Simple and Fast DNA-Based Tool to Investigate Topoisomerase 1 Activity, a Biomarker for Drug Susceptibility in Colorectal Cancer

Abstract

With the increased effort for identification of anticancer compounds, there is a growing need for tools to investigate the activity of enzyme biomarkers. Human topoisomerase 1 is the only target of the camptothecin derivatives, and the cellular drug response depends on the enzyme activity. Here we use the colon cancer cell line Caco2 to investigate the topoisomerase 1 activity using a simple and improved version of our rolling circle enhanced enzyme activity detection, the REEAD assay. We present two fast readout methods that do not require the use of specialized training or equipment. In this setup, topoisomerase 1 converts specific DNA substrates to closed circles. The circles are amplified by rolling circle amplification in the presence of biotinylated nucleotides allowing for the detection of the products using horse radish peroxidase conjugated anti-biotin antibodies. The visualization occurs by either ECL or by color development through the precipitation of the TMB onto the surface. The presented readouts allow for fast and sensitive screening of topoisomerase 1 activity in extracts from Caco2 cells, potentially enabling the patients’ stratification and the prediction of the chemotherapeutic response for individualized treatment. For these reasons, we believe that the presented method would be easily adaptable to the clinical settings.

1. Introduction

Colorectal cancer is the third most common cancer worldwide with more than 1.9 million new cases in 2020 [1]. Camptothecin (CPT) is the mother compound of a class of molecules that specifically targets the Topoisomerase 1 enzyme (TOP1) [2, 3, 4]. Currently, derivatives of the camptothecin (CPTs) family such as irinotecan are in clinical use for treatment of advanced stage of colorectal malignancies [5, 6, 7]. However, despite promising results [5], only a subset of the patients respond well to CPTs-based treatment and the development of chemoresistance remains a major issue [4, 8, 9, 10]. Tumor cells are characterized by a high degree of heterogeneity not only in morphology, but also in the functionality of the cells, including the activity of intracellular enzymes [11, 12]. Hence, investigation of TOP1 activity is a good biomarker for determining the response to CPTs-based anticancer treatment.

TOP1 maintains the genomic DNA integrity by regulating the DNA topology during replication and transcription. This is achieved by introducing a transient nick in the double-stranded DNA and the formation of a DNA-TOP1 cleavage complex (TOP1cc). The TOP1 enzyme becomes covalently attached to the 3′end of the DNA, and this is followed by a rapid religation of the scissile strand. These cleavage and ligation reactions allow for the relaxation of the supercoiling state of the DNA [13]. Although the cleavage-ligation reactions are fast, CPTs are able to reversibly bind to the interface of TOP1cc and selectively inhibit the religation step of the TOP1 catalysis, thereby prolonging the half-life of TOP1cc [14]. Upon collision with the replication- or transcription machinery, TOP1cc is converted to permanent double-stranded breaks resulting in genome fragmentation, which potentially can cause cell death [15, 16]. Hence, CPTs convert the activity of TOP1 into a cell poison, explaining the direct correlation between TOP1 activity and the TOP1 susceptibility to CPTs [17, 18, 19, 20]. Consistent with the cytotoxic effect of CPTs, high level of TOP1 activity is associated with high CPTs’ sensitivity, and these drugs are indeed particularly effective on fast dividing cells, such as cancer cells, where TOP1 is generally upregulated to manage the increased number of S-phase cycles [15, 21, 22]. Therefore, common mechanisms behind chemoresistance toward CPTs include downregulation of TOP1 level [17, 19, 20, 23, 24, 25, 26, 27, 28] or mutations in the TOP1 gene leaving the enzyme insensitive toward CPTs [8, 29, 30, 31, 32]. Cancer cells are frequently observed to have an upregulated activity of TOP1 [33, 34, 35], and enzyme activity can be regulated posttranslationally and not necessarily correlate to the TOP1 protein levels in the cells [36, 37]. Hence, a central aspect in investigating biomarkers for drug resistance is the measurement of enzymatic activity rather than RNA level or protein amount alone.

