Samples of the studied taxa of Asteraceae.
\\n\\n
Released this past November, the list is based on data collected from the Web of Science and highlights some of the world’s most influential scientific minds by naming the researchers whose publications over the previous decade have included a high number of Highly Cited Papers placing them among the top 1% most-cited.
\\n\\nWe wish to congratulate all of the researchers named and especially our authors on this amazing accomplishment! We are happy and proud to share in their success!
Note: Edited in March 2021
\\n"}]',published:!0,mainMedia:{caption:"Highly Cited",originalUrl:"/media/original/117"}},components:[{type:"htmlEditorComponent",content:'IntechOpen is proud to announce that 191 of our authors have made the Clarivate™ Highly Cited Researchers List for 2020, ranking them among the top 1% most-cited.
\n\nThroughout the years, the list has named a total of 261 IntechOpen authors as Highly Cited. Of those researchers, 69 have been featured on the list multiple times.
\n\n\n\nReleased this past November, the list is based on data collected from the Web of Science and highlights some of the world’s most influential scientific minds by naming the researchers whose publications over the previous decade have included a high number of Highly Cited Papers placing them among the top 1% most-cited.
\n\nWe wish to congratulate all of the researchers named and especially our authors on this amazing accomplishment! We are happy and proud to share in their success!
Note: Edited in March 2021
\n'}],latestNews:[{slug:"webinar-introduction-to-open-science-wednesday-18-may-1-pm-cest-20220518",title:"Webinar: Introduction to Open Science | Wednesday 18 May, 1 PM CEST"},{slug:"step-in-the-right-direction-intechopen-launches-a-portfolio-of-open-science-journals-20220414",title:"Step in the Right Direction: IntechOpen Launches a Portfolio of Open Science Journals"},{slug:"let-s-meet-at-london-book-fair-5-7-april-2022-olympia-london-20220321",title:"Let’s meet at London Book Fair, 5-7 April 2022, Olympia London"},{slug:"50-books-published-as-part-of-intechopen-and-knowledge-unlatched-ku-collaboration-20220316",title:"50 Books published as part of IntechOpen and Knowledge Unlatched (KU) Collaboration"},{slug:"intechopen-joins-the-united-nations-sustainable-development-goals-publishers-compact-20221702",title:"IntechOpen joins the United Nations Sustainable Development Goals Publishers Compact"},{slug:"intechopen-signs-exclusive-representation-agreement-with-lsr-libros-servicios-y-representaciones-s-a-de-c-v-20211123",title:"IntechOpen Signs Exclusive Representation Agreement with LSR Libros Servicios y Representaciones S.A. de C.V"},{slug:"intechopen-expands-partnership-with-research4life-20211110",title:"IntechOpen Expands Partnership with Research4Life"},{slug:"introducing-intechopen-book-series-a-new-publishing-format-for-oa-books-20210915",title:"Introducing IntechOpen Book Series - A New Publishing Format for OA Books"}]},book:{item:{type:"book",id:"9538",leadTitle:null,fullTitle:"Demographic Analysis - Selected Concepts, Tools, and Applications",title:"Demographic Analysis",subtitle:"Selected Concepts, Tools, and Applications",reviewType:"peer-reviewed",abstract:"Demographic Analysis - Selected Concepts, Tools, and Applications presents basic definitions, practical techniques, and methods, as well as examples of studies based on the usage of demographic analysis in various institutions and economic entities. The volume covers studies related to population distribution, urbanization, migration, population change and dynamics, aging, longevity, population theories, and population projections. It is an asset to academic and professional communities interested in advancing knowledge on diverse populations in various contexts such as public policies, public services, education, and labor markets. The book aims to help students of demography as well as practitioners of other fields of social sciences and people in government, business, and nonprofit organizations.",isbn:"978-1-83969-188-1",printIsbn:"978-1-83969-187-4",pdfIsbn:"978-1-83969-189-8",doi:"10.5772/intechopen.87333",price:119,priceEur:129,priceUsd:155,slug:"demographic-analysis-selected-concepts-tools-and-applications",numberOfPages:240,isOpenForSubmission:!1,isInWos:null,isInBkci:!1,hash:"f335c5d0a39e8631d8627546e14ce61f",bookSignature:"Andrzej Klimczuk",publishedDate:"November 3rd 2021",coverURL:"https://cdn.intechopen.com/books/images_new/9538.jpg",numberOfDownloads:2532,numberOfWosCitations:0,numberOfCrossrefCitations:1,numberOfCrossrefCitationsByBook:0,numberOfDimensionsCitations:2,numberOfDimensionsCitationsByBook:0,hasAltmetrics:1,numberOfTotalCitations:3,isAvailableForWebshopOrdering:!0,dateEndFirstStepPublish:"October 22nd 2020",dateEndSecondStepPublish:"December 1st 2020",dateEndThirdStepPublish:"January 30th 2021",dateEndFourthStepPublish:"April 20th 2021",dateEndFifthStepPublish:"June 19th 2021",currentStepOfPublishingProcess:5,indexedIn:"1,2,3,4,5,6",editedByType:"Edited by",kuFlag:!1,featuredMarkup:null,editors:[{id:"320017",title:"Ph.D.",name:"Andrzej",middleName:null,surname:"Klimczuk",slug:"andrzej-klimczuk",fullName:"Andrzej Klimczuk",profilePictureURL:"https://mts.intechopen.com/storage/users/320017/images/system/320017.jpg",biography:"Andrzej Klimczuk, Ph.D., is a sociologist, public policy expert, and assistant professor in the Department of Public Policy of the Collegium of Socio-Economics, SGH Warsaw School of Economics, Poland. He worked as an external expert for institutions such as the European Commission, Interreg CENTRAL EUROPE Programme, and Fondazione Cariplo. Dr. Klimczuk has authored many scientific papers in the fields of gerontology, labor economics, public management, and social policy. His recent monographs include Economic Foundations for Creative Ageing Policy, Generations, Intergenerational Relationships, Generational Policy, and Perspectives and Theories of Social Innovation for Ageing Population.",institutionString:"Warsaw School of Economics",position:null,outsideEditionCount:0,totalCites:0,totalAuthoredChapters:"1",totalChapterViews:"0",totalEditedBooks:"1",institution:{name:"Warsaw School of Economics",institutionURL:null,country:{name:"Poland"}}}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,coeditorOne:null,coeditorTwo:null,coeditorThree:null,coeditorFour:null,coeditorFive:null,topics:[{id:"281",title:"Sociology",slug:"sociology"}],chapters:[{id:"78906",title:"Introductory Chapter: Demographic Analysis",doi:"10.5772/intechopen.100503",slug:"introductory-chapter-demographic-analysis",totalDownloads:367,totalCrossrefCites:0,totalDimensionsCites:0,hasAltmetrics:0,abstract:null,signatures:"Andrzej Klimczuk",downloadPdfUrl:"/chapter/pdf-download/78906",previewPdfUrl:"/chapter/pdf-preview/78906",authors:[{id:"320017",title:"Ph.D.",name:"Andrzej",surname:"Klimczuk",slug:"andrzej-klimczuk",fullName:"Andrzej Klimczuk"}],corrections:null},{id:"75618",title:"Demographic Analysis and the Decomposition of Social Change",doi:"10.5772/intechopen.96350",slug:"demographic-analysis-and-the-decomposition-of-social-change",totalDownloads:330,totalCrossrefCites:0,totalDimensionsCites:0,hasAltmetrics:1,abstract:"Social science has made great strides over the last half-century, with some of the most significant gains made in micro-level studies. However, analysts interested in broad societal change will not be satisfied with this micro-level detail alone. They will find the detail useful, but they still need to convert the micro-level relations into macro-level outcomes. Decomposition methods rooted in demography can help in those situations. This chapter discusses how these decomposition methods can build on other methods traditionally used in the social sciences. It specifies the kind of problems that are well suited for decomposition analysis, and it briefly reviews three basic types of decomposition approaches (demographic, regression, and mathematical). We illustrate, using mortality data as an example, and conclude with some suggestions for how this method might more broadly advance macrosocial research.",signatures:"Parfait Eloundou-Enyegue, Sarah Giroux and Michel Tenikue",downloadPdfUrl:"/chapter/pdf-download/75618",previewPdfUrl:"/chapter/pdf-preview/75618",authors:[{id:"338748",title:"Prof.",name:"Parfait",surname:"Eloundou-Enyegue",slug:"parfait-eloundou-enyegue",fullName:"Parfait Eloundou-Enyegue"},{id:"338749",title:"Dr.",name:"Sarah",surname:"Giroux",slug:"sarah-giroux",fullName:"Sarah Giroux"},{id:"338750",title:"Dr.",name:"Michel",surname:"Tenikue",slug:"michel-tenikue",fullName:"Michel Tenikue"}],corrections:null},{id:"75780",title:"Geographies of Ageing: A Visuospatial Approach to Demographic Change in Australia",doi:"10.5772/intechopen.96430",slug:"geographies-of-ageing-a-visuospatial-approach-to-demographic-change-in-australia",totalDownloads:275,totalCrossrefCites:0,totalDimensionsCites:0,hasAltmetrics:0,abstract:"The global phenomenon of population ageing is both complex and multi-layered. We know at a global level that different countries are progressing towards becoming aged societies at different rates. We know that within national borders some regions, mainly rural, are affected by ageing more than others. We also know the health and social care systems struggle to respond effectively to ageing because it is complex and, often, runs counter to the structural design of healthcare systems with their emphasis on clinical and organ-specific problems. Ageing challenges these conventional approaches and is compounded by the prevalence of wide-spread ageism at the societal and systemic levels. Therefore, if we are to adapt to population ageing and care for older people effectively, we need to better understand them and their situational contexts. This includes where they live and how their social, biological and clinical trajectories are progressing. Synthesising this kind of multi-layered information also presents challenges because many health and social care systems operate in silos, with limited information exchanges and limited service coordination. One strategy is the concept of a visuospatial data-informed approach. Here we present a conceptual basis for this approach drawn from our work in the Australian health and ageing contexts.",signatures:"Hamish Robertson and Nick Nicholas",downloadPdfUrl:"/chapter/pdf-download/75780",previewPdfUrl:"/chapter/pdf-preview/75780",authors:[{id:"337661",title:"Dr.",name:"Hamish",surname:"Robertson",slug:"hamish-robertson",fullName:"Hamish Robertson"},{id:"346245",title:"Mr.",name:"Nick",surname:"Nicholas",slug:"nick-nicholas",fullName:"Nick Nicholas"}],corrections:null},{id:"77806",title:"Demographic Transition in Sub-Saharan Africa: From Grassroots to Ivory Towers",doi:"10.5772/intechopen.98407",slug:"demographic-transition-in-sub-saharan-africa-from-grassroots-to-ivory-towers",totalDownloads:144,totalCrossrefCites:0,totalDimensionsCites:1,hasAltmetrics:1,abstract:"The concept of demographic transition has been evident to European, North American and Japanese population since the early 1960’s. It loosely followed natural patterns that were postulated as far back as 1795. However, scientists and policy makers, still erroneously consider demographic transition to be absent in sub-Saharan Africa. The aim of this chapter is to uncover the hidden truth behind population censa in sub-Sahara African countries using Statistical tools. The chapter analyses philosophical basis of sub-Saharan Africa demographic dividends from 1960 to 2000. It then cautiously highlights how demographic transition is emerging in sub-Saharan Africa. Specifically, it endeavours to highlight how different African countries are in different stages of demographic transition. The chapter also contrasts some of the prevalent misconceptions about Africans, especially the delusional idea of Africans as a homogenous population group on genetic basis. Lastly, it offers solution, to the current demographic chaos, and their relationship to future matured demographic transition in sub-Saharan Africa.",signatures:"Kelvin Melkizedeck Leshabari",downloadPdfUrl:"/chapter/pdf-download/77806",previewPdfUrl:"/chapter/pdf-preview/77806",authors:[{id:"287573",title:"Dr.",name:"Kelvin",surname:"Leshabari",slug:"kelvin-leshabari",fullName:"Kelvin Leshabari"}],corrections:null},{id:"75918",title:"Variations in First Union Dissolution Patterns among the Lebou, Peuhl, Sereer, Toucouleur, and Wolof in Senegal",doi:"10.5772/intechopen.96108",slug:"variations-in-first-union-dissolution-patterns-among-the-lebou-peuhl-sereer-toucouleur-and-wolof-in-",totalDownloads:153,totalCrossrefCites:0,totalDimensionsCites:0,hasAltmetrics:0,abstract:"Major changes have been observed in recent decades both in the mode of union formation and in the stability of conjugal unions in Sub-Saharan Africa. Although these changes are known to vary in intensity across countries, variations across ethnical groups within countries are still not well studied. The present study investigates ethnic variations in the dissolution of first union in Senegal, focusing on five ethnic groups: Lebou, Peuhl, Sereer, Toucouleur and Wolof. It attempts to examine the specific effect of ethnicity and to identify underlying mechanisms of action of ethnic variations in union dissolution among men and women. The study uses data from a biographical survey on “vulnerabilities and chronic poverty” in Senegal (2008-2009) and event history analysis techniques. Kaplan-Meier survivor functions were used to explore bivariate relationships and Cox semi-parametric hazard model for multivariate analysis. Results showed that ethnic differences in the hazard of union dissolution become apparent only after controlling for the effects of cumulated fertility, education and birth cohort highlighting the persistence of cultural differences between ethnic groups that cannot be explained by only standard sociological and demographic variables. Ethnicity practices continue to shape marital outcomes in Senegal, especially after controlling for other covariates. This study suggests the need for large-scale and more detailed data covering all Senegalese ethnic groups for a better understanding of the complexity and the persistence of domestic and matrimonial customs and traditions in matrimonial relationships.",signatures:"Justin Dansou",downloadPdfUrl:"/chapter/pdf-download/75918",previewPdfUrl:"/chapter/pdf-preview/75918",authors:[{id:"339826",title:"Dr.",name:"Justin",surname:"Dansou",slug:"justin-dansou",fullName:"Justin Dansou"}],corrections:null},{id:"76794",title:"The Age-Sex Structure of Religion as a Determinant of the Social Inclusion of Internal Migrants in Maroua",doi:"10.5772/intechopen.96426",slug:"the-age-sex-structure-of-religion-as-a-determinant-of-the-social-inclusion-of-internal-migrants-in-m",totalDownloads:197,totalCrossrefCites:0,totalDimensionsCites:0,hasAltmetrics:0,abstract:"We set out to find out how the sex-age structure of religion of internal migrants influences their integration in the socio-economic activities of Maroua. We used the exponential non-discriminative snowball sampling method to collect data in which each new referral provided us with more data for referral until we got enough number of subjects for the sample. We concluded that: if one is a Muslim, one will have a stable and progressing business because Muslims maintain a good relationship with their neighbors and they also practice a relationship of solidarity. However, the socio-economic activities of Catholics, Pentecostals and Protestants suffer because they lack the cultural capital that Muslims enjoy. However, age plays a major role: when they are 45–54 years old, the income of the internally migrated Muslims and Catholics drastically decline while that of Pentecostals and Protestants increases. Older Muslims and Catholics earn basically very low income unlike Protestants who earn very high salary. The income inequality among men is much higher than that among women. Generally, men have a more conflictual relationship with their neighbors than women and women diversify their relationship with the natives more than men.",signatures:"Nanche Billa Robert",downloadPdfUrl:"/chapter/pdf-download/76794",previewPdfUrl:"/chapter/pdf-preview/76794",authors:[{id:"285893",title:"Dr.",name:"Nanche Billa",surname:"Robert",slug:"nanche-billa-robert",fullName:"Nanche Billa Robert"}],corrections:null},{id:"75431",title:"Age at First Marriage of Women in Bangladesh: Levels, Trends and Determinants",doi:"10.5772/intechopen.96264",slug:"age-at-first-marriage-of-women-in-bangladesh-levels-trends-and-determinants",totalDownloads:408,totalCrossrefCites:0,totalDimensionsCites:0,hasAltmetrics:0,abstract:"Age at first marriage is an important demographic event affecting births, deaths, and women’s and children’s health. This study aims to explore the levels, trends and determinants of age at first marriage of women in Bangladesh. This study utilized data from the 2014 Bangladesh Demographic and Health Survey. The univariate (some basic statistics), bivariate (simple cross-tabulation and χ2-test) and multivariate (analysis of covariance, multiple classification analysis and binary logistic regression) techniques were adopted to analyze the data. Age of women at first marriage in Bangladesh has been increasing over time, while the pace is sluggish. Respondent’s education has a strong positive effect on age at marriage. Women with a higher level of education are more likely to get delayed marriage. Current age, religion, region, place of residence and husband’s education are also influential factors affecting age at marriage. Wealth index is partially significant, that is, women from households with economically poor status are significantly more likely to marry early than those from affluent households. The change in age at marriage is associated with major social structural changes such as women’s educational attainment and urbanization process.",signatures:"Mohammad Salim Zahangir and Mosammat Zamilun Nahar",downloadPdfUrl:"/chapter/pdf-download/75431",previewPdfUrl:"/chapter/pdf-preview/75431",authors:[{id:"340753",title:"Prof.",name:"Mohammad Salim",surname:"Zahangir",slug:"mohammad-salim-zahangir",fullName:"Mohammad Salim Zahangir"},{id:"340768",title:"Mrs.",name:"Mosammat Zamilun",surname:"Nahar",slug:"mosammat-zamilun-nahar",fullName:"Mosammat Zamilun Nahar"}],corrections:null},{id:"77155",title:"The City of L’Aquila after the 2009 Earthquake: Review of Connections between Depopulation, Identity and Continuity",doi:"10.5772/intechopen.96537",slug:"the-city-of-l-aquila-after-the-2009-earthquake-review-of-connections-between-depopulation-identity-a",totalDownloads:286,totalCrossrefCites:0,totalDimensionsCites:0,hasAltmetrics:0,abstract:"The chapter wants to take into consideration the progressive loss of identity and authenticity of the city of L’Aquila, located in the Abruzzi region of central Italy about a hundred kilometers east of Rome, after the earthquake of 2009. Described as “a small Florence of the Italian Renaissance”, L’Aquila is nestled in a basin surrounded by mountains, with what was a fully recognizable identity until the devastating earthquake which took place on April 6, 2009, the night after Palm Sunday. After those violent seismic shocks, repeated in 2016 and 2017, there was a progressive demographic depopulation, since the historic center of the capital and that of the hamlets have been closed and declared a “red zone”. The population, especially the younger ones, no longer recognizes themselves in their place of origin, and many people have preferred to leave. Authenticity, both material and formal (of the urban form) is also increasingly diminishing. Today the image of the city, which had been handed down over centuries, is lost. Immediately after the 2009 earthquake the city was closed and barred, preventing residents from remaining in their homes, even in the less damaged ones. The historic center was isolated and emptied, occupied by the military forces and the Fire Brigade. Contrary to any common sense, instead of immediately carrying out consolidation and restoration work (especially with regards to the more characteristic minor structures), it was decided to begin with long and expensive shoring and scaffolding installations. A forest of props and tie rods that secure the walls and draw imaginative and imposing patterns, thus postponing sine die urgent works. With the forced expulsion of the inhabitants which has now lasted for nearly seven years, the younger generation particularly, is showing (perhaps unconsciously) more and more indifference and detachment from their roots in the historic center. As time passes social and economic interest (as well as those of identity) in returning to their past houses fade. They prefer to pass time elsewhere, either in the suburbs where anonymous shopping centers have mushroomed, or in other cities (in some aspects this has been favored by the possibility of obtaining funds for the purchase of houses outside the municipality). This is why one can speak of a double loss of identity and continuity. The topic should, therefore, be approached from a twofold point of view: identity and continuity. Identity meaning that which transmits the original model and characteristic of place and the inhabitants; and continuity meaning that which allows you to remain permanently in the same place with a stable dwelling. We also find a dual meaning in lasting continuity; the people (inhabitants), and the space and form of architecture. Identity and continuity are also reflected in lifestyle, as well as in details, materials, colors and common feelings. A ‘sentimental heritage’ as well as a material one, which is now lost. There is, therefore, a twin theme: that of the continuation of archetypes, and that of housing models in which the population recognizes itself. Today in L’Aquila, identity has disappeared. The inhabitants no longer appear as protagonists, but are reduced to extras, to mute actors against the backdrop of an incomprehensible scene. Even if the search for a lost identity and continuity may now seem an unreal or utopian goal, it should have been the opposite; they should have been the priority and gone hand in hand with the reconstruction. At the end, the various restoration and reconstruction criteria for the survival of what remains of the city will also be examined.",signatures:"Stefano Gizzi",downloadPdfUrl:"/chapter/pdf-download/77155",previewPdfUrl:"/chapter/pdf-preview/77155",authors:[{id:"342642",title:"Dr.",name:"Stefano",surname:"Gizzi",slug:"stefano-gizzi",fullName:"Stefano Gizzi"}],corrections:null},{id:"76336",title:"Health Seeking Behaviors among Displaced Populations/Refugees",doi:"10.5772/intechopen.97403",slug:"health-seeking-behaviors-among-displaced-populations-refugees",totalDownloads:120,totalCrossrefCites:0,totalDimensionsCites:0,hasAltmetrics:0,abstract:"The United States resettles refugees every year. Their population in south-central Kentucky (KY) is diverse and fitting to research into culture-dependent healthcare utilization patterns. A mixed study was conducted with one hundred and ten semi-structured questionnaires and three individual interviews. Significant differences were observed between the use of healthcare services and refugees’ nationality (F (5, 98) = 4.29, p < 0.001), acculturation (t = −2.03, p < 0.04), and interpreters (t = 1.92, p < 0.05). Beliefs affect use through the level of cultural competency of the healthcare provider. These findings contribute to the health policy debates surrounding this culturally diverse population.",signatures:"Chika Ejike",downloadPdfUrl:"/chapter/pdf-download/76336",previewPdfUrl:"/chapter/pdf-preview/76336",authors:[{id:"342365",title:"Dr.",name:"Chika",surname:"Ejike",slug:"chika-ejike",fullName:"Chika Ejike"}],corrections:null},{id:"76983",title:"Researching into Commitments for Sustainable Development Goals and Healthy