null,book:{title:"Updates on Veterinary Anatomy and Physiology",coverURL:"https://cdn.intechopen.com/books/images_new/10665.jpg",subseries:{id:"19",title:"Animal Science"}}},{id:"78242",title:"Genomic Instability and Cyto-Genotoxic Damage in Animal Species",doi:"10.5772/intechopen.99685",signatures:"María Evarista Arellano-García, Olivia Torres-Bugarín, Maritza Roxana García-García, Daniel García-Flores, Yanis Toledano-Magaña, Cinthya Sofia Sanabria-Mora, Sandra Castro-Gamboa and Juan Carlos García-Ramos",slug:"genomic-instability-and-cyto-genotoxic-damage-in-animal-species",totalDownloads:150,totalCrossrefCites:0,totalDimensionsCites:0,authors:null,book:{title:"Updates on Veterinary Anatomy and Physiology",coverURL:"https://cdn.intechopen.com/books/images_new/10665.jpg",subseries:{id:"19",title:"Animal Science"}}},{id:"78503",title:"Biomechanics of the Canine Elbow Joint",doi:"10.5772/intechopen.99569",signatures:"Thomas Rohwedder",slug:"biomechanics-of-the-canine-elbow-joint",totalDownloads:180,totalCrossrefCites:0,totalDimensionsCites:0,authors:null,book:{title:"Updates on Veterinary Anatomy and Physiology",coverURL:"https://cdn.intechopen.com/books/images_new/10665.jpg",subseries:{id:"19",title:"Animal Science"}}},{id:"78018",title:"Application of Noble Metals in the Advances in Animal Disease Diagnostics",doi:"10.5772/intechopen.99162",signatures:"Gabriel Alexis S.P. Tubalinal, Leonard Paulo G. Lucero, Jim Andreus V. Mangahas, Marvin A. Villanueva and Claro N. Mingala",slug:"application-of-noble-metals-in-the-advances-in-animal-disease-diagnostics",totalDownloads:111,totalCrossrefCites:0,totalDimensionsCites:0,authors:null,book:{title:"Updates on Veterinary Anatomy and Physiology",coverURL:"https://cdn.intechopen.com/books/images_new/10665.jpg",subseries:{id:"19",title:"Animal Science"}}},{id:"77455",title:"Marek’s Disease Is a Threat for Large Scale Poultry Production",doi:"10.5772/intechopen.98939",signatures:"Wojciech Kozdruń, Jowita Samanta Niczyporuk and Natalia Styś-Fijoł",slug:"marek-s-disease-is-a-threat-for-large-scale-poultry-production",totalDownloads:261,totalCrossrefCites:0,totalDimensionsCites:0,authors:null,book:{title:"Updates on Veterinary Anatomy and Physiology",coverURL:"https://cdn.intechopen.com/books/images_new/10665.jpg",subseries:{id:"19",title:"Animal Science"}}},{id:"74655",title:"Taxon-Specific Pair Bonding in Gibbons (Hylobatidae)",doi:"10.5772/intechopen.95270",signatures:"Thomas Geissmann, Simone Rosenkranz-Weck, Judith J.G.M. Van Der Loo and Mathias Orgeldinger",slug:"taxon-specific-pair-bonding-in-gibbons-hylobatidae",totalDownloads:396,totalCrossrefCites:0,totalDimensionsCites:0,authors:null,book:{title:"Updates on Veterinary Anatomy and Physiology",coverURL:"https://cdn.intechopen.com/books/images_new/10665.jpg",subseries:{id:"19",title:"Animal Science"}}}]},publishedBooks:{paginationCount:13,paginationItems:[{type:"book",id:"10798",title:"Starch",subtitle:"Evolution and Recent Advances",coverURL:"https://cdn.intechopen.com/books/images_new/10798.jpg",slug:"starch-evolution-and-recent-advances",publishedDate:"June 28th 2022",editedByType:"Edited by",bookSignature:"Martins Ochubiojo Emeje",hash:"f197f6062c1574a9a90e50a369271bcf",volumeInSeries:33,fullTitle:"Starch - Evolution and Recent Advances",editors:[{id:"94311",title:"Prof.",name:"Martins",middleName:"Ochubiojo",surname:"Ochubiojo Emeje",slug:"martins-ochubiojo-emeje",fullName:"Martins Ochubiojo Emeje",profilePictureURL:"https://mts.intechopen.com/storage/users/94311/images/system/94311.jpeg",institutionString:"National Institute for Pharmaceutical Research and Development",institution:{name:"National Institute for Pharmaceutical Research and Development",institutionURL:null,country:{name:"Nigeria"}}}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null},{type:"book",id:"11332",title:"Essential Oils",subtitle:"Advances in