Over the years, a number of assays have been developed to investigate the activity of the TOP1 enzyme [38] to allow for the enzyme mechanism to be dissected [39], to investigate the inhibition of potential new small-molecule compounds [40], or to validate TOP1 as a cancer biomarker in cell lines [41, 42]. Among the most used assays, we have the gold standard relaxation assay [43], the DNA suicide cleavage-ligation assay [44, 45], the electrophoretic mobility shift assay [46], and the in vivo complex of enzymes (ICE) assay [47]. These assays have been extensively used to dissect the steps of the TOP1 catalytic cycle, but they have a lot of limitations. They require either gel electrophoresis, which involves DNA intercalating agents, or highly specialized expertise and training, and they all usually perform optimally when using a large amount of purified TOP1 enzyme or cell extract. For all these reasons, these assays have been used only in research settings, making the potential of investigating TOP1 as a predictive marker for anticancer response very limited.

We have previously developed a rolling circle enhanced enzyme activity detection (REEAD) assay [48] that enables the specific detection of TOP1 activity at the single catalytic event level [49]. In the REEAD assay, the cleavage and ligation reaction of TOP1 converts a specifically designed DNA substrate to a closed circle. This reaction can either be performed in solution, where the generated DNA circles are hybridized to a glass-slide-anchored primer or directly onto the glass slide upon hybridization of the DNA substrate to the primer-coupled slide (On-slide REEAD) [50, 51]. In either case, each closed circle acts as a template for isothermal rolling circle amplification (RCA) generating ~10³ tandem repeat rolling circle products (RCPs). These RCPs can then be detected in a fluorescent microscope at the single molecule level by hybridization to a fluorescently labeled DNA probe or by the incorporation of fluorescently labeled nucleotides during the RCA step. Using this setup, the assay proved to be highly sensitive, as each TOP1-mediated cleavage-ligation generates one closed DNA circle that results in one detectable product in the microscope, and thereby the assay is directly quantitative. For these reasons, REEAD is a powerful tool that allows the investigation of TOP1 activity in crude extract from small biological samples. Indeed, using the described REEAD setup, we have been able to measure the activity of TOP1 in biopsies from cancer patients [52], and in single cells [50, 51] and to predict the CPT cytotoxicity in cancer cell lines [42]. Moreover, REEAD allowed to measure the activity and CPT sensitivity of rare subpopulation of colon cancer cell lines, showing a high degree of chemoresistance [42, 50, 51]. Finally, we have recently developed a new REEAD-based assay, called REEAD C/L that allows for the cleavage and ligation steps of the catalytic cycle to be investigated separately [53]. This enables the identification of new small-molecule compounds as potential TOP1 poisons, which specifically inhibit the relegation step or as TOP1 catalytic inhibitors, which inhibit the DNA binding/cleavage of the enzyme catalysis.

However, both the basic REEAD setup and the REEAD C/L have some limitations. Using a fluorescently labeled probe or fluorescently labeled nucleotides requires a fluorescent microscope for the detection of the RCPs, and to use such a microscope requires specialized training. Moreover, this setup is not well adaptable to non-specialized laboratories or clinical settings. Therefore, the development of other readout methods is highly relevant.

In this chapter, we present two newly developed simple and fast readout methods for the REEAD assay that do not require the use of a fluorescent microscope. In these setups, TOP1 converts a specific DNA substrate to a closed circle, and the RCA is performed in the presence of biotinylated nucleotides. This allows for the detection via the two readouts, by enhanced chemiluminescence (ECL) or by color development directly onto the slide. In this way the assay becomes easy adaptable to all laboratory settings, including clinics, where a screening for the patient response to treatment can be performed with results in only few hours.

2. Results and discussion

2.1 Detection of TOP1 activity using REEAD with easy-to-perform readout formats

Here, we present alternative readout methods for the quantitative and sensitive detection of TOP1 activity using the previously described REEAD assay [48]. In the new assay setup, the fluorescent detection of TOP1 generated products has been substituted with either chemiluminescent or a colorimetric readout. The original and the modified REEAD assays are schematically depicted in Figure 1. The setup uses a specially designed dumbbell-shaped DNA substrate that contains a double-stranded stem and two single-stranded loops. The stem contains a TOP1 preferred cleavage site three bases upstream from the 3′ end (Figure 1, I). Cleavage of the substrate results in temporary covalent binding of TOP1 to the 3′-end and diffusion of the three-base fragment, allowing the 5′ hydroxyl overhang to anneal to the substrate, thus positioning itself for TOP1 mediated ligation. The religation reaction results in the conversion of the dumbbell substrate from an open conformation to a closed DNA molecule, named circle in the following (Figure 1, II). The closed DNA circle is hybridized to a surface-anchored oligonucleotide, which is complementary to the region in one of the single-stranded loops of the TOP1 substrate (loop PB, Figure 1, I). RCA is initiated from this surface-anchored oligonucleotide using the phi29 polymerase, which is able to perform RCA with a high degree of strand displacement (Figure 1, III). RCA generates a long tandem repeat product complementary to the initial DNA circle. In the original REEAD assay, after RCA is performed, a fluorescent probe, complementary to the other loop of the dumbbell substrate (loop ID, Figure 1, I), is hybridized to the RCPs, thus allowing for the visualization in the fluorescence microscope. Alternatively, the RCA can be carried out in the presence of fluorescently labeled nucleotides (Figure 1, IV) generating bright fluorescent dots as a product that can be visualized in the microscope. In both cases, the RCPs will appear as fluorescent dots, and given the sensitivity of the assay, each dot will correspond to one cleavage-religation reaction (Figure 1, V). Upon taking pictures of the fluorescent RCPs coupled to the slide, these dots can be counted using a software and plotted as a direct measure of the number of the TOP1-mediated cleavage-religation reactions.