Aging",doi:"10.5772/intechopen.97674",slug:"researching-into-commitments-for-sustainable-development-goals-and-healthy-aging",totalDownloads:255,totalCrossrefCites:1,totalDimensionsCites:1,hasAltmetrics:0,abstract:"Implementing the Programme of Action (PoA), for the purpose of attaining Sustainable Development Goals (SDGs, also known as the “Global Goals”, adopted by UN Member States in the year 2015) requires, among other contributing factors, specific strategies on: (a) aging, and (b) health. The PoA was adopted at the International Conference on Population and Development (ICPD) that took place at Cairo, Egypt, in the year 1994. In view of these facts, the author of this paper makes two research statements: (a) “SDGs and healthy ageing (HA) are connected”, and (b) “international community, across the regions of the globe, needs to make advocacy efforts for HA”. These considerations gain increased significance if one looks at demographic trends: significant portion of the world population are older (also known as “older people”, “older adults”, and “older citizens”), with projections that share of older people (over the age of 65 years) will double by the end of 2050. The “UN Decade of Healthy Ageing (2021-2030)”, is, thus, a significant development. The author, in the present work, primarily attempts to discuss and debate specific initiatives (in terms of strategic interventions) that stakeholders need to undertake for the purpose of ensuring HA. It has been concluded on several platforms that “attainments of SDGs are closely linked with HA”. This research note also presents quick highlights on how SDGs and HA are inter-linked. In terms of research mythology employed here, the author has collected secondary data (largely ‘qualitative’ in nature) from various sources (quoted under references). Method of data analysis is ‘descriptive’. To sum up, key for HA aging lies in enlarging opportunities for positive health at all stages of life.",signatures:"Santosh Kumar Mishra",downloadPdfUrl:"/chapter/pdf-download/76983",previewPdfUrl:"/chapter/pdf-preview/76983",authors:[{id:"344582",title:"Dr.",name:"Santosh Kumar",surname:"Mishra",slug:"santosh-kumar-mishra",fullName:"Santosh Kumar Mishra"}],corrections:null}],productType:{id:"1",title:"Edited Volume",chapterContentType:"chapter",authoredCaption:"Edited by"},subseries:null,tags:null},relatedBooks:[{type:"book",id:"5810",title:"Socialization",subtitle:"A Multidimensional Perspective",isOpenForSubmission:!1,hash:"bfac2e9c0ec2963193e9d15d617c6a01",slug:"socialization-a-multidimensional-perspective",bookSignature:"Rosalba Morese, Sara Palermo and Juri Nervo",coverURL:"https://cdn.intechopen.com/books/images_new/5810.jpg",editedByType:"Edited by",editors:[{id:"214435",title:"Dr.",name:"Rosalba",surname:"Morese",slug:"rosalba-morese",fullName:"Rosalba Morese"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"10656",title:"Intellectual Property",subtitle:null,isOpenForSubmission:!1,hash:"135df9b403b125a6458eba971faab3f6",slug:"intellectual-property",bookSignature:"Sakthivel Lakshmana Prabu and Timmakkondu Narasimman Kuppusami Suriyaprakash",coverURL:"https://cdn.intechopen.com/books/images_new/10656.jpg",editedByType:"Edited by",editors:[{id:"91590",title:"Dr.",name:"Sakthivel",surname:"Lakshmana Prabu",slug:"sakthivel-lakshmana-prabu",fullName:"Sakthivel Lakshmana Prabu"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"10227",title:"Rural Development",subtitle:"Education, Sustainability, Multifunctionality",isOpenForSubmission:!1,hash:"091e1f8266ec9fc776113a71c002cf7f",slug:"rural-development-education-sustainability-multifunctionality",bookSignature:"Paola de Salvo and Manuel Vaquero Piñeiro",coverURL:"https://cdn.intechopen.com/books/images_new/10227.jpg",editedByType:"Edited by",editors:[{id:"289820",title:"Prof.",name:"Paola",surname:"de Salvo",slug:"paola-de-salvo",fullName:"Paola de Salvo"}],equalEditorOne:{id:"289817",title:"Prof.",name:"Manuel",middleName:null,surname:"Vaquero Pineiro",slug:"manuel-vaquero-pineiro",fullName:"Manuel Vaquero Pineiro",profilePictureURL:"https://mts.intechopen.com/storage/users/289817/images/system/289817.png",biography:"Manuel Vaquero Piñeiro was awarded a Ph.D. in Modern and Contemporary History by the University of Cantabria (Spain); since 2006, he is a professor of economic history at the University of Perugia, Italy (manuel.vaqueropineiro@unipg.it). In 2010, he received the international award, Daria Borghese, for studies on the history of the Renaissance in Rome. Among his main research interests includes the socioeconomic transformation of agriculture.",institutionString:"University of Perugia",position:null,outsideEditionCount:0,totalCites:0,totalAuthoredChapters:"2",totalChapterViews:"0",totalEditedBooks:"0",institution:{name:"University of Perugia",institutionURL:null,country:{name:"Italy"}}},equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"10785",title:"Suicide",subtitle:null,isOpenForSubmission:!1,hash:"f8ad2d5c55e4551a2e1046369cae627f",slug:"suicide",bookSignature:"Robert W. Motta",coverURL:"https://cdn.intechopen.com/books/images_new/10785.jpg",editedByType:"Edited by",editors:[{id:"262071",title:"Prof.",name:"Robert W.",surname:"Motta",slug:"robert-w.-motta",fullName:"Robert W. Motta"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"7781",title:"Improving Quality of Life",subtitle:"Exploring Standard of Living, Wellbeing, and Community Development",isOpenForSubmission:!1,hash:"8130b1bca2a4feb7f313f127d302dcdd",slug:"improving-quality-of-life-exploring-standard-of-living-wellbeing-and-community-development",bookSignature:"Ryan Merlin Yonk",coverURL:"https://cdn.intechopen.com/books/images_new/7781.jpg",editedByType:"Edited by",editors:[{id:"196259",title:"Dr.",name:"Ryan Merlin",surname:"Yonk",slug:"ryan-merlin-yonk",fullName:"Ryan Merlin Yonk"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"10233",title:"Sedentary Behaviour",subtitle:"A Contemporary View",isOpenForSubmission:!1,hash:"183415731897b5968c083dbdbef71553",slug:"sedentary-behaviour-a-contemporary-view",bookSignature:"Adilson Marques and Élvio Rúbio Gouveia",coverURL:"https://cdn.intechopen.com/books/images_new/10233.jpg",editedByType:"Edited by",editors:[{id:"210561",title:"Prof.",name:"Adilson",surname:"Marques",slug:"adilson-marques",fullName:"Adilson Marques"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"7802",title:"Modern Slavery and Human Trafficking",subtitle:null,isOpenForSubmission:!1,hash:"587a0b7fb765f31cc98de33c6c07c2e0",slug:"modern-slavery-and-human-trafficking",bookSignature:"Jane Reeves",coverURL:"https://cdn.intechopen.com/books/images_new/7802.jpg",editedByType:"Edited by",editors:[{id:"211328",title:"Prof.",name:"Jane",surname:"Reeves",slug:"jane-reeves",fullName:"Jane Reeves"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"7810",title:"Quality of Life",subtitle:"Biopsychosocial Perspectives",isOpenForSubmission:!1,hash:"0392d2712c58885b729bd943f9aac37f",slug:"quality-of-life-biopsychosocial-perspectives",bookSignature:"Floriana Irtelli, Federico Durbano and Simon George Taukeni",coverURL:"https://cdn.intechopen.com/books/images_new/7810.jpg",editedByType:"Edited by",editors:[{id:"174641",title:"Dr.",name:"Floriana",surname:"Irtelli",slug:"floriana-irtelli",fullName:"Floriana Irtelli"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"6927",title:"Intellectual Property Rights",subtitle:"Patent",isOpenForSubmission:!1,hash:"9fd5884b3bce2ec6f77a8356ea384a37",slug:"intellectual-property-rights-patent",bookSignature:"Sakthivel Lakshmana Prabu, Suriyaprakash Tnk, Eduardo Jacob-Lopes and Leila Queiroz Zepka",coverURL:"https://cdn.intechopen.com/books/images_new/6927.jpg",editedByType:"Edited by",editors:[{id:"91590",title:"Dr.",name:"Sakthivel",surname:"Lakshmana Prabu",slug:"sakthivel-lakshmana-prabu",fullName:"Sakthivel Lakshmana Prabu"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"6483",title:"Classes",subtitle:"From National to Global Class Formation",isOpenForSubmission:!1,hash:"3666ae0858b15a8a16846d8d53b40f91",slug:"classes-from-national-to-global-class-formation",bookSignature:"Hardy Hanappi",coverURL:"https://cdn.intechopen.com/books/images_new/6483.jpg",editedByType:"Edited by",editors:[{id:"145817",title:"Prof.",name:"Hardy",surname:"Hanappi",slug:"hardy-hanappi",fullName:"Hardy Hanappi"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}}],ofsBooks:[]},correction:{item:{id:"66300",slug:"corrigendum-to-recovery-intervention-to-promote-social-connectedness-through-social-recreational-pro",title:"Corrigendum to: Recovery Intervention to Promote Social Connectedness through Social Recreational Programs for Persons with Dementia: A Critical Analysis",doi:null,correctionPDFUrl:"https://cdn.intechopen.com/pdfs/66300.pdf",downloadPdfUrl:"/chapter/pdf-download/66300",previewPdfUrl:"/chapter/pdf-preview/66300",totalDownloads:null,totalCrossrefCites:null,bibtexUrl:"/chapter/bibtex/66300",risUrl:"/chapter/ris/66300",chapter:{id:"65375",slug:"recovery-intervention-to-promote-social-connectedness-through-social-recreational-programs-for-perso",signatures:"Winnie Sun, Shelby-Lynne Clarke, Hanaan Madahey and Ping Zou",dateSubmitted:"November 12th 2018",dateReviewed:"December 22nd 2018",datePrePublished:"January 28th 2019",datePublished:"April 10th 2019",book:{id:"8268",title:"Advances in Dementia Research",subtitle:null,fullTitle:"Advances in Dementia Research",slug:"advances-in-dementia-research",publishedDate:"April 10th 2019",bookSignature:"Ghulam Md. Ashraf",coverURL:"https://cdn.intechopen.com/books/images_new/8268.jpg",licenceType:"CC BY 3.0",editedByType:"Edited by",editors:[{id:"199287",title:"Dr.",name:"Ghulam Md",middleName:null,surname:"Ashraf",slug:"ghulam-md-ashraf",fullName:"Ghulam Md Ashraf"}],productType:{id:"1",title:"Edited Volume",chapterContentType:"chapter",authoredCaption:"Edited by"}},authors:[{id:"219759",title:"Dr.",name:"Winnie",middleName:null,surname:"Sun",fullName:"Winnie Sun",slug:"winnie-sun",email:"winnie.sun@uoit.ca",position:null,institution:{name:"University of Ontario Institute of Technology",institutionURL:null,country:{name:"Canada"}}},{id:"284558",title:"Dr.",name:"Shelby-Lynne",middleName:null,surname:"Clarke",fullName:"Shelby-Lynne Clarke",slug:"shelby-lynne-clarke",email:"shelbylynne.clarke@gmail.com",position:null,institution:null},{id:"284561",title:"Dr.",name:"Hanaan",middleName:null,surname:"Madahey",fullName:"Hanaan Madahey",slug:"hanaan-madahey",email:"hanaan.madahey@uoit.net",position:null,institution:null},{id:"284562",title:"Dr.",name:"Ping",middleName:null,surname:"Zou",fullName:"Ping Zou",slug:"ping-zou",email:"pingz@nipissingu.ca",position:null,institution:null}]}},chapter:{id:"65375",slug:"recovery-intervention-to-promote-social-connectedness-through-social-recreational-programs-for-perso",signatures:"Winnie Sun, Shelby-Lynne Clarke, Hanaan Madahey and Ping Zou",dateSubmitted:"November 12th 2018",dateReviewed:"December 22nd 2018",datePrePublished:"January 28th 2019",datePublished:"April 10th 2019",book:{id:"8268",title:"Advances in Dementia Research",subtitle:null,fullTitle:"Advances in Dementia Research",slug:"advances-in-dementia-research",publishedDate:"April 10th 2019",bookSignature:"Ghulam Md. Ashraf",coverURL:"https://cdn.intechopen.com/books/images_new/8268.jpg",licenceType:"CC BY 3.0",editedByType:"Edited by",editors:[{id:"199287",title:"Dr.",name:"Ghulam Md",middleName:null,surname:"Ashraf",slug:"ghulam-md-ashraf",fullName:"Ghulam Md Ashraf"}],productType:{id:"1",title:"Edited Volume",chapterContentType:"chapter",authoredCaption:"Edited by"}},authors:[{id:"219759",title:"Dr.",name:"Winnie",middleName:null,surname:"Sun",fullName:"Winnie Sun",slug:"winnie-sun",email:"winnie.sun@uoit.ca",position:null,institution:{name:"University of Ontario Institute of Technology",institutionURL:null,country:{name:"Canada"}}},{id:"284558",title:"Dr.",name:"Shelby-Lynne",middleName:null,surname:"Clarke",fullName:"Shelby-Lynne Clarke",slug:"shelby-lynne-clarke",email:"shelbylynne.clarke@gmail.com",position:null,institution:null},{id:"284561",title:"Dr.",name:"Hanaan",middleName:null,surname:"Madahey",fullName:"Hanaan Madahey",slug:"hanaan-madahey",email:"hanaan.madahey@uoit.net",position:null,institution:null},{id:"284562",title:"Dr.",name:"Ping",middleName:null,surname:"Zou",fullName:"Ping Zou",slug:"ping-zou",email:"pingz@nipissingu.ca",position:null,institution:null}]},book:{id:"8268",title:"Advances in Dementia Research",subtitle:null,fullTitle:"Advances in Dementia Research",slug:"advances-in-dementia-research",publishedDate:"April 10th 2019",bookSignature:"Ghulam Md. Ashraf",coverURL:"https://cdn.intechopen.com/books/images_new/8268.jpg",licenceType:"CC BY 3.0",editedByType:"Edited by",editors:[{id:"199287",title:"Dr.",name:"Ghulam Md",middleName:null,surname:"Ashraf",slug:"ghulam-md-ashraf",fullName:"Ghulam Md Ashraf"}],productType:{id:"1",title:"Edited Volume",chapterContentType:"chapter",authoredCaption:"Edited by"}}},ofsBook:{item:{type:"book",id:"11800",leadTitle:null,title:"Cyanobacteria - Recent Advances and New Perspectives",subtitle:null,reviewType:"peer-reviewed",abstract:"\r\n\tCyanobacteria have an enormous ecological role ranging from harmful algal blooms to carbon dioxide mitigation. Their extraordinary metabolic machinery enables them to flourish in diverse habitats. The valorization of biomass can yield a plethora of high-value products. The secondary metabolites that are produced by cyanobacteria include pigments, polysaccharides, phenols, hydrogen, and many more. The biofuels like hydrogen, bioethanol, syngas, and many more can be produced which find applications as alternate energy sources and address vital environmental issues related to non-renewable energy sources. These biofuels are very sustainable and eliminating the research gaps can further lead to the commercial production of cyanobacterial biofuels in the market across the world. The range of metabolic products is tremendously valuable as antimicrobial, anticancer, anti-inflammatory, antitumor, antioxidative in nature, which has excellent therapeutic applications.
\r\n\r\n\tThis book envisions elaborating on the recent advancements and the new perspectives in the area of cyanobacterial research on the global platform.
",isbn:"978-1-80356-462-3",printIsbn:"978-1-80356-461-6",pdfIsbn:"978-1-80356-463-0",doi:null,price:0,priceEur:0,priceUsd:0,slug:null,numberOfPages:0,isOpenForSubmission:!1,isSalesforceBook:!1,isNomenclature:!1,hash:"645b037b086ec8c36af614326dce9804",bookSignature:"Dr. Archana Tiwari",publishedDate:null,coverURL:"https://cdn.intechopen.com/books/images_new/11800.jpg",keywords:"Algae, Cyanobacteria, Ecological Impact, Carbon Dioxide Mitigation, Biofuels, Hydrogen, Ethanol, Sustainability, Applications, Biomass Valorization, Metabolites, Bioactive Compounds",numberOfDownloads:null,numberOfWosCitations:0,numberOfCrossrefCitations:null,numberOfDimensionsCitations:null,numberOfTotalCitations:null,isAvailableForWebshopOrdering:!0,dateEndFirstStepPublish:"March 2nd 2022",dateEndSecondStepPublish:"May 3rd 2022",dateEndThirdStepPublish:"July 2nd 2022",dateEndFourthStepPublish:"September 20th 2022",dateEndFifthStepPublish:"November 19th 2022",dateConfirmationOfParticipation:null,remainingDaysToSecondStep:"2 months",secondStepPassed:!0,areRegistrationsClosed:!0,currentStepOfPublishingProcess:4,editedByType:null,kuFlag:!1,biosketch:"A Gold medalist and distinction holder in Botany and her research interests include Phycoprospecting Diatoms for wastewater remediation and high-value products.",coeditorOneBiosketch:null,coeditorTwoBiosketch:null,coeditorThreeBiosketch:null,coeditorFourBiosketch:null,coeditorFiveBiosketch:null,editors:[{id:"186791",title:"Dr.",name:"Archana",middleName:null,surname:"Tiwari",slug:"archana-tiwari",fullName:"Archana Tiwari",profilePictureURL:"https://mts.intechopen.com/storage/users/186791/images/system/186791.jpg",biography:"Dr. Archana Tiwari is Associate Professor at Amity University, India. Her research interests include renewable sources of energy from microalgae and further utilizing the residual biomass for the generation of value-added products, bioremediation through microalgae and microbial consortium, antioxidative enzymes and stress, and nutraceuticals from microalgae. She has been working on algal biotechnology for the last two decades. She has published her research in many international journals and has authored many books and chapters with renowned publishing houses. She has also delivered talks as an invited speaker at many national and international conferences. Dr. Tiwari is the recipient of several awards including Researcher of the Year and Distinguished Scientist.",institutionString:"Amity University",position:null,outsideEditionCount:0,totalCites:0,totalAuthoredChapters:"3",totalChapterViews:"0",totalEditedBooks:"1",institution:{name:"Amity University",institutionURL:null,country:{name:"India"}}}],coeditorOne:null,coeditorTwo:null,coeditorThree:null,coeditorFour:null,coeditorFive:null,topics:[{id:"13",title:"Immunology and Microbiology",slug:"immunology-and-microbiology"}],chapters:null,productType:{id:"1",title:"Edited Volume",chapterContentType:"chapter",authoredCaption:"Edited by"},personalPublishingAssistant:{id:"453624",firstName:"Martina",lastName:"Scerbe",middleName:null,title:"Ms.",imageUrl:"https://mts.intechopen.com/storage/users/453624/images/20399_n.jpg",email:"martina.s@intechopen.com",biography:null}},relatedBooks:[{type:"book",id:"6764",title:"Cyanobacteria",subtitle:null,isOpenForSubmission:!1,hash:"87c7d8f86f7c1185aa4dd47c6492951a",slug:"cyanobacteria",bookSignature:"Archana Tiwari",coverURL:"https://cdn.intechopen.com/books/images_new/6764.jpg",editedByType:"Edited by",editors:[{id:"186791",title:"Dr.",name:"Archana",surname:"Tiwari",slug:"archana-tiwari",fullName:"Archana Tiwari"}],productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"1591",title:"Infrared Spectroscopy",subtitle:"Materials Science, Engineering and Technology",isOpenForSubmission:!1,hash:"99b4b7b71a8caeb693ed762b40b017f4",slug:"infrared-spectroscopy-materials-science-engineering-and-technology",bookSignature:"Theophile Theophanides",coverURL:"https://cdn.intechopen.com/books/images_new/1591.jpg",editedByType:"Edited by",editors:[{id:"37194",title:"Dr.",name:"Theophile",surname:"Theophanides",slug:"theophile-theophanides",fullName:"Theophile Theophanides"}],productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"3161",title:"Frontiers in Guided Wave Optics and Optoelectronics",subtitle:null,isOpenForSubmission:!1,hash:"deb44e9c99f82bbce1083abea743146c",slug:"frontiers-in-guided-wave-optics-and-optoelectronics",bookSignature:"Bishnu Pal",coverURL:"https://cdn.intechopen.com/books/images_new/3161.jpg",editedByType:"Edited by",editors:[{id:"4782",title:"Prof.",name:"Bishnu",surname:"Pal",slug:"bishnu-pal",fullName:"Bishnu Pal"}],productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"3092",title:"Anopheles mosquitoes",subtitle:"New insights into malaria vectors",isOpenForSubmission:!1,hash:"c9e622485316d5e296288bf24d2b0d64",slug:"anopheles-mosquitoes-new-insights-into-malaria-vectors",bookSignature:"Sylvie Manguin",coverURL:"https://cdn.intechopen.com/books/images_new/3092.jpg",editedByType:"Edited by",editors:[{id:"50017",title:"Prof.",name:"Sylvie",surname:"Manguin",slug:"sylvie-manguin",fullName:"Sylvie Manguin"}],productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"371",title:"Abiotic Stress in Plants",subtitle:"Mechanisms and Adaptations",isOpenForSubmission:!1,hash:"588466f487e307619849d72389178a74",slug:"abiotic-stress-in-plants-mechanisms-and-adaptations",bookSignature:"Arun Shanker and B. Venkateswarlu",coverURL:"https://cdn.intechopen.com/books/images_new/371.jpg",editedByType:"Edited by",editors:[{id:"58592",title:"Dr.",name:"Arun",surname:"Shanker",slug:"arun-shanker",fullName:"Arun Shanker"}],productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"72",title:"Ionic Liquids",subtitle:"Theory, Properties, New Approaches",isOpenForSubmission:!1,hash:"d94ffa3cfa10505e3b1d676d46fcd3f5",slug:"ionic-liquids-theory-properties-new-approaches",bookSignature:"Alexander Kokorin",coverURL:"https://cdn.intechopen.com/books/images_new/72.jpg",editedByType:"Edited by",editors:[{id:"19816",title:"Prof.",name:"Alexander",surname:"Kokorin",slug:"alexander-kokorin",fullName:"Alexander Kokorin"}],productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"314",title:"Regenerative Medicine and Tissue Engineering",subtitle:"Cells and Biomaterials",isOpenForSubmission:!1,hash:"bb67e80e480c86bb8315458012d65686",slug:"regenerative-medicine-and-tissue-engineering-cells-and-biomaterials",bookSignature:"Daniel Eberli",coverURL:"https://cdn.intechopen.com/books/images_new/314.jpg",editedByType:"Edited by",editors:[{id:"6495",title:"Dr.",name:"Daniel",surname:"Eberli",slug:"daniel-eberli",fullName:"Daniel Eberli"}],productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"57",title:"Physics and Applications of Graphene",subtitle:"Experiments",isOpenForSubmission:!1,hash:"0e6622a71cf4f02f45bfdd5691e1189a",slug:"physics-and-applications-of-graphene-experiments",bookSignature:"Sergey Mikhailov",coverURL:"https://cdn.intechopen.com/books/images_new/57.jpg",editedByType:"Edited by",editors:[{id:"16042",title:"Dr.",name:"Sergey",surname:"Mikhailov",slug:"sergey-mikhailov",fullName:"Sergey Mikhailov"}],productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"1373",title:"Ionic Liquids",subtitle:"Applications and Perspectives",isOpenForSubmission:!1,hash:"5e9ae5ae9167cde4b344e499a792c41c",slug:"ionic-liquids-applications-and-perspectives",bookSignature:"Alexander Kokorin",coverURL:"https://cdn.intechopen.com/books/images_new/1373.jpg",editedByType:"Edited by",editors:[{id:"19816",title:"Prof.",name:"Alexander",surname:"Kokorin",slug:"alexander-kokorin",fullName:"Alexander Kokorin"}],productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"2270",title:"Fourier Transform",subtitle:"Materials Analysis",isOpenForSubmission:!1,hash:"5e094b066da527193e878e160b4772af",slug:"fourier-transform-materials-analysis",bookSignature:"Salih Mohammed Salih",coverURL:"https://cdn.intechopen.com/books/images_new/2270.jpg",editedByType:"Edited by",editors:[{id:"111691",title:"Dr.Ing.",name:"Salih",surname:"Salih",slug:"salih-salih",fullName:"Salih Salih"}],productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}}]},chapter:{item:{type:"chapter",id:"66738",title:"Renal Tumor Biopsies: A Shift towards Improving Outcomes in the Management of Small Renal Masses",doi:"10.5772/intechopen.85781",slug:"renal-tumor-biopsies-a-shift-towards-improving-outcomes-in-the-management-of-small-renal-masses",body:'The surgical disposition towards partial nephrectomies and ablative techniques in the management of small renal masses (
However, it has been shown that a large proportion of SRMs treated are benign incidentalomas. Twenty percent of surgically removed SRMs have proven to be benign [1, 2] (angiomyolipoma, oncocytoma, metanephric adenoma, etc.), with the figure rising to 29% for tumors <2.5 cm [3]. Thus, it is necessary for current practices to be reevaluated to avoid unnecessary overtreatment.
Surgical management based on CT imaging, without pretreatment biopsy, is considered appropriate in most centres. Such an approach not only leads to the patient undertaking unnecessary surgical risks but also places a significant burden on the healthcare system. Premanagement renal tumour biopsies (
Opponents to RTBs believe that concordance rates of the final pathology with radiological imaging, false-negative rates and potential seeding make this an unreliable procedure. However, the safety and outcomes of RTBs have improved significantly over the last decade. Improved imaging techniques allow for a specific localized tissue to be biopsied. Samples taken from percutaneous needle biopsies also now utilize biomarkers that can lend further insights to the heterogeneous nature of renal neoplasms.
It is important to recognize that avoiding unnecessary surgical treatments is more cost-effective and negates associated risks. In this chapter, we will discuss the improvements of RTBs and the merits of incorporating them to deliver better outcome measures.