Extractions and Biological Applications",coverURL:"https://cdn.intechopen.com/books/images_new/11332.jpg",slug:"essential-oils-advances-in-extractions-and-biological-applications",publishedDate:"June 23rd 2022",editedByType:"Edited by",bookSignature:"Mozaniel Santana de Oliveira and Eloisa Helena de Aguiar Andrade",hash:"742e6cae3a35686f975edc8d7f9afa94",volumeInSeries:32,fullTitle:"Essential Oils - Advances in Extractions and Biological Applications",editors:[{id:"195290",title:"Ph.D.",name:"Mozaniel",middleName:null,surname:"Santana De Oliveira",slug:"mozaniel-santana-de-oliveira",fullName:"Mozaniel Santana De Oliveira",profilePictureURL:"https://mts.intechopen.com/storage/users/195290/images/system/195290.png",institutionString:"Museu Paraense Emílio Goeldi",institution:{name:"Museu Paraense Emílio Goeldi",institutionURL:null,country:{name:"Brazil"}}}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null},{type:"book",id:"10841",title:"Hydrolases",subtitle:null,coverURL:"https://cdn.intechopen.com/books/images_new/10841.jpg",slug:"hydrolases",publishedDate:"June 15th 2022",editedByType:"Edited by",bookSignature:"Sajjad Haider, Adnan Haider and Angel Catalá",hash:"4e868cde273d65a7ff54b1817d640629",volumeInSeries:29,fullTitle:"Hydrolases",editors:[{id:"110708",title:"Dr.",name:"Sajjad",middleName:null,surname:"Haider",slug:"sajjad-haider",fullName:"Sajjad Haider",profilePictureURL:"https://mts.intechopen.com/storage/users/110708/images/system/110708.png",institutionString:"King Saud University",institution:{name:"King Saud University",institutionURL:null,country:{name:"Saudi Arabia"}}}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null},{type:"book",id:"10799",title:"Phenolic Compounds",subtitle:"Chemistry, Synthesis, Diversity, Non-Conventional Industrial, Pharmaceutical and Therapeutic Applications",coverURL:"https://cdn.intechopen.com/books/images_new/10799.jpg",slug:"phenolic-compounds-chemistry-synthesis-diversity-non-conventional-industrial-pharmaceutical-and-therapeutic-applications",publishedDate:"February 23rd 2022",editedByType:"Edited by",bookSignature:"Farid A. Badria",hash:"339199f254d2987ef3167eef74fb8a38",volumeInSeries:26,fullTitle:"Phenolic Compounds - Chemistry, Synthesis, Diversity, Non-Conventional Industrial, Pharmaceutical and Therapeutic Applications",editors:[{id:"41865",title:"Prof.",name:"Farid A.",middleName:null,surname:"Badria",slug:"farid-a.-badria",fullName:"Farid A. Badria",profilePictureURL:"https://mts.intechopen.com/storage/users/41865/images/system/41865.jpg",institutionString:"Mansoura University",institution:{name:"Mansoura University",institutionURL:null,country:{name:"Egypt"}}}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null},{type:"book",id:"9753",title:"Terpenes and Terpenoids",subtitle:"Recent Advances",coverURL:"https://cdn.intechopen.com/books/images_new/9753.jpg",slug:"terpenes-and-terpenoids-recent-advances",publishedDate:"July 28th 2021",editedByType:"Edited by",bookSignature:"Shagufta Perveen and Areej Mohammad Al-Taweel",hash:"575689df13c78bf0e6c1be40804cd010",volumeInSeries:21,fullTitle:"Terpenes and Terpenoids - Recent Advances",editors:[{id:"192992",title:"Prof.",name:"Shagufta",middleName:null,surname:"Perveen",slug:"shagufta-perveen",fullName:"Shagufta Perveen",profilePictureURL:"https://mts.intechopen.com/storage/users/192992/images/system/192992.png",institutionString:"King Saud University",institution:{name:"King Saud University",institutionURL:null,country:{name:"Saudi Arabia"}}}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null},{type:"book",id:"9731",title:"Oxidoreductase",subtitle:null,coverURL:"https://cdn.intechopen.com/books/images_new/9731.jpg",slug:"oxidoreductase",publishedDate:"February 17th 2021",editedByType:"Edited by",bookSignature:"Mahmoud Ahmed Mansour",hash:"852e6f862c85fc3adecdbaf822e64e6e",volumeInSeries:19,fullTitle:"Oxidoreductase",editors:[{id:"224662",title:"Prof.",name:"Mahmoud