It is estimated that 60% of all diagnosed renal cell carcinomas (
There should be a paradigm shift on how SRMs are approached. In some centres, RTBs are now performed upon the discovery of an incidentaloma. Here, patients are referred to an interventional radiologist who will then perform a RTB before their consultation with their urologist. Following the biopsy results from the pathologist, the urologist will meet the patient and offer better informed treatment options.
The EAU guidelines recommend RTBs to be performed for AS on selected patients with SRMs, prior to ablative treatments and patients suffering from renal metastatic disease before embarking on systemic treatment.
The American Urological Association (
Historically, absolute contraindications to RTBs include uncontrolled severe hypertension, inability to cooperate with biopsy, solitary kidney and uncontrollable bleeding diathesis [5]. Relative contraindications may include a lack of a safe pathway to the lesion and pregnancy where imaging guidance involves ionizing radiation.
Recent studies have shown that RTBs are still not widely adopted among urologists in clinical practice. A survey in 2010 by Barwari et al. [6] showed that 73% of urologists never take biopsies and only 9% take biopsies in more than 25% of cases. Another survey in 2016 by Richard et al. [7], investigating the prevalence of biopsies for SRMs, showed that only 12% perform RTBs in >75% of cases, while 53% never perform or perform RTBs in <25% of cases.
In both surveys the main reasons urologists cited for not performing biopsies were the lack of influence in clinical management, the risk of false negatives and safety. There is also a radiology-related concern of a lack of expertise with RTBs [7]. These concerns will have to be tackled.
In current literature, many patients undergoing AS have not had a biopsy [8, 9, 10]. AS is usually indicated for elderly patients with significant comorbidities or those refusing surgery. Though considered a safe option for patients with SRMs, the risk of developing metastatic disease during surveillance is not ruled out. A systematic review performed by Prins et al. [9] showed that though 1.12% (0–3.2%) of the pooled AS population (968 patients) incurred delayed intervention, only a small proportion of the said population had undergone a RTB. If a biopsy had been performed, it could have led to an earlier appropriate intervention [11]. A systematic review performed by Smaldone et al. [10] looked at the incidence of metastases in AS strategies. In this review of 880 patients, 18 patients (2.05%) progressed to metastatic disease. Unfortunately, only three of these patients had undergone a RTB.
RTBs can also pave the way for a more refined AS strategy and are strongly recommended [8, 10, 12, 13]. If the SRM proves to be histologically benign, a less stringent follow-up protocol can be adopted, or the patient may even be discharged. Higher metastatic potential masses that are better suited for surgical intervention can also be identified. Thus, RTBs can stratify patients into a low-risk or high-risk surveillance strategy.
In some centres performing RFA, RTBs are either done at the time of the procedure or not performed at all [14, 15, 16]. These patients continue to be treated with a presumptive diagnosis of renal cancer based on CT/US imaging. This increases the rate of RFA performed for benign or indeterminate pathology [15]. Performing RTBs prior to ablative techniques can also be used to stratify patients—where those with unfavorable histology can be triaged to surgery instead.
In order to facilitate the shift in managing SRMs (be it in AS, RFA or systemic treatment), it is important for us to address these barriers in adopting RTBs. We will now assess the reliability and improvements of RTBs.
RTBs are performed percutaneously under local anesthesia. It can be with needle core biopsy or fine needle aspiration (FNA) with US or CT guidance.
Core needle biopsies yield a higher diagnostic rate and a more accurate histological examination over FNA. This was exemplified by a systematic review performed by Marconi et al. [17] (57 studies recruiting 5228 patients)—showing superior sensitivities and specificities over diagnostic FNAs. A coaxial technique allows multiple biopsies to be taken through a coaxial canula, avoiding potential tumor seeding. Comparing needle sizes used, 18-gauge needles are preferred over 14- and 20-gauge needles—showing safer and more accurate histological results [18, 19].
With regard to imaging modalities, US and CT possess their own merits. CT has the advantage of a better resolution that is ideal to locate lesions that are in proximity to critical structures. US has the advantage of lower radiation and lower cost. More importantly it allows real-time needle placement that is suited for nonfocal renal lesions [20].
In spite of acknowledging preferred techniques of RTBs, there are other technical factors that affect their success: amount of adipose tissue in the patient, echogenicity and location of lesion. The challenge of performing a successful biopsy can thus vary from lesion to lesion. Effective communication between the interventional radiologist and urologist is necessary to ensure that a RTB would be reliable in managing a specific SRM.
Recent literature lends support to the diagnostic accuracies of RTBs, challenging the notions some urologists believe. The meta-analysis performed by Marconi et al. [17] showed that initial RTBs yielded a diagnosis in >90% of cases. Core biopsies showed a high sensitivity and specificity of 99.1 and 99.7%, respectively. In cases where both a RTB and surgical pathology were available, good concordance (k = 0.683) for tumor histotype and fair concordance (k = 0.34) for tumor grade were shown.
A systematic review by Patel et al. [21] (including 20 studies with 2979 patients) showed a high diagnostic accuracy of RTB with a sensitivity of 97.5% and a specificity of 96.2%. There was also a high histological concordance observed. Patel’s study highlighted the concern of a reasonable non-diagnostic rate (14.1%).
However, repeat biopsy led to diagnosis in 80% of previously undiagnostic biopsies. It is reported that following a non-diagnostic biopsy, a repeat biopsy has a high rate of rendering a diagnosis—ranging from 67 to 85% [22]. Therefore, in the case of a non-diagnostic biopsy, there is merit in performing a repeat biopsy.
With overall improved diagnostic accuracies of RTBs, urologists should be more reassured about their successes.
Reported concerns regarding the safety of RTBs stem from the risks of bleeding, pneumothorax and tumor seeding [7]. Rising literature appraising the choice of gauge needles, imaging modality and preference for core biopsies over FNA have improved the safety of RTBs.
In Patel’s et al. study [21], complication rates observed were quite low. The rate of haematomas was 4.9%, while the occurrence of any clinically significant pain was 1.2%. Pneumothorax was only detected in 0.6% of cases, and no study reported any cases of tumor seeding. In Marconi’s et al. study [17], the median complication rate was 8.1% with only three Clavien grade ≥2 complications to be reported.
Tumor seeding along the needle tract is anecdotal and very rare. As per the EAU reported guidelines, to avoid any such complication, coaxial sheaths should be used. This allows multiple passes through the renal mass with only one through surrounding tissue.
Despite the high concordance rates in identifying tumor subtypes (as mentioned above), the heterogeneous nature of RCC in itself is an identified barrier in adopting RTB. It is essential for clinicians to identify the challenges in discerning between specific tumor subtypes in order to have a comprehensive grasp on the reliability of a RTB.
The four main subtypes of RCC include clear cell RCC (
Another systematic review by Patel et al. [24] investigated the success of identifying oncocytomas. Of the 48 lesions that were diagnostic of oncocytoma on RTB, 64.6% was in concordance with analysis following surgical treatment. Meta-analysis determined the PPV of oncocytoma on RTB to be 67% with a notable proportion to be identified as chRCC. Histologically, they are hard to distinguish as both have an eosinophilic cytoplasm. Clinical diagnostic dilemmas between chRCC and oncocytomas still remain. Clinicians should factor this in tailoring an altered AS for oncocytomas.
Recent studies have explored the merits of molecular biomarkers to improve diagnostic classification of RTBs. A recent systematic evaluation by Gulati et al. [25] assessed cancer-specific survival (
It is critical to stress on the cost-effectiveness of integrating RTBs in the management of SRMs. A cost-effectiveness study by Pandharipande et al. [28] showed that a strategy of pretreatment biopsies of SRMs leads to a minimally greater difference of quality-adjusted life expectancy (4 days) than empiric surgery. This is at a lower lifetime cost of ($3466). Avoiding unnecessary surgery in cases of resecting indolent SRMs is in the interests of both the patient and the healthcare system. With similar outcomes and lower cost, the use of biopsy to triage patients facilitates this.
RTBs have the strong potential to avoid unnecessary surgeries, preventing treatment-related morbidities in patients and saving healthcare costs. RTBs have high diagnostic accuracies, high concordance rates and low complication rates. Therefore, RTBs should be integrated in the pretreatment management of SRMs when their results can alter the treatment options for the patient. Further studies in improving diagnostic biomarkers are worthwhile in supplementing the classification of RCC subtypes.
This shift in management away from empiric surgical treatment requires support from interventional radiologists, histopathologists and urologists. An interventional radiologist would be suited in identifying the preferred imaging modality for a specific RTB and explaining the difficulty to obtain an adequate amount for a reliable diagnosis. A histopathologist can raise concerns on potential misclassifications of specific tumor subtypes.
Integrated clinical communication between these disciplines can optimize the effective use of a RTB in crafting a well-suited treatment plan for the patient.
There is a hypothesis that the strengthening of hybridization processes in the secondary distribution range contributes to more successful existence of plants in their new homeland [1, 2]. Under unusual conditions, alien species can form hybrids with closely related native species, as well as with other alien plants inhabiting a given area. Often, hybrids are better adapted to secondary distribution range conditions than parent taxa [3, 4, 5], resulting in landscapes in a new home area. Successful recombination of genetic traits of parent species reduces the lag phase (a period of adaptation of an alien taxon to new conditions during which there is not yet active introduction into natural phytocoenosis and expansion of the secondary distribution range) and leads to the formation of new active “species transformers.” Cross-pollinated plant species are the most predisposed to hybridization. Sympatric species are less likely to be cross-species hybridized than allopatric species or populations [6]. The share of hybrid taxa among invasive species of Middle Russia reaches 10% [7].
For a long time, the most important factor in limiting hybridization was geographical isolation, but nowadays closely related taxa come into contact with each other through a multitude of anthropogenic “corridors” [8]. Thus, inter-regional immigration occurs by means of the introduction of plants, which can be frequent and repetitive, and therefore it significantly increases immigration flow [9]. If we consider the situation where conditions for the hybridization of closely related taxa already exist, there may be several possible developments that coexist: (a) New hybrid taxon may appear, and (b) native taxon disappears. During hybridization, genetic assimilation occurs, and new genes are injected into one or both parent species. Hybrids, even being fertile, can, however, be reproductively isolated from parent plants due to the effect of the selection on reproductive traits (allopolyploidy, heterozygous translocations, recombination, mitochondrial DNA-specific differences) and/or due to factors that predetermine crossing (flowering phenology, separation of ecological niches). Interspecific hybridization may also facilitate the naturalization of rare genotypes and cause an increase in their proportion by inverse crossbreeding with alien parent taxa or hybridization between the hybrids themselves. Greater selection advantages for alien alleles should lead to faster replacement of natural alleles through hybridization and slower replacement without hybridization [10]. The period of displacement (substitution) decreases significantly with increasing immigration flow and selective differentiation. Immigration and selection operate in a variety of ways: increasing immigration levels result in the substitution of native species by suppressing them, while increasing selective differentiation in favor of an alien species results in the substitution of an alien species by genetic assimilation without leaving “pure” native species. At moderate and high immigration rates, the loss of native species can be rapid with or without hybridization. Given the high number of species introduced by humans, the loss of native species can increase only as a result of hybridization [11].
Hybridization increases the threat of extinction of many species due to introgression [12, 13]. High degree of introgression is often manifested by wind-pollinated species such as oaks. Hybridization and introgression can lead to a hybrid complex consisting of many hybrids due to a large number of loci. Thus, multiloci seem to increase the number of hybrid types and genetic complexes and accelerate the reduction of “pure” natural species. In addition, the large number of loci essentially reduces the probability of having a “pure” individual of any parent origin [11]. Without introgression, hybrids, being reproductively isolated, can quickly form a new species. With introgression, speciation slows down as inverse crosses with parent lines occur. The impact of hybridization and introgression on the rate of substitution of native species by closely related ones has been addressed by a mathematical model involving a one-loop bipartite inheritance scheme with different levels of cross-species hybridization [11]. Although the model did not take into account vegetatively propagating hybrids, the results showed that the substitution of natural taxa by alien ones could occur very quickly (in less than five generations). According to the results, hybridization and introgression can increase the degree of substitution of native species by non-native ones. Introgression increases species substitution with low immigration, but prevents substitution when an indigenous species has a significant advantage in selection as well as with higher immigration levels. However, as introductions are associated with increased frequency of hybrids, the impact on the indigenous taxon remains high, and the likelihood of extinction increases significantly [11].
It is known that the highest invasive activity is exhibited by species of Asteraceae family [14], so we have focused our attention on representatives of this group of alien species. It is often impossible to say with certainty whether plants with intermediate morphological features are hybrids (between two species of the same genus). This may also be the case for new ecological forms, resulting from microevolution of species. To confirm or disprove the hypothesis about hybrid origin of certain taxon, it is best to use molecular genetic methods.
DNA was extracted from silica gel dried leaves of
Sample no. | Number of ITS/rpl32–trnL/trnL–trnF sequence in GeneBank | Taxon | Date and place of collection, notes |
---|---|---|---|
de_1a | МК559763/ – /MK575566 | (= “ | Russia, Kaluga region, Milyatinsky Reservoir, 2013 54.4914° N, 34.3393° E |
de _1b | МК559764/ – /MK575567 | ||
de _1c | МК559765/ – / MK575568 | ||
de _1d | МК559766/ – /MK575569 | ||
de _2a | МК559767/ – /MK575570 | Russia, Kaliningrad region, 2013 54.95° N, 20.49° E | |
de _2b | МК559768/ – /MK575571 | ||
de _2c | МК559769/ – /MK575572 | ||
de _2d | МК559770/ – / – | ||
de _3a | МК559771/ – /MK575573 | Russia, Vladimir region, near Tasinsky village, 2014 Formed with dissected lower leaves 55.567° N, 40.172° E | |
de _3b | МК559772/ – / – | ||
de _3c | МК559773/ – / MK575574 | ||
de _4a | МК559774/ – /MK575575 | Russia, Vladimir region, near Tasinsky village, 2014 Formed with whole lower leaves 55.567° N, 40.172° E | |
de _4b | МК559775/ – /MK575576 | ||
fr_5a | МК559780/ – /MK575581 | Russia, Vladimir region, near Tasinsky village, 2014 55.567° N, 40.172° E | |
fr_5b | МК559781/ – /MK575582 | Russia, Vladimir region, near Tasinsky village, 2018 55.567° N, 40.172° E | |
fr_5c | МК559782/ – /MK575583 | ||
cr_6a | МК559755/ – /MK575559 | Russia, Moscow region, near Zvenigorod town, 2014 55.69° N, 36.74° E | |
cr_6b | МК559756/ – /MK575560 | ||
t_7 | МК559754/ – /MK575558 | Russia, Vladimir region, near Tasinsky village, 2018 55.567° N, 40.172° E | |
cr_8a | МК559757/ – /MK575561 | ||
cr_8b | МК559758/ – /MK575562 | ||
cr_8c | МК559759/ – /− | ||
cr_9a | МК559760/ – /MK575563 | Belarus, Dzerzhinsk, 2018 53.693° N, 27.165° E | |
сr_9b | МК559761/ – /MK575564 | ||
cr_9c | МК559762/ – /MK575565 | ||
fr_10a | МК559783/ – /MK575584 | ||
fr_10b | МК559784/ – /MK575585 | ||
de _11a | МК559776/ – /MK575577 | ||
de _11b | МК559777/ – /MK575578 | ||
de _11c | МК559778/ – /MK575579 | ||
de _13 | МК559779/ – /MK575580 | Russia, Moscow, park near Sviblovo estate, 2018 55.8639° N, 37.6396° E | |
v_1a | MK491849/MK474079/ – | Russia, Pskov region, Pskov district, vicinity of Pskov, idle field, 2018 57.80° N, 28.25° E | |
v_1b | MK491850/MK474080/ – | ||
v_1c | MK491851/MK474081/ – | ||
n_2a | MK491852/MK474082/ – | ||
n_2b | MK491853/MK474083/ – | ||
n_2c | – /MK474084/ – | ||
c_3a | MK491854/MK474085/ – | ||
c_3b | MK491855/MK474086/ – | ||
c_3c | MK491856/MK474087/ – | ||
v_4 | – /MK474088/ – | Russia, Moscow region, Chekhov district, near the village of Chudinovo, idle field, 2018 55.1° N, 37.5° E | |
c_5a | MK491857/MK474090/ – | ||
c_5b | – /MK474089/ – | ||
v_6a | MK491858/− / – | Russia, Moscow region, “Losiny Ostrov” National Park, Pine forest, 2014 55.89° N, 37.77° E | |
v_6b | MK491859/− / – | ||
3 | MK397980/− / – | Italy, Pompeii, 2016 40.7° N, 14.5° E | |
5a | MK397981/− / – | Italy, the Island of Ischia, 2016 40.7° N, 13.9° E | |
5b | MK397982/− / – | ||
5c | MK397983/− / – | ||
6 | MK397984/− / – | Italy, Herculaneum, 2016 40.8° N, 14.4° E | |
8a | MK397986/− / – | Italy, Naples, 2016 40.8° N, 14.2° E | |
8b | MK397987/− / – | ||
10a | MK397988/− / – | Italy, Pompeii, 2016 40.7° N, 14.5° E | |
10b | MK397989/− / – | ||
13a | MK397991/− / – | Italy, the Island of Ischia, 2016 40.7° N, 13.9° E | |
13b | MK397992/− / – | ||
16 | MK397985/− / – | Portugal, Lisbon, 2017 38.7° N, 9.1° W | |
18 | MK397993/− / – | Spain, Madrid, park, 2017 40.4° N, 3.7° W | |
19 | MK397994/− / – | ||
20 | MK397995/− / – | ||
22 | MK397990/− / – |
Samples of the studied taxa of Asteraceae.
Note: “E. sumatrensis × E. canadensis (?)” – putative hybrids.
Map of the secondary distribution range of
Nucleotide sequence analysis shows that not all individuals defined as
Fragment of ITS1-ITS2 site of nuclear DNA of various taxa of
Based on the nucleotide sequences of the ITS1-ITS2 site in the SplitsTree program, the dendrogram is built using the UPGMA method (Figure 3). With high probability (with 100% bootstrap support), two clades were separated—sample t_7 (
Dendrogram based on analysis of the ITS region of DNA of various
For trnL-trnF site of chloroplast DNA, samples of
Fragment of the trnL-trnF intergenic spacer of chloroplast DNA of various taxa of
We have set ourselves the task to study the features of
The main difference between the hybrid
Panicles of
The size of the heads themselves also varies (Figure 6).
Parameters of flower heads of
With regard to the length of the head,
Sample no. | Position in the alignment | |||
---|---|---|---|---|
384 | 431 | 508 | 549 | |
v_1a | T | A | C | A |
v_1b | T | A | C | A |
v_1c | T | A | C | A |
n_2a | Y | M | Y | R |
n_2b | Y | M | Y | R |
c_3a | C | C | T | G |
c_3b | C | C | T | G |
c_3c | Y | M | T | R |
c_5a | C | C | T | G |
v_6a | T | A | C | A |
v_6b | T | A | C | A |
ITS1-ITS2 polymorphism for the
The nucleotides are coded using IUPAC nomenclature.
The analysis of the rpl32-trnL high-variable intergenic spacer made it impossible to give an unambiguous answer which species is maternal to
Sample no. | Position in the alignment | ||||
---|---|---|---|---|---|
191 | 242–264 | 271–306 (292–330) | 739–741 (746–748, 709–714) | 894 (900, 923) | |
v_1a | A | — | TGTCTAAAAGAATAATTCTTGTATTTCTT | T | C |
v_1b | C | — | TGTCTAAAAGAATAATTCTTGTATTTCTTGAATTCT | T | C |
v_1c | C | — | TGTCTAAAAGAATAATTCTTGTATTTCTTGAATTCT | — | C |
n_2a | C | — | TGTCTAAAAGAATAATTCTTGTATTTCTTGAATTCT | — | C |
n_2b | C | — | TGTCTAAAAGAATAATTCTTGTATTTCTTGAATTCT | T | C |
n_2c | C | — | TGTCTAAAAGAATAATTCTTGTATTTCTTGAATTCT | T | C |
c_3a | A | GAATCTTAATGTTATGTCTAAA | TGTCTAAAAGAATAATTCTTGTATTTCTT | T | A |
c_3b | A | — | TGTCTAAAAGAATAATTCTTGTATTTCTTGAATTCT | TTTT | A |
c_3c | C | — | — | — | C |
v_4 | C | — | TGTCTAAAAGAATAATTCTTGTATTTCTTGAATTCT | TT | C |
c_5a | C | — | — | T | C |
c_5b | A | — | — | TTTT | A |
Polymorphism of the rpl32-trnL region for the Solidago × niederederi hybrid and parental species.
The nucleotides are coded using IUPAC nomenclature.
Earlier we studied in detail morphological differences between species of the genus
Features | |||
---|---|---|---|
Number of heads/generative shoot | 500–600 | No more 30 | less 500 |
Diameter of heads, mm | 4.8 ± 0.1 × 2.4 ± 0.1 | 6.1 ± 0.1 × 5.2 ± 0.2 | 6.6 ± 0.1 × 3.2 ± 0.2 At the base, swollen |
Structure of shoot systems | The main shoot is barely branched off and ends in a compound raceme occupying the upper third of the escape | The lower lateral deciduous axes of the inflorescence overturn the main shoot axis; the inflorescence covers the upper third of the shoot | The lower lateral deciduous inflorescences are shorter than the main axis of the shoot; the diamond-shaped compound raceme is half the length of the generative shoot |
Shape of leaves | Linear-lanceolate with denticle margin | Almost linear with 3–5 denticles | Lanceolate-oval with a serrated margin |
Type of pubescence | The leaves are light green, slightly pubescent, the stem is light green, strongly pubescent | The leaves are gray-green, the pubescent leaves and stems are strongly pubescent with long silvery trichomes | The leaves are dark green, softly pubescent, the stems are grayish with abundant soft pubescence |
Diagnostic morphological features of
Previously a hybrid of
The analysis of the
Sample no. | Taxa | Position in the alignment | ||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
65, 129, 136, 137, 238, 472/473, 570/571 | 72, 87, 249, 404 | 83, 576/577 | 95 | 114 | 130, 567/568, 568/569 | 211-212 | 242 | 412 | 430 | 461, 584/585 | 469 | 471/472, 530/531, 558/559 | 499/500 | 502/503 | 520/521 | 535/536 | 559/560 | 598-600 | ||
3 | Т | C | A | C | C | T | YY | C | C | G | G | — | C | A | C | R | Y | R | TCT | |
5a | T | C | A | C | C | T | TC | C | C | R | G | — | C | A | C | R | Y | R | TCT | |
5b | T | C | A | C | C | T | TC | C | Y | R | G | — | C | A | C | R | C | R | TCT | |
5c | T | C | A | C | C | T | TC | Y | C | R | G | — | C | A | S | R | Y | R | TCT | |
6 | T | C | A | C | S | T | TC | Y | C | R | G | — | C | A | S | R | Y | R | TCT | |
16 | T | C | A | Y | C | T | YY | C | C | G | G | — | C | A | S | R | C | A | TCT | |
8a | T | C | A | Y | C | T | YY | C | C | R | G | — | C | A | S | G | Y | R | TCT | |
8b | T | C | A | Y | C | T | YY | C | C | R | G | — | C | A | S | R | Y | R | TCT | |
10a | T | C | A | Y | C | T | YY | C | C | G | G | — | C | A | S | R | Y | R | TCT | |
10b | T | C | A | C | C | T | TC | C | C | R | G | — | C | A | S | R | Y | R | TCT | |
22 | T | C | A | Y | C | T | YY | C | C | R | G | — | C | A | Y | R | C | R | TCT | |
13a | C | T | C | C | C | A | CC | C | C | G | G | T | A | T | C | A | C | A | — | |
13b | C | T | C | C | C | A | CC | C | C | G | A | T | A | T | C | A | C | A | — | |
18 | C | T | C | C | C | A | CC | C | C | G | A | T | A | T | C | A | C | A | — | |
19 | C | T | C | C | C | A | CC | C | C | G | A | T | A | T | C | A | C | A | — | |
20 | C | T | C | C | C | A | CC | C | C | G | A | T | A | T | C | A | C | A | — |
ITS1-ITS2 polymorphism for different taxa of
The nucleotides are coded using IUPAC nomenclature.
Note: “E. sumatrensis × E. canadensis (?)” – putative hybrids.
Thus, the obtained data on hybrid activity among the Asteraceae family of invasive species are ambiguous.
Hybrid
In the northwest of Russia, the populations of three taxa of
In Southern Europe, the hybriogenic activity of representatives of the genus
Our data on the rare occurrence of hybrids in comparison with parental species in the Asteraceae family contradict the hypothesis explaining the success of plant growth in the new homeland by strengthening hybridization processes in the secondary distribution range [1, 2], but this situation may change in the coming decades, so the hybriogenic activity of invasive species requires attention of the scientific community.
This study was carried out with partial support from the Russian Foundation for Basic Research, grant no. 18-04-00411.
The authors declare no conflict of interest.
This is a brief overview of the main steps involved in publishing with IntechOpen Compacts, Monographs and Edited Books. Once you submit your proposal you will be appointed a Author Service Manager who will be your single point of contact and lead you through all the described steps below.
",metaTitle:"Publishing Process Steps and Descriptions",metaDescription:"This is a brief overview of the main steps involved in publishing with InTechOpen Compacts, Monographs and Edited Books. Once you submit your proposal you will be appointed a Publishing Process Manager who will be your single point of contact and lead you through all the described steps below.",metaKeywords:null,canonicalURL:"page/publishing-process-steps",contentRaw:'[{"type":"htmlEditorComponent","content":"1. SEND YOUR PROPOSAL
\\n\\nPlease complete the publishing proposal form. The completed form should serve as an overview of your future Compacts, Monograph or Edited Book. Once submitted, your publishing proposal will be sent for evaluation, and a notice of acceptance or rejection will be sent within 10 to 30 working days from the date of submission.
\\n\\n2. SUBMIT YOUR MANUSCRIPT
\\n\\nAfter approval, you will proceed in submitting your full-length manuscript. 50-130 pages for compacts, 130-500 for Monographs & Edited Books.Your full-length manuscript must follow IntechOpen's Author Guidelines and comply with our publishing rules. Once the manuscript is submitted, but before it is forwarded for peer review, it will be screened for plagiarism.
\\n\\n3. PEER REVIEW RESULTS
\\n\\nExternal reviewers will evaluate your manuscript and provide you with their feedback. You may be asked to revise your draft, or parts of your draft, provide additional information and make any other necessary changes according to their comments and suggestions.
\\n\\n4. ACCEPTANCE AND PRICE QUOTE
\\n\\nIf the manuscript is formally accepted after peer review you will receive a formal Notice of Acceptance, and a price quote.
\\n\\nThe Open Access Publishing Fee of your IntechOpen Compacts, Monograph or Edited Book depends on the volume of the publication and includes: project management, editorial and peer review services, technical editing, language copyediting, cover design and book layout, book promotion and ISBN assignment.
\\n\\nWe will send you your price quote and after it has been accepted (by both the author and the publisher), both parties will sign a Statement of Work binding them to adhere to the agreed upon terms.
\\n\\nAt this step you will also be asked to accept the Copyright Agreement.
\\n\\n5. LANGUAGE COPYEDITING, TECHNICAL EDITING AND TYPESET PROOF
\\n\\nYour manuscript will be sent to Straive, a leader in content solution services, for language copyediting. You will then receive a typeset proof formatted in XML and available online in HTML and PDF to proofread and check for completeness. The first typeset proof of your manuscript is usually available 10 days after its original submission.
\\n\\nAfter we receive your proof corrections and a final typeset of the manuscript is approved, your manuscript is sent to our in house DTP department for technical formatting and online publication preparation.
\\n\\nAdditionally, you will be asked to provide a profile picture (face or chest-up portrait photograph) and a short summary of the book which is required for the book cover design.
\\n\\n6. INVOICE PAYMENT
\\n\\nThe invoice is generally paid by the author, the author’s institution or funder. The payment can be made by credit card from your Author Panel (one will be assigned to you at the beginning of the project), or via bank transfer as indicated on the invoice. We currently accept the following payment options:
\\n\\nIntechOpen will help you complete your payment safely and securely, keeping your personal, professional and financial information safe.
\\n\\n7. ONLINE PUBLICATION, PRINT AND DELIVERY OF THE BOOK
\\n\\nIntechOpen authors can choose whether to publish their book online only or opt for online and print editions. IntechOpen Compacts, Monographs and Edited Books will be published on www.intechopen.com. If ordered, print copies are delivered by DHL within 12 to 15 working days.
\\n\\nIf you feel that IntechOpen Compacts, Monographs or Edited Books are the right publishing format for your work, please fill out the publishing proposal form. For any specific queries related to the publishing process, or IntechOpen Compacts, Monographs & Edited Books in general, please contact us at book.department@intechopen.com
\\n"}]'},components:[{type:"htmlEditorComponent",content:'1. SEND YOUR PROPOSAL
\n\nPlease complete the publishing proposal form. The completed form should serve as an overview of your future Compacts, Monograph or Edited Book. Once submitted, your publishing proposal will be sent for evaluation, and a notice of acceptance or rejection will be sent within 10 to 30 working days from the date of submission.
\n\n2. SUBMIT YOUR MANUSCRIPT
\n\nAfter approval, you will proceed in submitting your full-length manuscript. 50-130 pages for compacts, 130-500 for Monographs & Edited Books.Your full-length manuscript must follow IntechOpen's Author Guidelines and comply with our publishing rules. Once the manuscript is submitted, but before it is forwarded for peer review, it will be screened for plagiarism.
\n\n3. PEER REVIEW RESULTS
\n\nExternal reviewers will evaluate your manuscript and provide you with their feedback. You may be asked to revise your draft, or parts of your draft, provide additional information and make any other necessary changes according to their comments and suggestions.
\n\n4. ACCEPTANCE AND PRICE QUOTE
\n\nIf the manuscript is formally accepted after peer review you will receive a formal Notice of Acceptance, and a price quote.
\n\nThe Open Access Publishing Fee of your IntechOpen Compacts, Monograph or Edited Book depends on the volume of the publication and includes: project management, editorial and peer review services, technical editing, language copyediting, cover design and book layout, book promotion and ISBN assignment.
\n\nWe will send you your price quote and after it has been accepted (by both the author and the publisher), both parties will sign a Statement of Work binding them to adhere to the agreed upon terms.
\n\nAt this step you will also be asked to accept the Copyright Agreement.
\n\n5. LANGUAGE COPYEDITING, TECHNICAL EDITING AND TYPESET PROOF
\n\nYour manuscript will be sent to Straive, a leader in content solution services, for language copyediting. You will then receive a typeset proof formatted in XML and available online in HTML and PDF to proofread and check for completeness. The first typeset proof of your manuscript is usually available 10 days after its original submission.
\n\nAfter we receive your proof corrections and a final typeset of the manuscript is approved, your manuscript is sent to our in house DTP department for technical formatting and online publication preparation.
\n\nAdditionally, you will be asked to provide a profile picture (face or chest-up portrait photograph) and a short summary of the book which is required for the book cover design.
\n\n6. INVOICE PAYMENT
\n\nThe invoice is generally paid by the author, the author’s institution or funder. The payment can be made by credit card from your Author Panel (one will be assigned to you at the beginning of the project), or via bank transfer as indicated on the invoice. We currently accept the following payment options:
\n\nIntechOpen will help you complete your payment safely and securely, keeping your personal, professional and financial information safe.
\n\n7. ONLINE PUBLICATION, PRINT AND DELIVERY OF THE BOOK
\n\nIntechOpen authors can choose whether to publish their book online only or opt for online and print editions. IntechOpen Compacts, Monographs and Edited Books will be published on www.intechopen.com. If ordered, print copies are delivered by DHL within 12 to 15 working days.
\n\nIf you feel that IntechOpen Compacts, Monographs or Edited Books are the right publishing format for your work, please fill out the publishing proposal form. For any specific queries related to the publishing process, or IntechOpen Compacts, Monographs & Edited Books in general, please contact us at book.department@intechopen.com
\n'}]},successStories:{items:[]},authorsAndEditors:{filterParams:{},profiles:[{id:"396",title:"Dr.",name:"Vedran",middleName:null,surname:"Kordic",slug:"vedran-kordic",fullName:"Vedran Kordic",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/396/images/7281_n.png",biography:"After obtaining his Master's degree in Mechanical Engineering he continued his education at the Vienna University of Technology where he obtained his PhD degree in 2004. He worked as a researcher at the Automation and Control Institute, Faculty of Electrical Engineering, Vienna University of Technology until 2008. His studies in robotics lead him not only to a PhD degree but also inspired him to co-found and build the International Journal of Advanced Robotic Systems - world's first Open Access journal in the field of robotics.",institutionString:null,institution:{name:"TU Wien",country:{name:"Austria"}}},{id:"441",title:"Ph.D.",name:"Jaekyu",middleName:null,surname:"Park",slug:"jaekyu-park",fullName:"Jaekyu Park",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/441/images/1881_n.jpg",biography:null,institutionString:null,institution:{name:"LG Corporation (South Korea)",country:{name:"Korea, South"}}},{id:"465",title:"Dr",name:"Christian",middleName:null,surname:"Martens",slug:"christian-martens",fullName:"Christian Martens",position:null,profilePictureURL:"//cdnintech.com/web/frontend/www/assets/author.svg",biography:null,institutionString:null,institution:null},{id:"479",title:"Dr.",name:"Valentina",middleName:null,surname:"Colla",slug:"valentina-colla",fullName:"Valentina Colla",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/479/images/358_n.jpg",biography:null,institutionString:null,institution:{name:"Sant'Anna School of Advanced Studies",country:{name:"Italy"}}},{id:"494",title:"PhD",name:"Loris",middleName:null,surname:"Nanni",slug:"loris-nanni",fullName:"Loris Nanni",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/494/images/system/494.jpg",biography:"Loris Nanni received his Master Degree cum laude on June-2002 from the University of Bologna, and the April 26th 2006 he received his Ph.D. in Computer Engineering at DEIS, University of Bologna. On September, 29th 2006 he has won a post PhD fellowship from the university of Bologna (from October 2006 to October 2008), at the competitive examination he was ranked first in the industrial engineering area. He extensively served as referee for several international journals. He is author/coauthor of more than 100 research papers. He has been involved in some projects supported by MURST and European Community. His research interests include pattern recognition, bioinformatics, and biometric systems (fingerprint classification and recognition, signature verification, face recognition).",institutionString:null,institution:null},{id:"496",title:"Dr.",name:"Carlos",middleName:null,surname:"Leon",slug:"carlos-leon",fullName:"Carlos Leon",position:null,profilePictureURL:"//cdnintech.com/web/frontend/www/assets/author.svg",biography:null,institutionString:null,institution:{name:"University of Seville",country:{name:"Spain"}}},{id:"512",title:"Dr.",name:"Dayang",middleName:null,surname:"Jawawi",slug:"dayang-jawawi",fullName:"Dayang Jawawi",position:null,profilePictureURL:"//cdnintech.com/web/frontend/www/assets/author.svg",biography:null,institutionString:null,institution:{name:"University of Technology Malaysia",country:{name:"Malaysia"}}},{id:"528",title:"Dr.",name:"Kresimir",middleName:null,surname:"Delac",slug:"kresimir-delac",fullName:"Kresimir Delac",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/528/images/system/528.jpg",biography:"K. Delac received his B.Sc.E.E. degree in 2003 and is currentlypursuing a Ph.D. degree at the University of Zagreb, Faculty of Electrical Engineering andComputing. His current research interests are digital image analysis, pattern recognition andbiometrics.",institutionString:null,institution:{name:"University of Zagreb",country:{name:"Croatia"}}},{id:"557",title:"Dr.",name:"Andon",middleName:"Venelinov",surname:"Topalov",slug:"andon-topalov",fullName:"Andon Topalov",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/557/images/1927_n.jpg",biography:"Dr. Andon V. Topalov received the MSc degree in Control Engineering from the Faculty of Information Systems, Technologies, and Automation at Moscow State University of Civil Engineering (MGGU) in 1979. He then received his PhD degree in Control Engineering from the Department of Automation and Remote Control at Moscow State Mining University (MGSU), Moscow, in 1984. From 1985 to 1986, he was a Research Fellow in the Research Institute for Electronic Equipment, ZZU AD, Plovdiv, Bulgaria. In 1986, he joined the Department of Control Systems, Technical University of Sofia at the Plovdiv campus, where he is presently a Full Professor. He has held long-term visiting Professor/Scholar positions at various institutions in South Korea, Turkey, Mexico, Greece, Belgium, UK, and Germany. And he has coauthored one book and authored or coauthored more than 80 research papers in conference proceedings and journals. His current research interests are in the fields of intelligent control and robotics.",institutionString:null,institution:{name:"Technical University of Sofia",country:{name:"Bulgaria"}}},{id:"585",title:"Prof.",name:"Munir",middleName:null,surname:"Merdan",slug:"munir-merdan",fullName:"Munir Merdan",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/585/images/system/585.jpg",biography:"Munir Merdan received the M.Sc. degree in mechanical engineering from the Technical University of Sarajevo, Bosnia and Herzegovina, in 2001, and the Ph.D. degree in electrical engineering from the Vienna University of Technology, Vienna, Austria, in 2009.Since 2005, he has been at the Automation and Control Institute, Vienna University of Technology, where he is currently a Senior Researcher. His research interests include the application of agent technology for achieving agile control in the manufacturing environment.",institutionString:null,institution:null},{id:"605",title:"Prof",name:"Dil",middleName:null,surname:"Hussain",slug:"dil-hussain",fullName:"Dil Hussain",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/605/images/system/605.jpg",biography:"Dr. Dil Muhammad Akbar Hussain is a professor of Electronics Engineering & Computer Science at the Department of Energy Technology, Aalborg University Denmark. Professor Akbar has a Master degree in Digital Electronics from Govt. College University, Lahore Pakistan and a P-hD degree in Control Engineering from the School of Engineering and Applied Sciences, University of Sussex United Kingdom. Aalborg University has Two Satellite Campuses, one in Copenhagen (Aalborg University Copenhagen) and the other in Esbjerg (Aalborg University Esbjerg).\n· He is a member of prestigious IEEE (Institute of Electrical and Electronics Engineers), and IAENG (International Association of Engineers) organizations. \n· He is the chief Editor of the Journal of Software Engineering.\n· He is the member of the Editorial Board of International Journal of Computer Science and Software Technology (IJCSST) and International Journal of Computer Engineering and Information Technology. \n· He is also the Editor of Communication in Computer and Information Science CCIS-20 by Springer.\n· Reviewer For Many Conferences\nHe is the lead person in making collaboration agreements between Aalborg University and many universities of Pakistan, for which the MOU’s (Memorandum of Understanding) have been signed.\nProfessor Akbar is working in Academia since 1990, he started his career as a Lab demonstrator/TA at the University of Sussex. After finishing his P. hD degree in 1992, he served in the Industry as a Scientific Officer and continued his academic career as a visiting scholar for a number of educational institutions. In 1996 he joined National University of Science & Technology Pakistan (NUST) as an Associate Professor; NUST is one of the top few universities in Pakistan. In 1999 he joined an International Company Lineo Inc, Canada as Manager Compiler Group, where he headed the group for developing Compiler Tool Chain and Porting of Operating Systems for the BLACKfin processor. The processor development was a joint venture by Intel and Analog Devices. In 2002 Lineo Inc., was taken over by another company, so he joined Aalborg University Denmark as an Assistant Professor.\nProfessor Akbar has truly a multi-disciplined career and he continued his legacy and making progress in many areas of his interests both in teaching and research. He has contributed in stochastic estimation of control area especially, in the Multiple Target Tracking and Interactive Multiple Model (IMM) research, Ball & Beam Control Problem, Robotics, Levitation Control. He has contributed in developing Algorithms for Fingerprint Matching, Computer Vision and Face Recognition. He has been supervising Pattern Recognition, Formal Languages and Distributed Processing projects for several years. He has reviewed many books on Management, Computer Science. Currently, he is an active and permanent reviewer for many international conferences and symposia and the program committee member for many international conferences.\nIn teaching he has taught the core computer science subjects like, Digital Design, Real Time Embedded System Programming, Operating Systems, Software Engineering, Data Structures, Databases, Compiler Construction. In the Engineering side, Digital Signal Processing, Computer Architecture, Electronics Devices, Digital Filtering and Engineering Management.\nApart from his Academic Interest and activities he loves sport especially, Cricket, Football, Snooker and Squash. He plays cricket for Esbjerg city in the second division team as an opener wicket keeper batsman. He is a very good player of squash but has not played squash since his arrival in Denmark.",institutionString:null,institution:null},{id:"611",title:"Prof.",name:"T",middleName:null,surname:"Nagarajan",slug:"t-nagarajan",fullName:"T Nagarajan",position:null,profilePictureURL:"//cdnintech.com/web/frontend/www/assets/author.svg",biography:null,institutionString:null,institution:{name:"Universiti Teknologi Petronas",country:{name:"Malaysia"}}}],filtersByRegion:[{group:"region",caption:"North America",value:1,count:6675},{group:"region",caption:"Middle and South America",value:2,count:5955},{group:"region",caption:"Africa",value:3,count:2460},{group:"region",caption:"Asia",value:4,count:12718},{group:"region",caption:"Australia and Oceania",value:5,count:1018},{group:"region",caption:"Europe",value:6,count:17721}],offset:12,limit:12,total:134178},chapterEmbeded:{data:{}},editorApplication:{success:null,errors:{}},ofsBooks:{filterParams:{hasNoEditors:"0",sort:"-dateEndThirdStepPublish",src:"N-T-0-T2"},books:[{type:"book",id:"9985",title:"Geostatistics",subtitle:null,isOpenForSubmission:!0,hash:"423cb3896195a618c4acb493ce4fd23d",slug:null,bookSignature:"Prof. Jeffrey M. Yarus, Dr. Marko Maucec, Dr. Timothy C. Coburn and Associate Prof. Michael Pyrcz",coverURL:"https://cdn.intechopen.com/books/images_new/9985.jpg",editedByType:null,editors:[{id:"78011",title:"Prof.",name:"Jeffrey M.",surname:"Yarus",slug:"jeffrey-m.-yarus",fullName:"Jeffrey M. Yarus"}],productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"12058",title:"Future Housing",subtitle:null,isOpenForSubmission:!0,hash:"e7f4a1e57fab392b61156956c1247b9e",slug:null,bookSignature:"Dr. Ivan Oropeza-Perez and Dr. Astrid Helena Petzold-Rodríguez",coverURL:"https://cdn.intechopen.com/books/images_new/12058.jpg",editedByType:null,editors:[{id:"282172",title:"Dr.",name:"Ivan",surname:"Oropeza-Perez",slug:"ivan-oropeza-perez",fullName:"Ivan Oropeza-Perez"}],productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"12215",title:"Cell Death and Disease",subtitle:null,isOpenForSubmission:!0,hash:"dfd456a29478fccf4ebd3294137eb1e3",slug:null,bookSignature:"Dr. Ke Xu",coverURL:"https://cdn.intechopen.com/books/images_new/12215.jpg",editedByType:null,editors:[{id:"59529",title:"Dr.",name:"Ke",surname:"Xu",slug:"ke-xu",fullName:"Ke Xu"}],productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"12112",title:"The Colorectal Surgery",subtitle:null,isOpenForSubmission:!0,hash:"21c65e742d31d5b69fb681ef78cfa0be",slug:null,bookSignature:"Dr. Muhammad Shamim",coverURL:"https://cdn.intechopen.com/books/images_new/12112.jpg",editedByType:null,editors:[{id:"235128",title:"Dr.",name:"Muhammad",surname:"Shamim",slug:"muhammad-shamim",fullName:"Muhammad Shamim"}],productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"12079",title:"Strategies Towards the Synthesis of Heterocycles and Their Applications",subtitle:null,isOpenForSubmission:!0,hash:"bc4022af925c0883636e0819008971ee",slug:null,bookSignature:"Dr. Premlata Kumari and Dr. Amit B Patel",coverURL:"https://cdn.intechopen.com/books/images_new/12079.jpg",editedByType:null,editors:[{id:"177041",title:"Dr.",name:"Premlata",surname:"Kumari",slug:"premlata-kumari",fullName:"Premlata Kumari"}],productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"11998",title:"Biocomposites - Recent Advances",subtitle:null,isOpenForSubmission:!0,hash:"8bc7ffd7544fff1901301c787e64fada",slug:null,bookSignature:"Prof. Magdy Elnashar",coverURL:"https://cdn.intechopen.com/books/images_new/11998.jpg",editedByType:null,editors:[{id:"12075",title:"Prof.",name:"Magdy",surname:"Elnashar",slug:"magdy-elnashar",fullName:"Magdy Elnashar"}],productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"11999",title:"Earthquakes - Recent Advances, New Perspectives and Applications",subtitle:null,isOpenForSubmission:!0,hash:"b2af07109b13b76e5af9583532ab5bee",slug:null,bookSignature:"Dr. Walter Salazar",coverURL:"https://cdn.intechopen.com/books/images_new/11999.jpg",editedByType:null,editors:[{id:"236461",title:"Dr.",name:"Walter",surname:"Salazar",slug:"walter-salazar",fullName:"Walter Salazar"}],productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"11500",title:"Multi-Objective Optimization - Recent Advances, New Perspectives and Applications",subtitle:null,isOpenForSubmission:!0,hash:"842f84f308439c0a55c4e8e6a8fd9c01",slug:null,bookSignature:"Dr. Adel El-Shahat",coverURL:"https://cdn.intechopen.com/books/images_new/11500.jpg",editedByType:null,editors:[{id:"193331",title:"Dr.",name:"Adel",surname:"El-Shahat",slug:"adel-el-shahat",fullName:"Adel El-Shahat"}],productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"12172",title:"Health Risks of Food Additives - Recent Developments and Trends in Food Sector",subtitle:null,isOpenForSubmission:!0,hash:"f6aa23b1045d266d0928fcef04fa3417",slug:null,bookSignature:"Dr. Muhammad Sajid Arshad and Mr. Waseem Khalid",coverURL:"https://cdn.intechopen.com/books/images_new/12172.jpg",editedByType:null,editors:[{id:"192998",title:"Dr.",name:"Muhammad Sajid",surname:"Arshad",slug:"muhammad-sajid-arshad",fullName:"Muhammad Sajid Arshad"}],productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"12113",title:"Tendons - Trauma, Inflammation, Degeneration, and Treatment",subtitle:null,isOpenForSubmission:!0,hash:"2387a4e0d2a76883b16dcccd452281ab",slug:null,bookSignature:"Dr. Nahum Rosenberg",coverURL:"https://cdn.intechopen.com/books/images_new/12113.jpg",editedByType:null,editors:[{id:"68911",title:"Dr.",name:"Nahum",surname:"Rosenberg",slug:"nahum-rosenberg",fullName:"Nahum