Ahmed",middleName:null,surname:"Mansour",slug:"mahmoud-ahmed-mansour",fullName:"Mahmoud Ahmed Mansour",profilePictureURL:"https://mts.intechopen.com/storage/users/224662/images/system/224662.jpg",institutionString:"King Saud bin Abdulaziz University for Health Sciences",institution:{name:"King Saud bin Abdulaziz University for Health Sciences",institutionURL:null,country:{name:"Saudi Arabia"}}}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null},{type:"book",id:"8094",title:"Aflatoxin B1 Occurrence, Detection and Toxicological Effects",subtitle:null,coverURL:"https://cdn.intechopen.com/books/images_new/8094.jpg",slug:"aflatoxin-b1-occurrence-detection-and-toxicological-effects",publishedDate:"June 3rd 2020",editedByType:"Edited by",bookSignature:"Xi-Dai Long",hash:"44f4ad52d8a8cbb22ef3d505d6b18027",volumeInSeries:14,fullTitle:"Aflatoxin B1 Occurrence, Detection and Toxicological Effects",editors:[{id:"202142",title:"Prof.",name:"Xi-Dai",middleName:null,surname:"Long",slug:"xi-dai-long",fullName:"Xi-Dai Long",profilePictureURL:"https://mts.intechopen.com/storage/users/202142/images/system/202142.jpeg",institutionString:"Youjiang Medical University for Nationalities",institution:null}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null},{type:"book",id:"8004",title:"Nitrogen Fixation",subtitle:null,coverURL:"https://cdn.intechopen.com/books/images_new/8004.jpg",slug:"nitrogen-fixation",publishedDate:"April 8th 2020",editedByType:"Edited by",bookSignature:"Everlon Cid Rigobelo and Ademar Pereira Serra",hash:"02f39c8365ba155d1c520184c2f26976",volumeInSeries:11,fullTitle:"Nitrogen Fixation",editors:[{id:"39553",title:"Prof.",name:"Everlon",middleName:"Cid",surname:"Rigobelo",slug:"everlon-rigobelo",fullName:"Everlon Rigobelo",profilePictureURL:"https://mts.intechopen.com/storage/users/39553/images/system/39553.jpg",institutionString:"São Paulo State University",institution:{name:"Sao Paulo State University",institutionURL:null,country:{name:"Brazil"}}}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null},{type:"book",id:"8028",title:"Flavonoids",subtitle:"A Coloring Model for Cheering up Life",coverURL:"https://cdn.intechopen.com/books/images_new/8028.jpg",slug:"flavonoids-a-coloring-model-for-cheering-up-life",publishedDate:"March 11th 2020",editedByType:"Edited by",bookSignature:"Farid A. Badria and Anthony Ananga",hash:"6c33178a5c7d2b276d2c6af4255def64",volumeInSeries:10,fullTitle:"Flavonoids - A Coloring Model for Cheering up Life",editors:[{id:"41865",title:"Prof.",name:"Farid A.",middleName:null,surname:"Badria",slug:"farid-a.-badria",fullName:"Farid A. Badria",profilePictureURL:"https://mts.intechopen.com/storage/users/41865/images/system/41865.jpg",institutionString:"Mansoura University",institution:{name:"Mansoura University",institutionURL:null,country:{name:"Egypt"}}}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null},{type:"book",id:"8170",title:"Chemical Properties of Starch",subtitle:null,coverURL:"https://cdn.intechopen.com/books/images_new/8170.jpg",slug:"chemical-properties-of-starch",publishedDate:"March 11th 2020",editedByType:"Edited by",bookSignature:"Martins Emeje",hash:"0aedfdb374631bb3a33870c4ed16559a",volumeInSeries:9,fullTitle:"Chemical Properties of Starch",editors:[{id:"94311",title:"Prof.",name:"Martins",middleName:"Ochubiojo",surname:"Ochubiojo Emeje",slug:"martins-ochubiojo-emeje",fullName:"Martins Ochubiojo Emeje",profilePictureURL:"https://mts.intechopen.com/storage/users/94311/images/system/94311.jpeg",institutionString:"National Institute for Pharmaceutical Research and Development",institution:{name:"National Institute for Pharmaceutical Research and Development",institutionURL:null,country:{name:"Nigeria"}}}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null},{type:"book",id:"8019",title:"Alginates",subtitle:"Recent