Rosenberg"}],productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"12196",title:"Sepsis - New Perspectives",subtitle:null,isOpenForSubmission:!0,hash:"3590e6f6047122bd96d1d57da29c4054",slug:null,bookSignature:"Dr. Lixing Huang, Dr. Youyu Zhang and Dr. Lingbin Sun",coverURL:"https://cdn.intechopen.com/books/images_new/12196.jpg",editedByType:null,editors:[{id:"333148",title:"Dr.",name:"Lixing",surname:"Huang",slug:"lixing-huang",fullName:"Lixing Huang"}],productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"12050",title:"Advanced Biodiesel - Technological Advances, Challenges, and Sustainability Considerations",subtitle:null,isOpenForSubmission:!0,hash:"bb86ab5c5ca0dab95f01941eb350f920",slug:null,bookSignature:"Dr. IMR Fattah",coverURL:"https://cdn.intechopen.com/books/images_new/12050.jpg",editedByType:null,editors:[{id:"463663",title:"Dr.",name:"IMR",surname:"Fattah",slug:"imr-fattah",fullName:"IMR Fattah"}],productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}}],filtersByTopic:[{group:"topic",caption:"Agricultural and Biological Sciences",value:5,count:38},{group:"topic",caption:"Biochemistry, Genetics and Molecular Biology",value:6,count:12},{group:"topic",caption:"Business, Management and Economics",value:7,count:7},{group:"topic",caption:"Chemistry",value:8,count:22},{group:"topic",caption:"Computer and Information Science",value:9,count:23},{group:"topic",caption:"Earth and Planetary Sciences",value:10,count:15},{group:"topic",caption:"Engineering",value:11,count:63},{group:"topic",caption:"Environmental Sciences",value:12,count:9},{group:"topic",caption:"Immunology and Microbiology",value:13,count:15},{group:"topic",caption:"Materials Science",value:14,count:24},{group:"topic",caption:"Mathematics",value:15,count:11},{group:"topic",caption:"Medicine",value:16,count:112},{group:"topic",caption:"Nanotechnology and Nanomaterials",value:17,count:6},{group:"topic",caption:"Neuroscience",value:18,count:3},{group:"topic",caption:"Pharmacology, Toxicology and Pharmaceutical Science",value:19,count:9},{group:"topic",caption:"Physics",value:20,count:9},{group:"topic",caption:"Psychology",value:21,count:10},{group:"topic",caption:"Robotics",value:22,count:2},{group:"topic",caption:"Social Sciences",value:23,count:9},{group:"topic",caption:"Veterinary Medicine and Science",value:25,count:4}],offset:12,limit:12,total:404},popularBooks:{featuredBooks:[{type:"book",id:"10858",title:"MOOC (Massive Open Online Courses)",subtitle:null,isOpenForSubmission:!1,hash:"d32f86793bc72dde32532f509b1ec5b0",slug:"mooc-massive-open-online-courses-",bookSignature:"Dragan Cvetković",coverURL:"https://cdn.intechopen.com/books/images_new/10858.jpg",editors:[{id:"101330",title:"Dr.",name:"Dragan",middleName:"Mladen",surname:"Cvetković",slug:"dragan-cvetkovic",fullName:"Dragan Cvetković"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"10195",title:"Serotonin and the CNS",subtitle:"New Developments in Pharmacology and Therapeutics",isOpenForSubmission:!1,hash:"7ed9d96da98233a885bd2869a8056c36",slug:"serotonin-and-the-cns-new-developments-in-pharmacology-and-therapeutics",bookSignature:"Berend Olivier",coverURL:"https://cdn.intechopen.com/books/images_new/10195.jpg",editors:[{id:"71579",title:"Prof.",name:"Berend",middleName:null,surname:"Olivier",slug:"berend-olivier",fullName:"Berend Olivier"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"10755",title:"Corporate Governance",subtitle:"Recent Advances and Perspectives",isOpenForSubmission:!1,hash:"ffe06d1d5c4bf0fc2e63511825fe1257",slug:"corporate-governance-recent-advances-and-perspectives",bookSignature:"Okechukwu Lawrence Emeagwali and Feyza Bhatti",coverURL:"https://cdn.intechopen.com/books/images_new/10755.jpg",editors:[{id:"196317",title:"Associate Prof.",name:"Okechukwu Lawrence",middleName:null,surname:"Emeagwali",slug:"okechukwu-lawrence-emeagwali",fullName:"Okechukwu Lawrence Emeagwali"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"11120",title:"Environmental Impact and Remediation of Heavy Metals",subtitle:null,isOpenForSubmission:!1,hash:"9e77514288e7394f1e6cd13481af3509",slug:"environmental-impact-and-remediation-of-heavy-metals",bookSignature:"Hosam M. Saleh and Amal I. Hassan",coverURL:"https://cdn.intechopen.com/books/images_new/11120.jpg",editors:[{id:"144691",title:"Prof.",name:"Hosam M.",middleName:null,surname:"Saleh",slug:"hosam-m.-saleh",fullName:"Hosam M. Saleh"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"10901",title:"Grapes and Wine",subtitle:null,isOpenForSubmission:!1,hash:"5d7f2aa74874444bc6986e613ccebd7c",slug:"grapes-and-wine",bookSignature:"Antonio Morata, Iris Loira and Carmen González",coverURL:"https://cdn.intechopen.com/books/images_new/10901.jpg",editors:[{id:"180952",title:"Prof.",name:"Antonio",middleName:null,surname:"Morata",slug:"antonio-morata",fullName:"Antonio Morata"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"11080",title:"Engineering Principles",subtitle:"Welding and Residual Stresses",isOpenForSubmission:!1,hash:"6c07a13a113bce94174b40096f30fb5e",slug:"engineering-principles-welding-and-residual-stresses",bookSignature:"Kavian Omar Cooke and Ronaldo Câmara Cozza",coverURL:"https://cdn.intechopen.com/books/images_new/11080.jpg",editors:[{id:"138778",title:"Dr.",name:"Kavian",middleName:"Omar",surname:"Cooke",slug:"kavian-cooke",fullName:"Kavian Cooke"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"11332",title:"Essential Oils",subtitle:"Advances in Extractions and Biological Applications",isOpenForSubmission:!1,hash:"742e6cae3a35686f975edc8d7f9afa94",slug:"essential-oils-advances-in-extractions-and-biological-applications",bookSignature:"Mozaniel Santana de Oliveira and Eloisa Helena de Aguiar Andrade",coverURL:"https://cdn.intechopen.com/books/images_new/11332.jpg",editors:[{id:"195290",title:"Ph.D.",name:"Mozaniel",middleName:null,surname:"Santana De Oliveira",slug:"mozaniel-santana-de-oliveira",fullName:"Mozaniel Santana De Oliveira"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"11029",title:"Hepatitis B",subtitle:null,isOpenForSubmission:!1,hash:"609701f502efc3538c112ff47a2c2119",slug:"hepatitis-b",bookSignature:"Luis Rodrigo",coverURL:"https://cdn.intechopen.com/books/images_new/11029.jpg",editors:[{id:"73208",title:"Prof.",name:"Luis",middleName:null,surname:"Rodrigo",slug:"luis-rodrigo",fullName:"Luis Rodrigo"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"9537",title:"Human Rights in the Contemporary World",subtitle:null,isOpenForSubmission:!1,hash:"54f05b93812fd434f3962956d6413a6b",slug:"human-rights-in-the-contemporary-world",bookSignature:"Trudy Corrigan",coverURL:"https://cdn.intechopen.com/books/images_new/9537.jpg",editors:[{id:"197557",title:"Dr.",name:"Trudy",middleName:null,surname:"Corrigan",slug:"trudy-corrigan",fullName:"Trudy Corrigan"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"11371",title:"Cerebral Circulation",subtitle:"Updates on Models, Diagnostics and Treatments of Related Diseases",isOpenForSubmission:!1,hash:"e2d3335445d2852d0b906bb9750e939f",slug:"cerebral-circulation-updates-on-models-diagnostics-and-treatments-of-related-diseases",bookSignature:"Alba Scerrati, Luca Ricciardi and Flavia Dones",coverURL:"https://cdn.intechopen.com/books/images_new/11371.jpg",editors:[{id:"182614",title:"Dr.",name:"Alba",middleName:null,surname:"Scerrati",slug:"alba-scerrati",fullName:"Alba Scerrati"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"11012",title:"Radiopharmaceuticals",subtitle:"Current Research for Better Diagnosis and Therapy",isOpenForSubmission:!1,hash:"f9046d6f96148b285e776f384991120d",slug:"radiopharmaceuticals-current-research-for-better-diagnosis-and-therapy",bookSignature:"Farid A. Badria",coverURL:"https://cdn.intechopen.com/books/images_new/11012.jpg",editors:[{id:"41865",title:"Prof.",name:"Farid A.",middleName:null,surname:"Badria",slug:"farid-a.-badria",fullName:"Farid A. Badria"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"9974",title:"E-Learning and Digital Education in the Twenty-First Century",subtitle:null,isOpenForSubmission:!1,hash:"88b58d66e975df20425fc1dfd22d53aa",slug:"e-learning-and-digital-education-in-the-twenty-first-century",bookSignature:"M. Mahruf C. Shohel",coverURL:"https://cdn.intechopen.com/books/images_new/9974.jpg",editors:[{id:"94099",title:"Dr.",name:"M. Mahruf C.",middleName:null,surname:"Shohel",slug:"m.-mahruf-c.-shohel",fullName:"M. Mahruf C. Shohel"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}}],offset:12,limit:12,total:4431},hotBookTopics:{hotBooks:[],offset:0,limit:12,total:null},publish:{},publishingProposal:{success:null,errors:{}},books:{featuredBooks:[{type:"book",id:"10858",title:"MOOC (Massive Open Online Courses)",subtitle:null,isOpenForSubmission:!1,hash:"d32f86793bc72dde32532f509b1ec5b0",slug:"mooc-massive-open-online-courses-",bookSignature:"Dragan Cvetković",coverURL:"https://cdn.intechopen.com/books/images_new/10858.jpg",publishedDate:"June 23rd 2022",numberOfDownloads:1677,editors:[{id:"101330",title:"Dr.",name:"Dragan",middleName:"Mladen",surname:"Cvetković",slug:"dragan-cvetkovic",fullName:"Dragan Cvetković"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"10195",title:"Serotonin and the CNS",subtitle:"New Developments in Pharmacology and Therapeutics",isOpenForSubmission:!1,hash:"7ed9d96da98233a885bd2869a8056c36",slug:"serotonin-and-the-cns-new-developments-in-pharmacology-and-therapeutics",bookSignature:"Berend Olivier",coverURL:"https://cdn.intechopen.com/books/images_new/10195.jpg",publishedDate:"June 23rd 2022",numberOfDownloads:1337,editors:[{id:"71579",title:"Prof.",name:"Berend",middleName:null,surname:"Olivier",slug:"berend-olivier",fullName:"Berend Olivier"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"10755",title:"Corporate Governance",subtitle:"Recent Advances and Perspectives",isOpenForSubmission:!1,hash:"ffe06d1d5c4bf0fc2e63511825fe1257",slug:"corporate-governance-recent-advances-and-perspectives",bookSignature:"Okechukwu Lawrence Emeagwali and Feyza Bhatti",coverURL:"https://cdn.intechopen.com/books/images_new/10755.jpg",publishedDate:"June 23rd 2022",numberOfDownloads:1309,editors:[{id:"196317",title:"Associate Prof.",name:"Okechukwu Lawrence",middleName:null,surname:"Emeagwali",slug:"okechukwu-lawrence-emeagwali",fullName:"Okechukwu Lawrence Emeagwali"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"11120",title:"Environmental Impact and Remediation of Heavy Metals",subtitle:null,isOpenForSubmission:!1,hash:"9e77514288e7394f1e6cd13481af3509",slug:"environmental-impact-and-remediation-of-heavy-metals",bookSignature:"Hosam M. Saleh and Amal I. Hassan",coverURL:"https://cdn.intechopen.com/books/images_new/11120.jpg",publishedDate:"June 23rd 2022",numberOfDownloads:847,editors:[{id:"144691",title:"Prof.",name:"Hosam M.",middleName:null,surname:"Saleh",slug:"hosam-m.-saleh",fullName:"Hosam M. Saleh"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"10901",title:"Grapes and Wine",subtitle:null,isOpenForSubmission:!1,hash:"5d7f2aa74874444bc6986e613ccebd7c",slug:"grapes-and-wine",bookSignature:"Antonio Morata, Iris Loira and Carmen González",coverURL:"https://cdn.intechopen.com/books/images_new/10901.jpg",publishedDate:"June 15th 2022",numberOfDownloads:2273,editors:[{id:"180952",title:"Prof.",name:"Antonio",middleName:null,surname:"Morata",slug:"antonio-morata",fullName:"Antonio Morata"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"11080",title:"Engineering Principles",subtitle:"Welding and Residual Stresses",isOpenForSubmission:!1,hash:"6c07a13a113bce94174b40096f30fb5e",slug:"engineering-principles-welding-and-residual-stresses",bookSignature:"Kavian Omar Cooke and Ronaldo Câmara Cozza",coverURL:"https://cdn.intechopen.com/books/images_new/11080.jpg",publishedDate:"June 23rd 2022",numberOfDownloads:591,editors:[{id:"138778",title:"Dr.",name:"Kavian",middleName:"Omar",surname:"Cooke",slug:"kavian-cooke",fullName:"Kavian Cooke"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"11332",title:"Essential Oils",subtitle:"Advances in Extractions and Biological Applications",isOpenForSubmission:!1,hash:"742e6cae3a35686f975edc8d7f9afa94",slug:"essential-oils-advances-in-extractions-and-biological-applications",bookSignature:"Mozaniel Santana de Oliveira and Eloisa Helena de Aguiar Andrade",coverURL:"https://cdn.intechopen.com/books/images_new/11332.jpg",publishedDate:"June 23rd 2022",numberOfDownloads:515,editors:[{id:"195290",title:"Ph.D.",name:"Mozaniel",middleName:null,surname:"Santana De Oliveira",slug:"mozaniel-santana-de-oliveira",fullName:"Mozaniel Santana De Oliveira"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"11029",title:"Hepatitis B",subtitle:null,isOpenForSubmission:!1,hash:"609701f502efc3538c112ff47a2c2119",slug:"hepatitis-b",bookSignature:"Luis Rodrigo",coverURL:"https://cdn.intechopen.com/books/images_new/11029.jpg",publishedDate:"June 23rd 2022",numberOfDownloads:413,editors:[{id:"73208",title:"Prof.",name:"Luis",middleName:null,surname:"Rodrigo",slug:"luis-rodrigo",fullName:"Luis Rodrigo"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"9537",title:"Human Rights in the Contemporary World",subtitle:null,isOpenForSubmission:!1,hash:"54f05b93812fd434f3962956d6413a6b",slug:"human-rights-in-the-contemporary-world",bookSignature:"Trudy Corrigan",coverURL:"https://cdn.intechopen.com/books/images_new/9537.jpg",publishedDate:"June 8th 2022",numberOfDownloads:2194,editors:[{id:"197557",title:"Dr.",name:"Trudy",middleName:null,surname:"Corrigan",slug:"trudy-corrigan",fullName:"Trudy Corrigan"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"11371",title:"Cerebral Circulation",subtitle:"Updates on Models, Diagnostics and Treatments of Related Diseases",isOpenForSubmission:!1,hash:"e2d3335445d2852d0b906bb9750e939f",slug:"cerebral-circulation-updates-on-models-diagnostics-and-treatments-of-related-diseases",bookSignature:"Alba Scerrati, Luca Ricciardi and Flavia Dones",coverURL:"https://cdn.intechopen.com/books/images_new/11371.jpg",publishedDate:"June 23rd 2022",numberOfDownloads:341,editors:[{id:"182614",title:"Dr.",name:"Alba",middleName:null,surname:"Scerrati",slug:"alba-scerrati",fullName:"Alba Scerrati"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}}],latestBooks:[{type:"book",id:"11043",title:"Endometriosis",subtitle:"Recent Advances, New Perspectives and Treatments",isOpenForSubmission:!1,hash:"7baf1c70b11d41400bb9302ae9411ca4",slug:"endometriosis-recent-advances-new-perspectives-and-treatments",bookSignature:"Giovana Ap. Gonçalves",coverURL:"https://cdn.intechopen.com/books/images_new/11043.jpg",editedByType:"Edited by",publishedDate:"June 28th 2022",editors:[{id:"185930",title:"Associate Prof.",name:"Giovana",middleName:null,surname:"Gonçalves",slug:"giovana-goncalves",fullName:"Giovana Gonçalves"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"10536",title:"Campylobacter",subtitle:null,isOpenForSubmission:!1,hash:"c4b132b741dd0a2ed539b824ab63965f",slug:"campylobacter",bookSignature:"Guillermo Tellez-Isaias and Saeed El-Ashram",coverURL:"https://cdn.intechopen.com/books/images_new/10536.jpg",editedByType:"Edited by",publishedDate:"June 28th 2022",editors:[{id:"73465",title:"Dr.",name:"Guillermo",middleName:null,surname:"Téllez",slug:"guillermo-tellez",fullName:"Guillermo Téllez"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"10798",title:"Starch",subtitle:"Evolution and Recent Advances",isOpenForSubmission:!1,hash:"f197f6062c1574a9a90e50a369271bcf",slug:"starch-evolution-and-recent-advances",bookSignature:"Martins Ochubiojo Emeje",coverURL:"https://cdn.intechopen.com/books/images_new/10798.jpg",editedByType:"Edited by",publishedDate:"June 28th 2022",editors:[{id:"94311",title:"Prof.",name:"Martins",middleName:"Ochubiojo",surname:"Ochubiojo Emeje",slug:"martins-ochubiojo-emeje",fullName:"Martins Ochubiojo Emeje"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"11083",title:"Hazardous Waste Management",subtitle:null,isOpenForSubmission:!1,hash:"d553bd4f6f1c4b115ca69bd19faac7dc",slug:"hazardous-waste-management",bookSignature:"Rajesh Banu Jeyakumar, Kavitha Sankarapandian and Yukesh Kannah Ravi",coverURL:"https://cdn.intechopen.com/books/images_new/11083.jpg",editedByType:"Edited by",publishedDate:"June 28th 2022",editors:[{id:"218539",title:"Dr.",name:"Rajesh Banu",middleName:null,surname:"Jeyakumar",slug:"rajesh-banu-jeyakumar",fullName:"Rajesh Banu Jeyakumar"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"10848",title:"Tribology of Machine Elements",subtitle:"Fundamentals and Applications",isOpenForSubmission:!1,hash:"3c4ca4c4692ca8d4fa749b4ae81ec1fa",slug:"tribology-of-machine-elements-fundamentals-and-applications",bookSignature:"Giuseppe Pintaude, Tiago Cousseau and Anna Rudawska",coverURL:"https://cdn.intechopen.com/books/images_new/10848.jpg",editedByType:"Edited by",publishedDate:"June 28th 2022",editors:[{id:"18347",title:"Prof.",name:"Giuseppe",middleName:null,surname:"Pintaude",slug:"giuseppe-pintaude",fullName:"Giuseppe Pintaude"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"10856",title:"Crude Oil",subtitle:"New Technologies and Recent Approaches",isOpenForSubmission:!1,hash:"8d0a7ca35b3de95b295dc4eab39a087e",slug:"crude-oil-new-technologies-and-recent-approaches",bookSignature:"Manar Elsayed Abdel-Raouf and Mohamed Hasan El-Keshawy",coverURL:"https://cdn.intechopen.com/books/images_new/10856.jpg",editedByType:"Edited by",publishedDate:"June 28th 2022",editors:[{id:"102626",title:"Prof.",name:"Manar",middleName:null,surname:"Elsayed Abdel-Raouf",slug:"manar-elsayed-abdel-raouf",fullName:"Manar Elsayed Abdel-Raouf"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"9625",title:"Spinocerebellar Ataxia",subtitle:"Concepts, Particularities and Generalities",isOpenForSubmission:!1,hash:"365a7025fd46eb45de2549bdd9d50b98",slug:"spinocerebellar-ataxia-concepts-particularities-and-generalities",bookSignature:"Patricia Bozzetto Ambrosi",coverURL:"https://cdn.intechopen.com/books/images_new/9625.jpg",editedByType:"Edited by",publishedDate:"June 28th 2022",editors:[{id:"221787",title:"Dr.",name:"Patricia",middleName:null,surname:"Bozzetto Ambrosi",slug:"patricia-bozzetto-ambrosi",fullName:"Patricia Bozzetto Ambrosi"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"10905",title:"Plant Defense Mechanisms",subtitle:null,isOpenForSubmission:!1,hash:"84ad5b27dde5f01dc76087d0fd6fa834",slug:"plant-defense-mechanisms",bookSignature:"Josphert Ngui Kimatu",coverURL:"https://cdn.intechopen.com/books/images_new/10905.jpg",editedByType:"Edited by",publishedDate:"June 28th 2022",editors:[{id:"224171",title:"Prof.",name:"Josphert N.",middleName:null,surname:"Kimatu",slug:"josphert-n.-kimatu",fullName:"Josphert N. Kimatu"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"10686",title:"Natural Gas",subtitle:"New Perspectives and Future Developments",isOpenForSubmission:!1,hash:"581763788a6a59e653a9d1d9b5a42d79",slug:"natural-gas-new-perspectives-and-future-developments",bookSignature:"Maryam Takht Ravanchi",coverURL:"https://cdn.intechopen.com/books/images_new/10686.jpg",editedByType:"Edited by",publishedDate:"June 28th 2022",editors:[{id:"2416",title:"Dr.",name:"Maryam",middleName:null,surname:"Takht Ravanchi",slug:"maryam-takht-ravanchi",fullName:"Maryam Takht Ravanchi"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"10988",title:"Railway Transport Planning and Manageme",subtitle:null,isOpenForSubmission:!1,hash:"5cb54cc53caedad9ec78372563c82e2c",slug:"railway-transport-planning-and-management",bookSignature:"Stefano de Luca, Roberta Di Pace and Chiara Fiori",coverURL:"https://cdn.intechopen.com/books/images_new/10988.jpg",editedByType:"Edited by",publishedDate:"June 28th 2022",editors:[{id:"271061",title:"Prof.",name:"Stefano",middleName:null,surname:"de Luca",slug:"stefano-de-luca",fullName:"Stefano de Luca"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}}]},subject:{topic:{id:"1388",title:"Knowledge Management",slug:"management-knowledge-management",parent:{id:"272",title:"Management",slug:"management"},numberOfBooks:2,numberOfSeries:0,numberOfAuthorsAndEditors:19,numberOfWosCitations:9,numberOfCrossrefCitations:27,numberOfDimensionsCitations:41,videoUrl:null,fallbackUrl:null,description:null},booksByTopicFilter:{topicId:"1388",sort:"-publishedDate",limit:12,offset:0},booksByTopicCollection:[{type:"book",id:"7808",title:"Current Issues in Knowledge Management",subtitle:null,isOpenForSubmission:!1,hash:"93933c9bdd9d2d5fc7419959897005bf",slug:"current-issues-in-knowledge-management",bookSignature:"Mark Wickham",coverURL:"https://cdn.intechopen.com/books/images_new/7808.jpg",editedByType:"Edited by",editors:[{id:"195021",title:"Dr.",name:"Mark",middleName:null,surname:"Wickham",slug:"mark-wickham",fullName:"Mark Wickham"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"5605",title:"Parenting",subtitle:"Empirical Advances and Intervention Resources",isOpenForSubmission:!1,hash:"1791ac20219bb1f0832571672b219fbe",slug:"parenting-empirical-advances-and-intervention-resources",bookSignature:"Loredana Benedetto and Massimo Ingrassia",coverURL:"https://cdn.intechopen.com/books/images_new/5605.jpg",editedByType:"Edited by",editors:[{id:"193200",title:"Prof.",name:"Loredana",middleName:null,surname:"Benedetto",slug:"loredana-benedetto",fullName:"Loredana Benedetto"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}}],booksByTopicTotal:2,seriesByTopicCollection:[],seriesByTopicTotal:0,mostCitedChapters:[{id:"55633",doi:"10.5772/intechopen.68933",title:"Parental Self-efficacy in Promoting Children Care and Parenting Quality",slug:"parental-self-efficacy-in-promoting-children-care-and-parenting-quality",totalDownloads:2102,totalCrossrefCites:9,totalDimensionsCites:13,abstract:"Parental self-efficacy (PSE) emerges as a crucial variable into exploring variability in parenting quality. After introducing the link between PSE and parental competence, the role of PSE on parenting quality, its multiple influences, and transactional effects connected to contextual or cultural variables are discussed. The chapter addresses some key issues: (a) the levels of PSE measurement (i.e., domain- or task-specific approach), their interrelationship and magnitude as mutual predictors (study 1); (b) infant-caring, parent’s adjustment, and PSE development in the transition to parenthood (study 2); (c) parenting difficult children and the role of PSE as a “buffer” variable moderating the effects of negative child’s characteristics on parenting skills; and (d) PSE beliefs in family context, the relationships with other family measures (marital self-efficacy and stress), and their associations with children’s adjustments (study 3). Finally, in the study 4, PSE is presented as an outcome variable in a parent training. In all summarized studies, a special attention was devoted to father’s PSE as a specific factor affecting childrearing and parent’s well-being. As Bandura says, PSE is not a personality trait, but a learnable set of beliefs producing positive effects on parenting quality. Suggestions for family-based interventions enhancing PSE are discussed.",book:{id:"5605",slug:"parenting-empirical-advances-and-intervention-resources",title:"Parenting",fullTitle:"Parenting - Empirical Advances and Intervention Resources"},signatures:"Loredana Benedetto and Massimo Ingrassia",authors:[{id:"193200",title:"Prof.",name:"Loredana",middleName:null,surname:"Benedetto",slug:"loredana-benedetto",fullName:"Loredana Benedetto"},{id:"193901",title:"Prof.",name:"Massimo",middleName:null,surname:"Ingrassia",slug:"massimo-ingrassia",fullName:"Massimo Ingrassia"}]},{id:"53767",doi:"10.5772/66985",title:"Parenting Practices and the Development of Internalizing/ Externalizing Problems in Adolescence",slug:"parenting-practices-and-the-development-of-internalizing-externalizing-problems-in-adolescence",totalDownloads:1712,totalCrossrefCites:5,totalDimensionsCites:8,abstract:"This chapter examines the existing relationship between different types of parental practices and the development of internalizing and externalizing behavioral problems in adolescence. Parental involvement and parenting styles are defined and analyzed as possible parameters of adolescent problems, including bullying and victimization. Special emphasis is given to the distinction between behavioral and psychological parental control. Furthermore, issues such as parent‐adolescent conflict, locus of control, and parental values are discussed as correlates of these problems, since prior research has identified them as either risk or protective factors for child and adolescent social and emotional adaptation.",book:{id:"5605",slug:"parenting-empirical-advances-and-intervention-resources",title:"Parenting",fullTitle:"Parenting - Empirical Advances and Intervention Resources"},signatures:"Stelios N. Georgiou and Maria Symeou",authors:[{id:"193345",title:"Prof.",name:"Stelios",middleName:null,surname:"Georgiou",slug:"stelios-georgiou",fullName:"Stelios Georgiou"},{id:"197682",title:"Dr.",name:"Maria",middleName:null,surname:"Symeou",slug:"maria-symeou",fullName:"Maria Symeou"}]},{id:"67167",doi:"10.5772/intechopen.86517",title:"Aligning Human Resource Management with Knowledge Management for Better Organizational Performance: How Human Resource Practices Support Knowledge Management Strategies?",slug:"aligning-human-resource-management-with-knowledge-management-for-better-organizational-performance-h",totalDownloads:1965,totalCrossrefCites:6,totalDimensionsCites:7,abstract:"Contributing to the HR-approach to knowledge management (KM), this chapter aims at outlining the role of human resource management (HRM) in supporting KM through utilizing the theoretical and empirical literature. The article is divided into two sections. The first section presents various knowledge concepts, KM perspectives and KM strategies. This section ends up by linking these topics in a KM sequential model which helps us to track the philosophical underpinnings and perspectives of each KM strategy. The second section investigates various HR orientations and HR practices and situates their differing contextual characteristics under each KM strategy. It aligns various HR practices with different KM strategies; suggesting that HRM is most effective as a combination of practices that are consistent and sharpened in supporting each KM strategy, which is part of the organizational strategy. The debated practices are recruitment and selection, compensation management, training and development, performance management, retention management and career management. Each of those practices is speculated to alter based on the chosen KM strategy; presenting a framework that is useful for practitioners and academics alike. The review ends up by identifying some research gaps and opportunities to be carried out in future studies. Those research gaps, if addressed, will extend our understanding of KM and the supporting role HRM.",book:{id:"7808",slug:"current-issues-in-knowledge-management",title:"Current Issues in Knowledge Management",fullTitle:"Current Issues in Knowledge Management"},signatures:"Hadi El-Farr and Rezvan Hosseingholizadeh",authors:[{id:"293827",title:"Dr.",name:"Hadi",middleName:null,surname:"El-Farr",slug:"hadi-el-farr",fullName:"Hadi El-Farr"},{id:"293834",title:"Dr.",name:"Rezvan",middleName:null,surname:"Hosseingholizadeh",slug:"rezvan-hosseingholizadeh",fullName:"Rezvan Hosseingholizadeh"}]},{id:"59135",doi:"10.5772/intechopen.73540",title:"The Relationship between Parenting and Internalizing Problems in Childhood",slug:"the-relationship-between-parenting-and-internalizing-problems-in-childhood",totalDownloads:1480,totalCrossrefCites:2,totalDimensionsCites:5,abstract:"Several types of stress factors are likely to be implied in the development, maintenance, and transmission of internalizing symptomatology: genetic/temperamental factors, cognitive factors, family factors, and societal/cultural factors. Nonetheless, family factors—especially those related to parenting—seem to be crucial during childhood, because children are nested within their families and family factors are able to indirectly influence other factors as well. The current chapter focuses on the relationship between parental style and internalizing symptoms in childhood. In the first part of the chapter, the most important studies on the topic are reviewed in detail and differences in parenting behaviors between mothers and fathers are illustrated. A discussion on the cognitive and metacognitive factors as possible pathways of the relation between parenting and childhood symptoms is also proposed. The last part of the chapter reviews studies investigating the efficacy of parental involvement in cognitive behavior therapy for children who exhibit internalizing symptoms.",book:{id:"5605",slug:"parenting-empirical-advances-and-intervention-resources",title:"Parenting",fullTitle:"Parenting - Empirical Advances and Intervention Resources"},signatures:"Simona Scaini, Sara Palmieri and Marcella Caputi",authors:[{id:"240074",title:"Dr.",name:"Simona",middleName:null,surname:"Scaini",slug:"simona-scaini",fullName:"Simona Scaini"},{id:"240906",title:"Dr.",name:"Marcella",middleName:null,surname:"Caputi",slug:"marcella-caputi",fullName:"Marcella Caputi"}]},{id:"67575",doi:"10.5772/intechopen.86757",title:"Toward Management Based on Knowledge",slug:"toward-management-based-on-knowledge",totalDownloads:1128,totalCrossrefCites:3,totalDimensionsCites:3,abstract:"In a world overwhelmed with pervasive digital technologies, the organization is transformed and becomes a socio-technical system which is constantly renewed. Organization needs specific skills, adapted to the values and to the cultures peculiar to each location. The cooperation and the mobility become a shape of inescapable work which rests on a permanent personal and collective learning. Beyond the information handled in the digital information systems, the role of the tacit knowledge, which is in each individual’s head, cannot be ignored. A constructivist attitude replaces a determinist attitude strongly deep-rooted in our educational modes. The managers have to pass from a posture of authority and of control to a posture of incitation, of support, and of accompaniment. The notions that are introduced in this chapter result from a managerial and socio-technical vision of knowledge management. They arouse essential reflections to develop a mode of management adapted to the digital transformation of the organizations called management based on knowledge.",book:{id:"7808",slug:"current-issues-in-knowledge-management",title:"Current Issues in Knowledge Management",fullTitle:"Current Issues in Knowledge Management"},signatures:"Michel Grundstein",authors:[{id:"292425",title:"Mr.",name:"Michel",middleName:null,surname:"Grundstein",slug:"michel-grundstein",fullName:"Michel Grundstein"}]}],mostDownloadedChaptersLast30Days:[{id:"55633",title:"Parental Self-efficacy in Promoting Children Care and Parenting Quality",slug:"parental-self-efficacy-in-promoting-children-care-and-parenting-quality",totalDownloads:2099,totalCrossrefCites:9,totalDimensionsCites:13,abstract:"Parental self-efficacy (PSE) emerges as a crucial variable into exploring variability in parenting quality. After introducing the link between PSE and parental competence, the role of PSE on parenting quality, its multiple influences, and transactional effects connected to contextual or cultural variables are discussed. The chapter addresses some key issues: (a) the levels of PSE measurement (i.e., domain- or task-specific approach), their interrelationship and magnitude as mutual predictors (study 1); (b) infant-caring, parent’s adjustment, and PSE development in the transition to parenthood (study 2); (c) parenting difficult children and the role of PSE as a “buffer” variable moderating the effects of negative child’s characteristics on parenting skills; and (d) PSE beliefs in family context, the relationships with other family measures (marital self-efficacy and stress), and their associations with children’s adjustments (study 3). Finally, in the study 4, PSE is presented as an outcome variable in a parent training. In all summarized studies, a special attention was devoted to father’s PSE as a specific factor affecting childrearing and parent’s well-being. As Bandura says, PSE is not a personality trait, but a learnable set of beliefs producing positive effects on parenting quality. Suggestions for family-based interventions enhancing PSE are discussed.",book:{id:"5605",slug:"parenting-empirical-advances-and-intervention-resources",title:"Parenting",fullTitle:"Parenting - Empirical Advances and Intervention Resources"},signatures:"Loredana Benedetto and Massimo Ingrassia",authors:[{id:"193200",title:"Prof.",name:"Loredana",middleName:null,surname:"Benedetto",slug:"loredana-benedetto",fullName:"Loredana Benedetto"},{id:"193901",title:"Prof.",name:"Massimo",middleName:null,surname:"Ingrassia",slug:"massimo-ingrassia",fullName:"Massimo Ingrassia"}]},{id:"67528",title:"The Management, Sharing and Transfer of Knowledge in the Oil Districts - The Case Study of An Italian District",slug:"the-management-sharing-and-transfer-of-knowledge-in-the-oil-districts-the-case-study-of-an-italian-d",totalDownloads:1172,totalCrossrefCites:0,totalDimensionsCites:0,abstract:"Knowledge management is one of the most innovative and effective tools available to companies to manage an economic and organizational ever-changing environment. The chapter is based on an empirical study starting from the classification of oil district and aims to understand how firms’ position affect knowledge transfer process within the district. We support the idea that knowledge transfer is deeply affected by firms’ contractual power as well as by their position within the district. The companies of the industrial districts have the advantage of exploiting and sharing knowledge with each other. The literature generally holds that knowledge transfer requires a sense of equality and fairness among the firms, to create conditions in which firms will share their own knowledge for joint competitive advantage. However, empirical evidence shows that the value chains are often characterized by hierarchical relations and asymmetry between the parties: this feature is particularly evident in the oil districts. For companies attempting to acquire new information, the typologies of their intercompany collaboration and their cultural relationships are crucial.",book:{id:"7808",slug:"current-issues-in-knowledge-management",title:"Current Issues in Knowledge Management",fullTitle:"Current Issues in Knowledge Management"},signatures:"Giovanna Testa",authors:[{id:"293404",title:"Dr.",name:"Giovanna",middleName:null,surname:"Testa",slug:"giovanna-testa",fullName:"Giovanna Testa"}]},{id:"67167",title:"Aligning Human Resource Management with Knowledge Management for Better Organizational Performance: How Human Resource Practices Support Knowledge Management Strategies?",slug:"aligning-human-resource-management-with-knowledge-management-for-better-organizational-performance-h",totalDownloads:1961,totalCrossrefCites:6,totalDimensionsCites:7,abstract:"Contributing to the HR-approach to knowledge management (KM), this chapter aims at outlining the role of human resource management (HRM) in supporting KM through utilizing the theoretical and empirical literature. The article is divided into two sections. The first section presents various knowledge concepts, KM perspectives and KM strategies. This section ends up by linking these topics in a KM sequential model which helps us to track the philosophical underpinnings and perspectives of each KM strategy. The second section investigates various HR orientations and HR practices and situates their differing contextual characteristics under each KM strategy. It aligns various HR practices with different KM strategies; suggesting that HRM is most effective as a combination of practices that are consistent and sharpened in supporting each KM strategy, which is part of the organizational strategy. The debated practices are recruitment and selection, compensation management, training and development, performance management, retention management and career management. Each of those practices is speculated to alter based on the chosen KM strategy; presenting a framework that is useful for practitioners and academics alike. The review ends up by identifying some research gaps and opportunities to be carried out in future studies. Those research gaps, if addressed, will extend our understanding of KM and the supporting role HRM.",book:{id:"7808",slug:"current-issues-in-knowledge-management",title:"Current Issues in Knowledge Management",fullTitle:"Current Issues in Knowledge Management"},signatures:"Hadi El-Farr and Rezvan Hosseingholizadeh",authors:[{id:"293827",title:"Dr.",name:"Hadi",middleName:null,surname:"El-Farr",slug:"hadi-el-farr",fullName:"Hadi El-Farr"},{id:"293834",title:"Dr.",name:"Rezvan",middleName:null,surname:"Hosseingholizadeh",slug:"rezvan-hosseingholizadeh",fullName:"Rezvan Hosseingholizadeh"}]},{id:"53767",title:"Parenting Practices and the Development of Internalizing/ Externalizing Problems in Adolescence",slug:"parenting-practices-and-the-development-of-internalizing-externalizing-problems-in-adolescence",totalDownloads:1708,totalCrossrefCites:5,totalDimensionsCites:8,abstract:"This chapter examines the existing relationship between different types of parental practices and the development of internalizing and externalizing behavioral problems in adolescence. Parental involvement and parenting styles are defined and analyzed as possible parameters of adolescent problems, including bullying and victimization. Special emphasis is given to the distinction between behavioral and psychological parental control. Furthermore, issues such as parent‐adolescent conflict, locus of control, and parental values are discussed as correlates of these problems, since prior research has identified them as either risk or protective factors for child and adolescent social and emotional adaptation.",book:{id:"5605",slug:"parenting-empirical-advances-and-intervention-resources",title:"Parenting",fullTitle:"Parenting - Empirical Advances and Intervention Resources"},signatures:"Stelios N. Georgiou and Maria Symeou",authors:[{id:"193345",title:"Prof.",name:"Stelios",middleName:null,surname:"Georgiou",slug:"stelios-georgiou",fullName:"Stelios Georgiou"},{id:"197682",title:"Dr.",name:"Maria",middleName:null,surname:"Symeou",slug:"maria-symeou",fullName:"Maria Symeou"}]},{id:"59028",title:"Parent Training Interventions for Children and Adolescents with Aggressive Behavioral Problems",slug:"parent-training-interventions-for-children-and-adolescents-with-aggressive-behavioral-problems",totalDownloads:1630,totalCrossrefCites:0,totalDimensionsCites:2,abstract:"Children who display early disruptive and aggressive behavior are also at greater risk for delinquency, mood and anxiety disorders, and substance use in the long term. As is the case for many forms of childhood psychopathology, a number of factors are associated with the emergence of aggressive and disruptive behavior, including family factors. Indeed, conduct problems during childhood are usually associated with peculiar parenting practices, such as increasingly coercive cycles of harsh parenting and noncompliance exhibited by child; insensitive and nonresponsive parenting; inconsistent, severe discipline and vague commands and directions; lack of parental warmth and involvement; and absence of parental monitoring and supervision. That is why behavioral parent trainings (BPTs) represent one of the gold standard interventions for conduct problems. The main goal of BPT is to decrease coercive interchanges and, consequently, children aggressive problems by teaching parents strategies in order to apply a more effective discipline. Therefore, the putative mechanism for change in youth behavior in BPT is change in parent behavior. Some of the most employed parent training interventions for aggressive behavior problems are presented.",book:{id:"5605",slug:"parenting-empirical-advances-and-intervention-resources",title:"Parenting",fullTitle:"Parenting - Empirical Advances and Intervention Resources"},signatures:"Pietro Muratori, Valentina Levantini, Azzurra Manfredi, Laura\nRuglioni and Furio Lambruschi",authors:[{id:"238556",title:"Dr.",name:"Pietro",middleName:null,surname:"Muratori",slug:"pietro-muratori",fullName:"Pietro Muratori"}]}],onlineFirstChaptersFilter:{topicId:"1388",limit:6,offset:0},onlineFirstChaptersCollection:[],onlineFirstChaptersTotal:0},preDownload:{success:null,errors:{}},subscriptionForm:{success:null,errors:{}},aboutIntechopen:{},privacyPolicy:{},peerReviewing:{},howOpenAccessPublishingWithIntechopenWorks:{},sponsorshipBooks:{sponsorshipBooks:[],offset:8,limit:8,total:0},allSeries:{pteSeriesList:[{id:"14",title:"Artificial Intelligence",numberOfPublishedBooks:9,numberOfPublishedChapters:89,numberOfOpenTopics:6,numberOfUpcomingTopics:0,issn:"2633-1403",doi:"10.5772/intechopen.79920",isOpenForSubmission:!0},{id:"7",title:"Biomedical Engineering",numberOfPublishedBooks:12,numberOfPublishedChapters:104,numberOfOpenTopics:3,numberOfUpcomingTopics:0,issn:"2631-5343",doi:"10.5772/intechopen.71985",isOpenForSubmission:!0}],lsSeriesList:[{id:"11",title:"Biochemistry",numberOfPublishedBooks:32,numberOfPublishedChapters:318,numberOfOpenTopics:4,numberOfUpcomingTopics:0,issn:"2632-0983",doi:"10.5772/intechopen.72877",isOpenForSubmission:!0},{id:"25",title:"Environmental Sciences",numberOfPublishedBooks:1,numberOfPublishedChapters:12,numberOfOpenTopics:4,numberOfUpcomingTopics:0,issn:"2754-6713",doi:"10.5772/intechopen.100362",isOpenForSubmission:!0},{id:"10",title:"Physiology",numberOfPublishedBooks:11,numberOfPublishedChapters:141,numberOfOpenTopics:4,numberOfUpcomingTopics:0,issn:"2631-8261",doi:"10.5772/intechopen.72796",isOpenForSubmission:!0}],hsSeriesList:[{id:"3",title:"Dentistry",numberOfPublishedBooks:8,numberOfPublishedChapters:133,numberOfOpenTopics:2,numberOfUpcomingTopics:0,issn:"2631-6218",doi:"10.5772/intechopen.71199",isOpenForSubmission:!0},{id:"6",title:"Infectious Diseases",numberOfPublishedBooks:13,numberOfPublishedChapters:113,numberOfOpenTopics:3,numberOfUpcomingTopics:1,issn:"2631-6188",doi:"10.5772/intechopen.71852",isOpenForSubmission:!0},{id:"13",title:"Veterinary Medicine and Science",numberOfPublishedBooks:11,numberOfPublishedChapters:107,numberOfOpenTopics:3,numberOfUpcomingTopics:0,issn:"2632-0517",doi:"10.5772/intechopen.73681",isOpenForSubmission:!0}],sshSeriesList:[{id:"22",title:"Business, Management and Economics",numberOfPublishedBooks:1,numberOfPublishedChapters:19,numberOfOpenTopics:3,numberOfUpcomingTopics:0,issn:"2753-894X",doi:"10.5772/intechopen.100359",isOpenForSubmission:!0},{id:"23",title:"Education and Human Development",numberOfPublishedBooks:0,numberOfPublishedChapters:5,numberOfOpenTopics:1,numberOfUpcomingTopics:1,issn:null,doi:"10.5772/intechopen.100360",isOpenForSubmission:!0},{id:"24",title:"Sustainable Development",numberOfPublishedBooks:0,numberOfPublishedChapters:15,numberOfOpenTopics:5,numberOfUpcomingTopics:0,issn:null,doi:"10.5772/intechopen.100361",isOpenForSubmission:!0}],testimonialsList:[{id:"13",text:"The collaboration with and support of the technical staff of IntechOpen is fantastic. The whole process of submitting an article and editing of the submitted article goes extremely smooth and fast, the number of reads and downloads of chapters is high, and the contributions are also frequently cited.",author:{id:"55578",name:"Antonio",surname:"Jurado-Navas",institutionString:null,profilePictureURL:"https://s3.us-east-1.amazonaws.com/intech-files/0030O00002bRisIQAS/Profile_Picture_1626166543950",slug:"antonio-jurado-navas",institution:{id:"720",name:"University of Malaga",country:{id:null,name:"Spain"}}}},{id:"6",text:"It is great to work with the IntechOpen to produce a worthwhile collection of research that also becomes a great educational resource and guide for future research endeavors.",author:{id:"259298",name:"Edward",surname:"Narayan",institutionString:null,profilePictureURL:"https://mts.intechopen.com/storage/users/259298/images/system/259298.jpeg",slug:"edward-narayan",institution:{id:"3",name:"University of Queensland",country:{id:null,name:"Australia"}}}}]},series:{item:{id:"6",title:"Infectious Diseases",doi:"10.5772/intechopen.71852",issn:"2631-6188",scope:"This series will provide a comprehensive overview of recent research trends in various Infectious Diseases (as per the most recent Baltimore classification). Topics will include general overviews of infections, immunopathology, diagnosis, treatment, epidemiology, etiology, and current clinical recommendations for managing infectious diseases. Ongoing issues, recent advances, and future diagnostic approaches and therapeutic strategies will also be discussed. This book series will focus on various aspects and properties of infectious diseases whose deep understanding is essential for safeguarding the human race from losing resources and economies due to pathogens.",coverUrl:"https://cdn.intechopen.com/series/covers/6.jpg",latestPublicationDate:"June 25th, 2022",hasOnlineFirst:!0,numberOfPublishedBooks:13,editor:{id:"131400",title:"Prof.",name:"Alfonso J.",middleName:null,surname:"Rodriguez-Morales",slug:"alfonso-j.-rodriguez-morales",fullName:"Alfonso J. Rodriguez-Morales",profilePictureURL:"https://mts.intechopen.com/storage/users/131400/images/system/131400.png",biography:"Dr. Rodriguez-Morales is an expert in tropical and emerging diseases, particularly zoonotic and vector-borne diseases (especially arboviral diseases). He is the president of the Travel Medicine Committee of the Pan-American Infectious Diseases Association (API), as well as the president of the Colombian Association of Infectious Diseases (ACIN). He is a member of the Committee on Tropical Medicine, Zoonoses, and Travel Medicine of ACIN. He is a vice-president of the Latin American Society for Travel Medicine (SLAMVI) and a Member of the Council of the International Society for Infectious Diseases (ISID). Since 2014, he has been recognized as a Senior Researcher, at the Ministry of Science of Colombia. He is a professor at the Faculty of Medicine of the Fundacion Universitaria Autonoma de las Americas, in Pereira, Risaralda, Colombia. He is an External Professor, Master in Research on Tropical Medicine and International Health, Universitat de Barcelona, Spain. He is also a professor at the Master in Clinical Epidemiology and Biostatistics, Universidad Científica del Sur, Lima, Peru. In 2021 he has been awarded the “Raul Isturiz Award” Medal of the API. Also, in 2021, he was awarded with the “Jose Felix Patiño” Asclepius Staff Medal of the Colombian Medical College, due to his scientific contributions to COVID-19 during the pandemic. He is currently the Editor in Chief of the journal Travel Medicine and Infectious Diseases. His Scopus H index is 47 (Google Scholar H index, 68).",institutionString:"Institución Universitaria Visión de las Américas, Colombia",institution:null},editorTwo:null,editorThree:null},subseries:{paginationCount:4,paginationItems:[{id:"3",title:"Bacterial Infectious Diseases",coverUrl:"https://cdn.intechopen.com/series_topics/covers/3.jpg",isOpenForSubmission:!1,annualVolume:null,editor:null,editorTwo:null,editorThree:null},{id:"4",title:"Fungal Infectious Diseases",coverUrl:"https://cdn.intechopen.com/series_topics/covers/4.jpg",isOpenForSubmission:!0,annualVolume:11400,editor:{id:"174134",title:"Dr.",name:"Yuping",middleName:null,surname:"Ran",slug:"yuping-ran",fullName:"Yuping Ran",profilePictureURL:"https://s3.us-east-1.amazonaws.com/intech-files/0030O00002bS9d6QAC/Profile_Picture_1630330675373",biography:"Dr. Yuping Ran, Professor, Department of Dermatology, West China Hospital, Sichuan University, Chengdu, China. Completed the Course Medical Mycology, the Centraalbureau voor Schimmelcultures (CBS), Fungal Biodiversity Centre, Netherlands (2006). International Union of Microbiological Societies (IUMS) Fellow, and International Emerging Infectious Diseases (IEID) Fellow, Centers for Diseases Control and Prevention (CDC), Atlanta, USA. Diploma of Dermatological Scientist, Japanese Society for Investigative Dermatology. Ph.D. of Juntendo University, Japan. Bachelor’s and Master’s degree, Medicine, West China University of Medical Sciences. Chair of Sichuan Medical Association Dermatology Committee. General Secretary of The 19th Annual Meeting of Chinese Society of Dermatology and the Asia Pacific Society for Medical Mycology (2013). In charge of the Annual Medical Mycology Course over 20-years authorized by National Continue Medical Education Committee of China. Member of the board of directors of the Asia-Pacific Society for Medical Mycology (APSMM). Associate editor of Mycopathologia. Vice-chief of the editorial board of Chinses Journal of Mycology, China. Board Member and Chair of Mycology Group of Chinese Society of Dermatology.",institutionString:null,institution:{name:"Sichuan University",institutionURL:null,country:{name:"China"}}},editorTwo:null,editorThree:null},{id:"5",title:"Parasitic Infectious Diseases",coverUrl:"https://cdn.intechopen.com/series_topics/covers/5.jpg",isOpenForSubmission:!0,annualVolume:11401,editor:{id:"67907",title:"Dr.",name:"Amidou",middleName:null,surname:"Samie",slug:"amidou-samie",fullName:"Amidou Samie",profilePictureURL:"https://mts.intechopen.com/storage/users/67907/images/system/67907.jpg",biography:"Dr. Amidou Samie is an Associate Professor of Microbiology at the University of Venda, in South Africa, where he graduated for his PhD in May 2008. He joined the Department of Microbiology the same year and has been giving lectures on topics covering parasitology, immunology, molecular biology and industrial microbiology. He is currently a rated researcher by the National Research Foundation of South Africa at category C2. He has published widely in the field of infectious diseases and has overseen several MSc’s and PhDs. His research activities mostly cover topics on infectious diseases from epidemiology to control. His particular interest lies in the study of intestinal protozoan parasites and opportunistic infections among HIV patients as well as the potential impact of childhood diarrhoea on growth and child development. He also conducts research on water-borne diseases and water quality and is involved in the evaluation of point-of-use water treatment technologies using silver and copper nanoparticles in collaboration with the University of Virginia, USA. He also studies the use of medicinal plants for the control of infectious diseases as well as antimicrobial drug resistance.",institutionString:null,institution:{name:"University of Venda",institutionURL:null,country:{name:"South Africa"}}},editorTwo:null,editorThree:null},{id:"6",title:"Viral Infectious Diseases",coverUrl:"https://cdn.intechopen.com/series_topics/covers/6.jpg",isOpenForSubmission:!0,annualVolume:11402,editor:{id:"158026",title:"Prof.",name:"Shailendra K.",middleName:null,surname:"Saxena",slug:"shailendra-k.