Uses of This Natural Polymer",coverURL:"https://cdn.intechopen.com/books/images_new/8019.jpg",slug:"alginates-recent-uses-of-this-natural-polymer",publishedDate:"February 5th 2020",editedByType:"Edited by",bookSignature:"Leonel Pereira",hash:"61ea5c1aef462684a3b2215631b7dbf2",volumeInSeries:7,fullTitle:"Alginates - Recent Uses of This Natural Polymer",editors:[{id:"279788",title:"Dr.",name:"Leonel",middleName:null,surname:"Pereira",slug:"leonel-pereira",fullName:"Leonel Pereira",profilePictureURL:"https://mts.intechopen.com/storage/users/279788/images/system/279788.jpg",institutionString:"University of Coimbra",institution:{name:"University of Coimbra",institutionURL:null,country:{name:"Portugal"}}}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null},{type:"book",id:"8504",title:"Pectins",subtitle:"Extraction, Purification, Characterization and Applications",coverURL:"https://cdn.intechopen.com/books/images_new/8504.jpg",slug:"pectins-extraction-purification-characterization-and-applications",publishedDate:"January 22nd 2020",editedByType:"Edited by",bookSignature:"Martin Masuelli",hash:"ff1acef627b277c575a10b3259dd331b",volumeInSeries:6,fullTitle:"Pectins - Extraction, Purification, Characterization and Applications",editors:[{id:"99994",title:"Dr.",name:"Martin",middleName:"Alberto",surname:"Masuelli",slug:"martin-masuelli",fullName:"Martin Masuelli",profilePictureURL:"https://mts.intechopen.com/storage/users/99994/images/system/99994.png",institutionString:"National University of San Luis",institution:{name:"National University of San Luis",institutionURL:null,country:{name:"Argentina"}}}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null}]},testimonialsList:[{id:"8",text:"I work with IntechOpen for a number of reasons: their professionalism, their mission in support of Open Access publishing, and the quality of their peer-reviewed publications, but also because they believe in equality.",author:{id:"202192",name:"Catrin",surname:"Rutland",institutionString:null,profilePictureURL:"https://mts.intechopen.com/storage/users/202192/images/system/202192.png",slug:"catrin-rutland",institution:{id:"134",name:"University of Nottingham",country:{id:null,name:"United Kingdom"}}}},{id:"27",text:"The opportunity to work with a prestigious publisher allows for the possibility to collaborate with more research groups interested in animal nutrition, leading to the development of new feeding strategies and food valuation while being more sustainable with the environment, allowing more readers to learn about the subject.",author:{id:"175967",name:"Manuel",surname:"Gonzalez Ronquillo",institutionString:null,profilePictureURL:"https://mts.intechopen.com/storage/users/175967/images/system/175967.png",slug:"manuel-gonzalez-ronquillo",institution:{id:"6221",name:"Universidad Autónoma del Estado de México",country:{id:null,name:"Mexico"}}}},{id:"18",text:"It was great publishing with IntechOpen, the process was straightforward and I had support all along.",author:{id:"71579",name:"Berend",surname:"Olivier",institutionString:"Utrecht University",profilePictureURL:"https://mts.intechopen.com/storage/users/71579/images/system/71579.png",slug:"berend-olivier",institution:{id:"253",name:"Utrecht University",country:{id:null,name:"Netherlands"}}}}]},submityourwork:{pteSeriesList:[],lsSeriesList:[],hsSeriesList:[],sshSeriesList:[],subseriesList:[],annualVolumeBook:{},thematicCollection:[],selectedSeries:null,selectedSubseries:null},seriesLanding:{item:null},libraryRecommendation:{success:null,errors:{},institutions:[]},route:{name:"profile.detail",path:"/profiles/80387",hash:"",query:{},params:{id:"80387"},fullPath:"/profiles/80387",meta:{},from:{name:null,path:"/",hash:"",query:{},params:{},fullPath:"/",meta:{}}}},function(){var e;(e=document.currentScript||document.scripts[document.scripts.length-1]).parentNode.removeChild(e)}()