-saxena",fullName:"Shailendra K. Saxena",profilePictureURL:"https://s3.us-east-1.amazonaws.com/intech-files/0030O00002bRET3QAO/Profile_Picture_2022-05-10T10:10:26.jpeg",biography:"Professor Dr. Shailendra K. Saxena is a vice dean and professor at King George's Medical University, Lucknow, India. His research interests involve understanding the molecular mechanisms of host defense during human viral infections and developing new predictive, preventive, and therapeutic strategies for them using Japanese encephalitis virus (JEV), HIV, and emerging viruses as a model via stem cell and cell culture technologies. His research work has been published in various high-impact factor journals (Science, PNAS, Nature Medicine) with a high number of citations. He has received many awards and honors in India and abroad including various Young Scientist Awards, BBSRC India Partnering Award, and Dr. JC Bose National Award of Department of Biotechnology, Min. of Science and Technology, Govt. of India. Dr. Saxena is a fellow of various international societies/academies including the Royal College of Pathologists, United Kingdom; Royal Society of Medicine, London; Royal Society of Biology, United Kingdom; Royal Society of Chemistry, London; and Academy of Translational Medicine Professionals, Austria. He was named a Global Leader in Science by The Scientist. He is also an international opinion leader/expert in vaccination for Japanese encephalitis by IPIC (UK).",institutionString:"King George's Medical University",institution:{name:"King George's Medical University",institutionURL:null,country:{name:"India"}}},editorTwo:null,editorThree:null}]},overviewPageOFChapters:{paginationCount:58,paginationItems:[{id:"81961",title:"Antioxidants as an Adjuncts to Periodontal Therapy",doi:"10.5772/intechopen.105016",signatures:"Sura Dakhil Jassim and Ali Abbas Abdulkareem",slug:"antioxidants-as-an-adjuncts-to-periodontal-therapy",totalDownloads:3,totalCrossrefCites:0,totalDimensionsCites:0,authors:null,book:{title:"Dental Trauma",coverURL:"https://cdn.intechopen.com/books/images_new/11567.jpg",subseries:{id:"2",title:"Prosthodontics and Implant Dentistry"}}},{id:"82357",title:"Caries Management Aided by Fluorescence-Based Devices",doi:"10.5772/intechopen.105567",signatures:"Atena Galuscan, Daniela Jumanca and Aurora Doris Fratila",slug:"caries-management-aided-by-fluorescence-based-devices",totalDownloads:4,totalCrossrefCites:0,totalDimensionsCites:0,authors:null,book:{title:"Dental Caries - The Selection of Restoration Methods and Restorative Materials",coverURL:"https://cdn.intechopen.com/books/images_new/11565.jpg",subseries:{id:"1",title:"Oral Health"}}},{id:"81894",title:"Diet and Nutrition and Their Relationship with Early Childhood Dental Caries",doi:"10.5772/intechopen.105123",signatures:"Luanna Gonçalves Ferreira, Giuliana de Campos Chaves Lamarque and Francisco Wanderley Garcia Paula-Silva",slug:"diet-and-nutrition-and-their-relationship-with-early-childhood-dental-caries",totalDownloads:11,totalCrossrefCites:0,totalDimensionsCites:0,authors:null,book:{title:"Dental Caries - The Selection of Restoration Methods and Restorative Materials",coverURL:"https://cdn.intechopen.com/books/images_new/11565.jpg",subseries:{id:"1",title:"Oral Health"}}},{id:"81595",title:"Prosthetic Concepts in Dental Implantology",doi:"10.5772/intechopen.104725",signatures:"Ivica Pelivan",slug:"prosthetic-concepts-in-dental-implantology",totalDownloads:27,totalCrossrefCites:0,totalDimensionsCites:0,authors:null,book:{title:"Current Concepts in Dental Implantology - From Science to Clinical Research",coverURL:"https://cdn.intechopen.com/books/images_new/10808.jpg",subseries:{id:"2",title:"Prosthodontics and Implant Dentistry"}}}]},overviewPagePublishedBooks:{paginationCount:8,paginationItems:[{type:"book",id:"6668",title:"Dental Caries",subtitle:"Diagnosis, Prevention and Management",coverURL:"https://cdn.intechopen.com/books/images_new/6668.jpg",slug:"dental-caries-diagnosis-prevention-and-management",publishedDate:"September 19th 2018",editedByType:"Edited by",bookSignature:"Zühre Akarslan",hash:"b0f7667770a391f772726c3013c1b9ba",volumeInSeries:1,fullTitle:"Dental Caries - Diagnosis, Prevention and Management",editors:[{id:"171887",title:"Prof.",name:"Zühre",middleName:null,surname:"Akarslan",slug:"zuhre-akarslan",fullName:"Zühre Akarslan",profilePictureURL:"https://mts.intechopen.com/storage/users/171887/images/system/171887.jpg",biography:"Zühre Akarslan was born in 1977 in Cyprus. She graduated from Gazi University Faculty of Dentistry, Ankara, Turkey in 2000. \r\nLater she received her Ph.D. degree from the Oral Diagnosis and Radiology Department; which was recently renamed as Oral and Dentomaxillofacial Radiology, from the same university. \r\nShe is working as a full-time Associate Professor and is a lecturer and an academic researcher. \r\nHer expertise areas are dental caries, cancer, dental fear and anxiety, gag reflex in dentistry, oral medicine, and dentomaxillofacial radiology.",institutionString:"Gazi University",institution:{name:"Gazi University",institutionURL:null,country:{name:"Turkey"}}}]},{type:"book",id:"7139",title:"Current Approaches in Orthodontics",subtitle:null,coverURL:"https://cdn.intechopen.com/books/images_new/7139.jpg",slug:"current-approaches-in-orthodontics",publishedDate:"April 10th 2019",editedByType:"Edited by",bookSignature:"Belma Işık Aslan and Fatma Deniz Uzuner",hash:"2c77384eeb748cf05a898d65b9dcb48a",volumeInSeries:2,fullTitle:"Current Approaches in Orthodontics",editors:[{id:"42847",title:"Dr.",name:"Belma",middleName:null,surname:"Işik Aslan",slug:"belma-isik-aslan",fullName:"Belma Işik Aslan",profilePictureURL:"https://mts.intechopen.com/storage/users/42847/images/system/42847.jpg",biography:"Dr. Belma IşIk Aslan was born in 1976 in Ankara-TURKEY. After graduating from TED Ankara College in 1994, she attended to Gazi University, Faculty of Dentistry in Ankara. She completed her PhD in orthodontic education at Gazi University between 1999-2005. Dr. Işık Aslan stayed at the Providence Hospital Craniofacial Institude and Reconstructive Surgery in Michigan, USA for three months as an observer. She worked as a specialist doctor at Gazi University, Dentistry Faculty, Department of Orthodontics between 2005-2014. She was appointed as associate professor in January, 2014 and as professor in 2021. Dr. Işık Aslan still works as an instructor at the same faculty. She has published a total of 35 articles, 10 book chapters, 39 conference proceedings both internationally and nationally. Also she was the academic editor of the international book 'Current Advances in Orthodontics'. She is a member of the Turkish Orthodontic Society and Turkish Cleft Lip and Palate Society. She is married and has 2 children. Her knowledge of English is at an advanced level.",institutionString:"Gazi University Dentistry Faculty Department of Orthodontics",institution:null}]},{type:"book",id:"7572",title:"Trauma in Dentistry",subtitle:null,coverURL:"https://cdn.intechopen.com/books/images_new/7572.jpg",slug:"trauma-in-dentistry",publishedDate:"July 3rd 2019",editedByType:"Edited by",bookSignature:"Serdar Gözler",hash:"7cb94732cfb315f8d1e70ebf500eb8a9",volumeInSeries:3,fullTitle:"Trauma in Dentistry",editors:[{id:"204606",title:"Dr.",name:"Serdar",middleName:null,surname:"Gözler",slug:"serdar-gozler",fullName:"Serdar Gözler",profilePictureURL:"https://mts.intechopen.com/storage/users/204606/images/system/204606.jpeg",biography:"Dr. Serdar Gözler has completed his undergraduate studies at the Marmara University Faculty of Dentistry in 1978, followed by an assistantship in the Prosthesis Department of Dicle University Faculty of Dentistry. Starting his PhD work on non-resilient overdentures with Assoc. Prof. Hüsnü Yavuzyılmaz, he continued his studies with Prof. Dr. Gürbüz Öztürk of Istanbul University Faculty of Dentistry Department of Prosthodontics, this time on Gnatology. He attended training programs on occlusion, neurology, neurophysiology, EMG, radiology and biostatistics. In 1982, he presented his PhD thesis \\Gerber and Lauritzen Occlusion Analysis Techniques: Diagnosis Values,\\ at Istanbul University School of Dentistry, Department of Prosthodontics. As he was also working with Prof. Senih Çalıkkocaoğlu on The Physiology of Chewing at the same time, Gözler has written a chapter in Çalıkkocaoğlu\\'s book \\Complete Prostheses\\ entitled \\The Place of Neuromuscular Mechanism in Prosthetic Dentistry.\\ The book was published five times since by the Istanbul University Publications. Having presented in various conferences about occlusion analysis until 1998, Dr. Gözler has also decided to use the T-Scan II occlusion analysis method. Having been personally trained by Dr. Robert Kerstein on this method, Dr. Gözler has been lecturing on the T-Scan Occlusion Analysis Method in conferences both in Turkey and abroad. Dr. Gözler has various articles and presentations on Digital Occlusion Analysis methods. He is now Head of the TMD Clinic at Prosthodontic Department of Faculty of Dentistry , Istanbul Aydın University , Turkey.",institutionString:"Istanbul Aydin University",institution:{name:"Istanbul Aydın University",institutionURL:null,country:{name:"Turkey"}}}]},{type:"book",id:"7060",title:"Gingival Disease",subtitle:"A Professional Approach for Treatment and Prevention",coverURL:"https://cdn.intechopen.com/books/images_new/7060.jpg",slug:"gingival-disease-a-professional-approach-for-treatment-and-prevention",publishedDate:"October 23rd 2019",editedByType:"Edited by",bookSignature:"Alaa Eddin Omar Al Ostwani",hash:"b81d39988cba3a3cf746c1616912cf41",volumeInSeries:4,fullTitle:"Gingival Disease - A Professional Approach for Treatment and Prevention",editors:[{id:"240870",title:"Ph.D.",name:"Alaa Eddin Omar",middleName:null,surname:"Al Ostwani",slug:"alaa-eddin-omar-al-ostwani",fullName:"Alaa Eddin Omar Al Ostwani",profilePictureURL:"https://mts.intechopen.com/storage/users/240870/images/system/240870.jpeg",biography:"Dr. Al Ostwani Alaa Eddin Omar received his Master in dentistry from Damascus University in 2010, and his Ph.D. in Pediatric Dentistry from Damascus University in 2014. Dr. Al Ostwani is an assistant professor and faculty member at IUST University since 2014. \nDuring his academic experience, he has received several awards including the scientific research award from the Union of Arab Universities, the Syrian gold medal and the international gold medal for invention and creativity. Dr. Al Ostwani is a Member of the International Association of Dental Traumatology and the Syrian Society for Research and Preventive Dentistry since 2017. He is also a Member of the Reviewer Board of International Journal of Dental Medicine (IJDM), and the Indian Journal of Conservative and Endodontics since 2016.",institutionString:"International University for Science and Technology.",institution:{name:"Islamic University of Science and Technology",institutionURL:null,country:{name:"India"}}}]}]},openForSubmissionBooks:{paginationCount:3,paginationItems:[{id:"11570",title:"Influenza - New Approaches",coverURL:"https://cdn.intechopen.com/books/images_new/11570.jpg",hash:"157b379b9d7a4bf5e2cc7a742f155a44",secondStepPassed:!0,currentStepOfPublishingProcess:3,submissionDeadline:"May 10th 2022",isOpenForSubmission:!0,editors:[{id:"139889",title:"Dr.",name:"Seyyed Shamsadin",surname:"Athari",slug:"seyyed-shamsadin-athari",fullName:"Seyyed Shamsadin Athari"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null},{id:"11569",title:"Bacterial Sexually Transmitted Infections - New Findings, Diagnosis, Treatment, and Prevention",coverURL:"https://cdn.intechopen.com/books/images_new/11569.jpg",hash:"069d6142ecb0d46d14920102d48c0e9d",secondStepPassed:!0,currentStepOfPublishingProcess:3,submissionDeadline:"May 31st 2022",isOpenForSubmission:!0,editors:[{id:"189561",title:"Dr.",name:"Mihaela Laura",surname:"Vica",slug:"mihaela-laura-vica",fullName:"Mihaela Laura Vica"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null},{id:"11568",title:"Staphylococcal Infections - Recent Advances and Perspectives",coverURL:"https://cdn.intechopen.com/books/images_new/11568.jpg",hash:"92c881664d1921c7f2d0fee34b78cd08",secondStepPassed:!1,currentStepOfPublishingProcess:2,submissionDeadline:"July 8th 2022",isOpenForSubmission:!0,editors:[{id:"59719",title:"Dr.",name:"Jaime",surname:"Bustos-Martínez",slug:"jaime-bustos-martinez",fullName:"Jaime Bustos-Martínez"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null}]},onlineFirstChapters:{paginationCount:10,paginationItems:[{id:"82380",title:"Evolution of Parasitism and Pathogenic Adaptations in Certain Medically Important Fungi",doi:"10.5772/intechopen.105206",signatures:"Gokul Shankar Sabesan, Ranjit Singh AJA, Ranjith Mehenderkar and Basanta Kumar Mohanty",slug:"evolution-of-parasitism-and-pathogenic-adaptations-in-certain-medically-important-fungi",totalDownloads:4,totalCrossrefCites:0,totalDimensionsCites:0,authors:null,book:{title:"Fungal Infectious Diseases - Annual Volume 2022",coverURL:"https://cdn.intechopen.com/books/images_new/11400.jpg",subseries:{id:"4",title:"Fungal Infectious Diseases"}}},{id:"82367",title:"Spatial Variation and Factors Associated with Unsuppressed HIV Viral Load among Women in an HIV Hyperendemic Area of KwaZulu-Natal, South Africa",doi:"10.5772/intechopen.105547",signatures:"Adenike O. Soogun, Ayesha B.M. Kharsany, Temesgen Zewotir and Delia North",slug:"spatial-variation-and-factors-associated-with-unsuppressed-hiv-viral-load-among-women-in-an-hiv-hype",totalDownloads:11,totalCrossrefCites:0,totalDimensionsCites:0,authors:null,book:{title:"HIV-AIDS - Updates, Perspectives and Applications",coverURL:"https://cdn.intechopen.com/books/images_new/11575.jpg",subseries:{id:"6",title:"Viral Infectious Diseases"}}},{id:"82193",title:"Enterococcal Infections: Recent Nomenclature and emerging trends",doi:"10.5772/intechopen.104792",signatures:"Kavita Raja",slug:"enterococcal-infections-recent-nomenclature-and-emerging-trends",totalDownloads:7,totalCrossrefCites:0,totalDimensionsCites:0,authors:null,book:{title:"Streptococcal Infections",coverURL:"https://cdn.intechopen.com/books/images_new/10828.jpg",subseries:{id:"3",title:"Bacterial Infectious Diseases"}}},{id:"82207",title:"Management Strategies in Perinatal HIV",doi:"10.5772/intechopen.105451",signatures:"Kayla Aleshire and Rima Bazzi",slug:"management-strategies-in-perinatal-hiv",totalDownloads:8,totalCrossrefCites:0,totalDimensionsCites:0,authors:null,book:{title:"HIV-AIDS - Updates, Perspectives and Applications",coverURL:"https://cdn.intechopen.com/books/images_new/11575.jpg",subseries:{id:"6",title:"Viral Infectious Diseases"}}},{id:"82013",title:"Streamlining Laboratory Tests for HIV Detection",doi:"10.5772/intechopen.105096",signatures:"Ramakrishna Prakash and Mysore Krishnamurthy Yashaswini",slug:"streamlining-laboratory-tests-for-hiv-detection",totalDownloads:3,totalCrossrefCites:0,totalDimensionsCites:0,authors:null,book:{title:"HIV-AIDS - Updates, Perspectives and Applications",coverURL:"https://cdn.intechopen.com/books/images_new/11575.jpg",subseries:{id:"6",title:"Viral Infectious Diseases"}}},{id:"81972",title:"The Submicroscopic Plasmodium falciparum Malaria in Sub-Saharan Africa; Current Understanding of the Host Immune System and New Perspectives",doi:"10.5772/intechopen.105086",signatures:"Kwame Kumi Asare",slug:"the-submicroscopic-plasmodium-falciparum-malaria-in-sub-saharan-africa-current-understanding-of-the-",totalDownloads:5,totalCrossrefCites:0,totalDimensionsCites:0,authors:null,book:{title:"Malaria - Recent Advances, and New Perspectives",coverURL:"https://cdn.intechopen.com/books/images_new/11576.jpg",subseries:{id:"5",title:"Parasitic Infectious Diseases"}}},{id:"81821",title:"Pneumococcal Carriage in Jordanian Children and the Importance of Vaccination",doi:"10.5772/intechopen.104999",signatures:"Adnan Al-Lahham",slug:"pneumococcal-carriage-in-jordanian-children-and-the-importance-of-vaccination",totalDownloads:6,totalCrossrefCites:0,totalDimensionsCites:0,authors:null,book:{title:"Streptococcal Infections",coverURL:"https://cdn.intechopen.com/books/images_new/10828.jpg",subseries:{id:"3",title:"Bacterial Infectious Diseases"}}},{id:"81813",title:"Schistosomiasis: Discovery of New Molecules for Disease Treatment and Vaccine Development",doi:"10.5772/intechopen.104738",signatures:"Andressa Barban do Patrocinio",slug:"schistosomiasis-discovery-of-new-molecules-for-disease-treatment-and-vaccine-development",totalDownloads:17,totalCrossrefCites:0,totalDimensionsCites:0,authors:null,book:{title:"New Horizons for Schistosomiasis Research",coverURL:"https://cdn.intechopen.com/books/images_new/10829.jpg",subseries:{id:"5",title:"Parasitic Infectious Diseases"}}},{id:"81644",title:"Perspective Chapter: Ethics of Using Placebo Controlled Trials for Covid-19 Vaccine Development in Vulnerable Populations",doi:"10.5772/intechopen.104776",signatures:"Lesley Burgess, Jurie Jordaan and Matthew Wilson",slug:"perspective-chapter-ethics-of-using-placebo-controlled-trials-for-covid-19-vaccine-development-in-vu",totalDownloads:22,totalCrossrefCites:0,totalDimensionsCites:0,authors:null,book:{title:"SARS-CoV-2 Variants - Two Years After",coverURL:"https://cdn.intechopen.com/books/images_new/11573.jpg",subseries:{id:"6",title:"Viral Infectious Diseases"}}},{id:"80546",title:"Streptococcal Skin and Skin-Structure Infections",doi:"10.5772/intechopen.102894",signatures:"Alwyn Rapose",slug:"streptococcal-skin-and-skin-structure-infections",totalDownloads:64,totalCrossrefCites:0,totalDimensionsCites:0,authors:null,book:{title:"Streptococcal Infections",coverURL:"https://cdn.intechopen.com/books/images_new/10828.jpg",subseries:{id:"3",title:"Bacterial Infectious Diseases"}}}]},subseriesFiltersForOFChapters:[{caption:"Fungal Infectious Diseases",value:4,count:1,group:"subseries"},{caption:"Parasitic Infectious Diseases",value:5,count:2,group:"subseries"},{caption:"Bacterial Infectious Diseases",value:3,count:3,group:"subseries"},{caption:"Viral Infectious Diseases",value:6,count:4,group:"subseries"}],publishedBooks:{paginationCount:1,paginationItems:[{type:"book",id:"10843",title:"Persistent Organic Pollutants (POPs)",subtitle:"Monitoring, Impact and Treatment",coverURL:"https://cdn.intechopen.com/books/images_new/10843.jpg",slug:"persistent-organic-pollutants-pops-monitoring-impact-and-treatment",publishedDate:"April 13th 2022",editedByType:"Edited by",bookSignature:"Mohamed Nageeb Rashed",hash:"f5b1589f0a990b6114fef2dadc735dd9",volumeInSeries:1,fullTitle:"Persistent Organic Pollutants (POPs) - Monitoring, Impact and Treatment",editors:[{id:"63465",title:"Prof.",name:"Mohamed Nageeb",middleName:null,surname:"Rashed",slug:"mohamed-nageeb-rashed",fullName:"Mohamed Nageeb Rashed",profilePictureURL:"https://mts.intechopen.com/storage/users/63465/images/system/63465.gif",institutionString:null,institution:{name:"Aswan University",institutionURL:null,country:{name:"Egypt"}}}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null}]},subseriesFiltersForPublishedBooks:[{group:"subseries",caption:"Pollution",value:38,count:1}],publicationYearFilters:[{group:"publicationYear",caption:"2022",value:2022,count:1}],authors:{paginationCount:301,paginationItems:[{id:"116250",title:"Dr.",name:"Nima",middleName:null,surname:"Rezaei",slug:"nima-rezaei",fullName:"Nima Rezaei",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/116250/images/system/116250.jpg",biography:"Professor Nima Rezaei obtained an MD from Tehran University of Medical Sciences, Iran. He also obtained an MSc in Molecular and Genetic Medicine, and a Ph.D. in Clinical Immunology and Human Genetics from the University of Sheffield, UK. He also completed a short-term fellowship in Pediatric Clinical Immunology and Bone Marrow Transplantation at Newcastle General Hospital, England. Dr. Rezaei is a Full Professor of Immunology and Vice Dean of International Affairs and Research, at the School of Medicine, Tehran University of Medical Sciences, and the co-founder and head of the Research Center for Immunodeficiencies. He is also the founding president of the Universal Scientific Education and Research Network (USERN). Dr. Rezaei has directed more than 100 research projects and has designed and participated in several international collaborative projects. He is an editor, editorial assistant, or editorial board member of more than forty international journals. He has edited more than 50 international books, presented more than 500 lectures/posters in congresses/meetings, and published more than 1,100 scientific papers in international journals.",institutionString:"Tehran University of Medical Sciences",institution:{name:"Tehran University of Medical Sciences",country:{name:"Iran"}}},{id:"180733",title:"Dr.",name:"Jean",middleName:null,surname:"Engohang-Ndong",slug:"jean-engohang-ndong",fullName:"Jean Engohang-Ndong",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/180733/images/system/180733.png",biography:"Dr. Jean Engohang-Ndong was born and raised in Gabon. After obtaining his Associate Degree of Science at the University of Science and Technology of Masuku, Gabon, he continued his education in France where he obtained his BS, MS, and Ph.D. in Medical Microbiology. He worked as a post-doctoral fellow at the Public Health Research Institute (PHRI), Newark, NJ for four years before accepting a three-year faculty position at Brigham Young University-Hawaii. Dr. Engohang-Ndong is a tenured faculty member with the academic rank of Full Professor at Kent State University, Ohio, where he teaches a wide range of biological science courses and pursues his research in medical and environmental microbiology. Recently, he expanded his research interest to epidemiology and biostatistics of chronic diseases in Gabon.",institutionString:"Kent State University",institution:{name:"Kent State University",country:{name:"United States of America"}}},{id:"188773",title:"Prof.",name:"Emmanuel",middleName:null,surname:"Drouet",slug:"emmanuel-drouet",fullName:"Emmanuel Drouet",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/188773/images/system/188773.png",biography:"Emmanuel Drouet, PharmD, is a Professor of Virology at the Faculty of Pharmacy, the University Grenoble-Alpes, France. As a head scientist at the Institute of Structural Biology in Grenoble, Dr. Drouet’s research investigates persisting viruses in humans (RNA and DNA viruses) and the balance with our host immune system. He focuses on these viruses’ effects on humans (both their impact on pathology and their symbiotic relationships in humans). He has an excellent track record in the herpesvirus field, and his group is engaged in clinical research in the field of Epstein-Barr virus diseases. He is the editor of the online Encyclopedia of Environment and he coordinates the Universal Health Coverage education program for the BioHealth Computing Schools of the European Institute of Science.",institutionString:null,institution:{name:"Grenoble Alpes University",country:{name:"France"}}},{id:"131400",title:"Prof.",name:"Alfonso J.",middleName:null,surname:"Rodriguez-Morales",slug:"alfonso-j.-rodriguez-morales",fullName:"Alfonso J. Rodriguez-Morales",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/131400/images/system/131400.png",biography:"Dr. Rodriguez-Morales is an expert in tropical and emerging diseases, particularly zoonotic and vector-borne diseases (especially arboviral diseases). He is the president of the Travel Medicine Committee of the Pan-American Infectious Diseases Association (API), as well as the president of the Colombian Association of Infectious Diseases (ACIN). He is a member of the Committee on Tropical Medicine, Zoonoses, and Travel Medicine of ACIN. He is a vice-president of the Latin American Society for Travel Medicine (SLAMVI) and a Member of the Council of the International Society for Infectious Diseases (ISID). Since 2014, he has been recognized as a Senior Researcher, at the Ministry of Science of Colombia. He is a professor at the Faculty of Medicine of the Fundacion Universitaria Autonoma de las Americas, in Pereira, Risaralda, Colombia. He is an External Professor, Master in Research on Tropical Medicine and International Health, Universitat de Barcelona, Spain. He is also a professor at the Master in Clinical Epidemiology and Biostatistics, Universidad Científica del Sur, Lima, Peru. In 2021 he has been awarded the “Raul Isturiz Award” Medal of the API. Also, in 2021, he was awarded with the “Jose Felix Patiño” Asclepius Staff Medal of the Colombian Medical College, due to his scientific contributions to COVID-19 during the pandemic. He is currently the Editor in Chief of the journal Travel Medicine and Infectious Diseases. His Scopus H index is 47 (Google Scholar H index, 68).",institutionString:"Institución Universitaria Visión de las Américas, Colombia",institution:null},{id:"332819",title:"Dr.",name:"Chukwudi Michael",middleName:"Michael",surname:"Egbuche",slug:"chukwudi-michael-egbuche",fullName:"Chukwudi Michael Egbuche",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/332819/images/14624_n.jpg",biography:"I an Dr. Chukwudi Michael Egbuche. I am a Senior Lecturer in the Department of Parasitology and Entomology, Nnamdi Azikiwe University, Awka.",institutionString:null,institution:{name:"Nnamdi Azikiwe University",country:{name:"Nigeria"}}},{id:"284232",title:"Mr.",name:"Nikunj",middleName:"U",surname:"Tandel",slug:"nikunj-tandel",fullName:"Nikunj Tandel",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/284232/images/8275_n.jpg",biography:'Mr. Nikunj Tandel has completed his Master\'s degree in Biotechnology from VIT University, India in the year of 2012. He is having 8 years of research experience especially in the field of malaria epidemiology, immunology, and nanoparticle-based drug delivery system against the infectious diseases, autoimmune disorders and cancer. He has worked for the NIH funded-International Center of Excellence in Malaria Research project "Center for the study of complex malaria in India (CSCMi)" in collaboration with New York University. The preliminary objectives of the study are to understand and develop the evidence-based tools and interventions for the control and prevention of malaria in different sites of the INDIA. Alongside, with the help of next-generation genomics study, the team has studied the antimalarial drug resistance in India. Further, he has extended his research in the development of Humanized mice for the study of liver-stage malaria and identification of molecular marker(s) for the Artemisinin resistance. At present, his research focuses on understanding the role of B cells in the activation of CD8+ T cells in malaria. Received the CSIR-SRF (Senior Research Fellow) award-2018, FIMSA (Federation of Immunological Societies of Asia-Oceania) Travel Bursary award to attend the IUIS-IIS-FIMSA Immunology course-2019',institutionString:"Nirma University",institution:{name:"Nirma University",country:{name:"India"}}},{id:"334383",title:"Ph.D.",name:"Simone",middleName:"Ulrich",surname:"Ulrich Picoli",slug:"simone-ulrich-picoli",fullName:"Simone Ulrich Picoli",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/334383/images/15919_n.jpg",biography:"Graduated in Pharmacy from Universidade Luterana do Brasil (1999), Master in Agricultural and Environmental Microbiology from Federal University of Rio Grande do Sul (2002), Specialization in Clinical Microbiology from Universidade de São Paulo, USP (2007) and PhD in Sciences in Gastroenterology and Hepatology (2012). She is currently an Adjunct Professor at Feevale University in Medicine and Biomedicine courses and a permanent professor of the Academic Master\\'s Degree in Virology. She has experience in the field of Microbiology, with an emphasis on Bacteriology, working mainly on the following topics: bacteriophages, bacterial resistance, clinical microbiology and food microbiology.",institutionString:null,institution:{name:"Universidade Feevale",country:{name:"Brazil"}}},{id:"229220",title:"Dr.",name:"Amjad",middleName:"Islam",surname:"Aqib",slug:"amjad-aqib",fullName:"Amjad Aqib",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/229220/images/system/229220.png",biography:"Dr. Amjad Islam Aqib obtained a DVM and MSc (Hons) from University of Agriculture Faisalabad (UAF), Pakistan, and a PhD from the University of Veterinary and Animal Sciences Lahore, Pakistan. Dr. Aqib joined the Department of Clinical Medicine and Surgery at UAF for one year as an assistant professor where he developed a research laboratory designated for pathogenic bacteria. Since 2018, he has been Assistant Professor/Officer in-charge, Department of Medicine, Manager Research Operations and Development-ORIC, and President One Health Club at Cholistan University of Veterinary and Animal Sciences, Bahawalpur, Pakistan. He has nearly 100 publications to his credit. His research interests include epidemiological patterns and molecular analysis of antimicrobial resistance and modulation and vaccine development against animal pathogens of public health concern.",institutionString:"Cholistan University of Veterinary and Animal Sciences",institution:null},{id:"62900",title:"Prof.",name:"Fethi",middleName:null,surname:"Derbel",slug:"fethi-derbel",fullName:"Fethi Derbel",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/62900/images/system/62900.jpeg",biography:"Professor Fethi Derbel was born in 1960 in Tunisia. He received his medical degree from the Sousse Faculty of Medicine at Sousse, University of Sousse, Tunisia. He completed his surgical residency in General Surgery at the University Hospital Farhat Hached of Sousse and was a member of the Unit of Liver Transplantation in the University of Rennes, France. He then worked in the Department of Surgery at the Sahloul University Hospital in Sousse. Professor Derbel is presently working at the Clinique les Oliviers, Sousse, Tunisia. His hospital activities are mostly concerned with laparoscopic, colorectal, pancreatic, hepatobiliary, and gastric surgery. He is also very interested in hernia surgery and performs ventral hernia repairs and inguinal hernia repairs. He has been a member of the GREPA and Tunisian Hernia Society (THS). During his residency, he managed patients suffering from diabetic foot, and he was very interested in this pathology. For this reason, he decided to coordinate a book project dealing with the diabetic foot. Professor Derbel has published many articles in journals and collaborates intensively with IntechOpen Access Publisher as an editor.",institutionString:"Clinique les Oliviers",institution:null},{id:"300144",title:"Dr.",name:"Meriem",middleName:null,surname:"Braiki",slug:"meriem-braiki",fullName:"Meriem Braiki",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/300144/images/system/300144.jpg",biography:"Dr. Meriem Braiki is a specialist in pediatric surgeon from Tunisia. She was born in 1985. She received her medical degree from the University of Medicine at Sousse, Tunisia. She achieved her surgical residency training periods in Pediatric Surgery departments at University Hospitals in Monastir, Tunis and France.\r\nShe is currently working at the Pediatric surgery department, Sidi Bouzid Hospital, Tunisia. Her hospital activities are mostly concerned with laparoscopic, parietal, urological and digestive surgery. She has published several articles in diffrent journals.",institutionString:"Sidi Bouzid Regional Hospital",institution:null},{id:"229481",title:"Dr.",name:"Erika M.",middleName:"Martins",surname:"de Carvalho",slug:"erika-m.-de-carvalho",fullName:"Erika M. de Carvalho",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/229481/images/6397_n.jpg",biography:null,institutionString:null,institution:{name:"Oswaldo Cruz Foundation",country:{name:"Brazil"}}},{id:"186537",title:"Prof.",name:"Tonay",middleName:null,surname:"Inceboz",slug:"tonay-inceboz",fullName:"Tonay Inceboz",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/186537/images/system/186537.jfif",biography:"I was graduated from Ege University of Medical Faculty (Turkey) in 1988 and completed his Med. PhD degree in Medical Parasitology at the same university. I became an Associate Professor in 2008 and Professor in 2014. I am currently working as a Professor at the Department of Medical Parasitology at Dokuz Eylul University, Izmir, Turkey.\n\nI have given many lectures, presentations in different academic meetings. I have more than 60 articles in peer-reviewed journals, 18 book chapters, 1 book editorship.\n\nMy research interests are Echinococcus granulosus, Echinococcus multilocularis (diagnosis, life cycle, in vitro and in vivo cultivation), and Trichomonas vaginalis (diagnosis, PCR, and in vitro cultivation).",institutionString:"Dokuz Eylül University",institution:{name:"Dokuz Eylül University",country:{name:"Turkey"}}},{id:"71812",title:"Prof.",name:"Hanem Fathy",middleName:"Fathy",surname:"Khater",slug:"hanem-fathy-khater",fullName:"Hanem Fathy Khater",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/71812/images/1167_n.jpg",biography:"Prof. Khater is a Professor of Parasitology at Benha University, Egypt. She studied for her doctoral degree, at the Department of Entomology, College of Agriculture, Food and Natural Resources, University of Missouri, Columbia, USA. She has completed her Ph.D. degrees in Parasitology in Egypt, from where she got the award for “the best scientific Ph.D. dissertation”. She worked at the School of Biological Sciences, Bristol, England, the UK in controlling insects of medical and veterinary importance as a grant from Newton Mosharafa, the British Council. Her research is focused on searching of pesticides against mosquitoes, house flies, lice, green bottle fly, camel nasal botfly, soft and hard ticks, mites, and the diamondback moth as well as control of several parasites using safe and natural materials to avoid drug resistances and environmental contamination.",institutionString:null,institution:{name:"Banha University",country:{name:"Egypt"}}},{id:"99780",title:"Prof.",name:"Omolade",middleName:"Olayinka",surname:"Okwa",slug:"omolade-okwa",fullName:"Omolade Okwa",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/99780/images/system/99780.jpg",biography:"Omolade Olayinka Okwa is presently a Professor of Parasitology at Lagos State University, Nigeria. She has a PhD in Parasitology (1997), an MSc in Cellular Parasitology (1992), and a BSc (Hons) Zoology (1990) all from the University of Ibadan, Nigeria. She teaches parasitology at the undergraduate and postgraduate levels. She was a recipient of a Commonwealth fellowship supported by British Council tenable at the Centre for Entomology and Parasitology (CAEP), Keele University, United Kingdom between 2004 and 2005. She was awarded an Honorary Visiting Research Fellow at the same university from 2005 to 2007. \nShe has been an external examiner to the Department of Veterinary Microbiology and Parasitology, University of Ibadan, MSc programme between 2010 and 2012. She is a member of the Nigerian Society of Experimental Biology (NISEB), Parasitology and Public Health Society of Nigeria (PPSN), Science Association of Nigeria (SAN), Zoological Society of Nigeria (ZSN), and is Vice Chairperson of the Organisation of Women in Science (OWSG), LASU chapter. She served as Head of Department of Zoology and Environmental Biology, Lagos State University from 2007 to 2010 and 2014 to 2016. She is a reviewer for several local and international journals such as Unilag Journal of Science, Libyan Journal of Medicine, Journal of Medicine and Medical Sciences, and Annual Research and Review in Science. \nShe has authored 45 scientific research publications in local and international journals, 8 scientific reviews, 4 books, and 3 book chapters, which includes the books “Malaria Parasites” and “Malaria” which are IntechOpen access publications.",institutionString:"Lagos State University",institution:{name:"Lagos State University",country:{name:"Nigeria"}}},{id:"273100",title:"Dr.",name:"Vijay",middleName:null,surname:"Gayam",slug:"vijay-gayam",fullName:"Vijay Gayam",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/273100/images/system/273100.jpeg",biography:"Dr. Vijay Bhaskar Reddy Gayam is currently practicing as an internist at Interfaith Medical Center in Brooklyn, New York, USA. He is also a Clinical Assistant Professor at the SUNY Downstate University Hospital and Adjunct Professor of Medicine at the American University of Antigua. He is a holder of an M.B.B.S. degree bestowed to him by Osmania Medical College and received his M.D. at Interfaith Medical Center. His career goals thus far have heavily focused on direct patient care, medical education, and clinical research. He currently serves in two leadership capacities; Assistant Program Director of Medicine at Interfaith Medical Center and as a Councilor for the American\r\nFederation for Medical Research. As a true academician and researcher, he has more than 50 papers indexed in international peer-reviewed journals. He has also presented numerous papers in multiple national and international scientific conferences. His areas of research interest include general internal medicine, gastroenterology and hepatology. He serves as an editor, editorial board member and reviewer for multiple international journals. His research on Hepatitis C has been very successful and has led to multiple research awards, including the 'Equity in Prevention and Treatment Award” from the New York Department of Health Viral Hepatitis Symposium (2018) and the 'Presidential Poster Award” awarded to him by the American College of Gastroenterology (2018). He was also awarded 'Outstanding Clinician in General Medicine” by Venus International Foundation for his extensive research expertise and services, perform over and above the standard expected in the advancement of healthcare, patient safety and quality of care.",institutionString:"Interfaith Medical Center",institution:{name:"Interfaith Medical Center",country:{name:"United States of America"}}},{id:"93517",title:"Dr.",name:"Clement",middleName:"Adebajo",surname:"Meseko",slug:"clement-meseko",fullName:"Clement Meseko",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/93517/images/system/93517.jpg",biography:"Dr. Clement Meseko obtained DVM and PhD degree in Veterinary Medicine and Virology respectively. He has worked for over 20 years in both private and public sectors including the academia, contributing to knowledge and control of infectious disease. Through the application of epidemiological skill, classical and molecular virological skills, he investigates viruses of economic and public health importance for the mitigation of the negative impact on people, animal and the environment in the context of Onehealth. \r\nDr. Meseko’s field experience on animal and zoonotic diseases and pathogen dynamics at the human-animal interface over the years shaped his carrier in research and scientific inquiries. He has been part of the investigation of Highly Pathogenic Avian Influenza incursions in sub Saharan Africa and monitors swine Influenza (Pandemic influenza Virus) agro-ecology and potential for interspecies transmission. He has authored and reviewed a number of journal articles and book chapters.",institutionString:"National Veterinary Research Institute",institution:{name:"National Veterinary Research Institute",country:{name:"Nigeria"}}},{id:"158026",title:"Prof.",name:"Shailendra K.",middleName:null,surname:"Saxena",slug:"shailendra-k.-saxena",fullName:"Shailendra K. Saxena",position:null,profilePictureURL:"https://s3.us-east-1.amazonaws.com/intech-files/0030O00002bRET3QAO/Profile_Picture_2022-05-10T10:10:26.jpeg",biography:"Professor Dr. Shailendra K. Saxena is a vice dean and professor at King George's Medical University, Lucknow, India. His research interests involve understanding the molecular mechanisms of host defense during human viral infections and developing new predictive, preventive, and therapeutic strategies for them using Japanese encephalitis virus (JEV), HIV, and emerging viruses as a model via stem cell and cell culture technologies. His research work has been published in various high-impact factor journals (Science, PNAS, Nature Medicine) with a high number of citations. He has received many awards and honors in India and abroad including various Young Scientist Awards, BBSRC India Partnering Award, and Dr. JC Bose National Award of Department of Biotechnology, Min. of Science and Technology, Govt. of India. Dr. Saxena is a fellow of various international societies/academies including the Royal College of Pathologists, United Kingdom; Royal Society of Medicine, London; Royal Society of Biology, United Kingdom; Royal Society of Chemistry, London; and Academy of Translational Medicine Professionals, Austria. He was named a Global Leader in Science by The Scientist. He is also an international opinion leader/expert in vaccination for Japanese encephalitis by IPIC (UK).",institutionString:"King George's Medical University",institution:{name:"King George's Medical University",country:{name:"India"}}},{id:"94928",title:"Dr.",name:"Takuo",middleName:null,surname:"Mizukami",slug:"takuo-mizukami",fullName:"Takuo Mizukami",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/94928/images/6402_n.jpg",biography:null,institutionString:null,institution:{name:"National Institute of Infectious Diseases",country:{name:"Japan"}}},{id:"233433",title:"Dr.",name:"Yulia",middleName:null,surname:"Desheva",slug:"yulia-desheva",fullName:"Yulia Desheva",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/233433/images/system/233433.png",biography:"Dr. Yulia Desheva is a leading researcher at the Institute of Experimental Medicine, St. Petersburg, Russia. She is a professor in the Stomatology Faculty, St. Petersburg State University. She has expertise in the development and evaluation of a wide range of live mucosal vaccines against influenza and bacterial complications. Her research interests include immunity against influenza and COVID-19 and the development of immunization schemes for high-risk individuals.",institutionString:'Federal State Budgetary Scientific Institution "Institute of Experimental Medicine"',institution:null},{id:"238958",title:"Mr.",name:"Atamjit",middleName:null,surname:"Singh",slug:"atamjit-singh",fullName:"Atamjit Singh",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/238958/images/6575_n.jpg",biography:null,institutionString:null,institution:null},{id:"333753",title:"Dr.",name:"Rais",middleName:null,surname:"Ahmed",slug:"rais-ahmed",fullName:"Rais Ahmed",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/333753/images/20168_n.jpg",biography:null,institutionString:null,institution:null},{id:"252058",title:"M.Sc.",name:"Juan",middleName:null,surname:"Sulca",slug:"juan-sulca",fullName:"Juan Sulca",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/252058/images/12834_n.jpg",biography:null,institutionString:null,institution:null},{id:"191392",title:"Dr.",name:"Marimuthu",middleName:null,surname:"Govindarajan",slug:"marimuthu-govindarajan",fullName:"Marimuthu Govindarajan",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/191392/images/5828_n.jpg",biography:"Dr. M. Govindarajan completed his BSc degree in Zoology at Government Arts College (Autonomous), Kumbakonam, and MSc, MPhil, and PhD degrees at Annamalai University, Annamalai Nagar, Tamil Nadu, India. He is serving as an assistant professor at the Department of Zoology, Annamalai University. His research interests include isolation, identification, and characterization of biologically active molecules from plants and microbes. He has identified more than 20 pure compounds with high mosquitocidal activity and also conducted high-quality research on photochemistry and nanosynthesis. He has published more than 150 studies in journals with impact factor and 2 books in Lambert Academic Publishing, Germany. He serves as an editorial board member in various national and international scientific journals.",institutionString:null,institution:null},{id:"274660",title:"Dr.",name:"Damodar",middleName:null,surname:"Paudel",slug:"damodar-paudel",fullName:"Damodar Paudel",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/274660/images/8176_n.jpg",biography:"I am DrDamodar Paudel,currently working as consultant Physician in Nepal police Hospital.",institutionString:null,institution:null},{id:"241562",title:"Dr.",name:"Melvin",middleName:null,surname:"Sanicas",slug:"melvin-sanicas",fullName:"Melvin Sanicas",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/241562/images/6699_n.jpg",biography:null,institutionString:null,institution:null},{id:"337446",title:"Dr.",name:"Maria",middleName:null,surname:"Zavala-Colon",slug:"maria-zavala-colon",fullName:"Maria Zavala-Colon",position:null,profilePictureURL:"//cdnintech.com/web/frontend/www/assets/author.svg",biography:null,institutionString:null,institution:{name:"University of Puerto Rico, Medical Sciences Campus",country:{name:"United States of America"}}},{id:"338856",title:"Mrs.",name:"Nur Alvira",middleName:null,surname:"Pascawati",slug:"nur-alvira-pascawati",fullName:"Nur Alvira Pascawati",position:null,profilePictureURL:"//cdnintech.com/web/frontend/www/assets/author.svg",biography:null,institutionString:null,institution:{name:"Universitas Respati Yogyakarta",country:{name:"Indonesia"}}},{id:"441116",title:"Dr.",name:"Jovanka M.",middleName:null,surname:"Voyich",slug:"jovanka-m.-voyich",fullName:"Jovanka M. Voyich",position:null,profilePictureURL:"//cdnintech.com/web/frontend/www/assets/author.svg",biography:null,institutionString:null,institution:{name:"Montana State University",country:{name:"United States of America"}}},{id:"330412",title:"Dr.",name:"Muhammad",middleName:null,surname:"Farhab",slug:"muhammad-farhab",fullName:"Muhammad Farhab",position:null,profilePictureURL:"//cdnintech.com/web/frontend/www/assets/author.svg",biography:null,institutionString:null,institution:{name:"University of Agriculture Faisalabad",country:{name:"Pakistan"}}},{id:"349495",title:"Dr.",name:"Muhammad",middleName:null,surname:"Ijaz",slug:"muhammad-ijaz",fullName:"Muhammad Ijaz",position:null,profilePictureURL:"//cdnintech.com/web/frontend/www/assets/author.svg",biography:null,institutionString:null,institution:{name:"University of Veterinary and Animal Sciences",country:{name:"Pakistan"}}}]}},subseries:{item:{id:"95",type:"subseries",title:"Urban Planning and Environmental Management",keywords:"Circular economy, Contingency planning and response to disasters, Ecosystem services, Integrated urban water management, Nature-based solutions, Sustainable urban development, Urban green spaces",scope:"