Figure 1.

Schematic representation of the REEAD assay. (I) The dumbbell-shaped substrate contains a preferred TOP1 cleavage site in the double-stranded stem, as well as a primer binding (PB) sequence and an identifier (ID) element in the two single-stranded loops. The substrate acts as a specific template for TOP1 and is upon the TOP1 cleavage and ligation reaction converted into a closed circle (II). (III) The anchored circles are amplified by rolling circle amplification (RCA) initiated by Phi29 polymerase. The RCA can be performed either by incorporation of fluorescent nucleotides (IV) or biotinylated nucleotides (VI). The fluorescent rolling circle products are visualized using a fluorescent microscope (V). The biotinylated rolling circle products are incubated with an anti-biotin antibody conjugated with horse radish peroxidase (HRP) (VII), which binds specifically to the incorporated biotin molecules. The signal development is mediated by the HRP enzyme bound to the rolling circle products. The signals are then visualized by enhanced chemiluminescence (ECL) (VIII, left) and detected in a CCD camera or using Kodak films. Alternatively, HRP catalyzes the conversion of a chromogenic substrate TMB into a blue color for a colorimetric visualization of the signals (VIII, right).

To enable the visualization of the RCPs to be performed without the use of a big, expensive, and not easy to use instrument, and without the time-consuming image analysis, the RCA can be performed in the presence of biotinylated nucleotides (Figure 1, VI). This generates long tandem repeat products with several incorporated biotins. The detection of the products can then be achieved by incubation with horse radish peroxidase (HRP)-conjugated anti-biotin antibodies that will bind the biotin molecule on the RCPs (Figure 1, VII). This enables visualization in two ways by adding specific substrates for HRP. The substrate can be the components of an ECL kit resulting in a chemiluminescence readout. Alternatively, the substrate can be 3,3′,5,5′-Tetramethylbenidine (TMB) that is oxidized by HRP and converted from colorless to blue giving a colorimetric readout (Figure 1, VIII). Both detection methods enable a fast, simple, and quantitative detection of TOP1 activity.

2.2 Detection of TOP1 activity in the Caco2 colon cancer cells: direct comparison of the fluorescent, chemiluminescent, and colorimetric readouts of the REEAD assay

The well-defined colorectal cancer derived cell line Caco2 was used as a model cell line to demonstrate the functionality of the modified colorimetric/ECL REEAD assay and to investigate whether this readout method can be used instead of the fluorescence-microscope-based readout. Nuclear extract from increasing number of Caco2 cells (as indicated in Figure 2) was incubated with the TOP1-specific substrate and, upon hybridization to the surface-anchored primer on a glass slide, the generated closed DNA circles were amplified by RCA in the presence of fluorescently labeled nucleotides. The fluorescent RCPs were visualized using 60× magnification in a fluorescence microscope. Fifteen pictures per sample were taken and the number of RCPs was estimated by using Image J software [54]. Figure 2A and B show the results of such analysis. Figure 2A depicts representative microscopic images of the observed fluorescent signals in extracts from 0 to 10,000 Caco2 cells. Note that due to the high sensitivity of the assay, it was not possible to quantify the signals obtained when using extract from >10,000 Caco2 cells, due to the abundance of signals that hinders the discrimination between the single RCPs in the image frame. Figure 2B shows a graphical depiction resulting from the quantification of the REEAD signals obtained from two independent experiments. As evident from the graphical depiction, the TOP1 activity increased as the amount of Caco2 cells increased. Hence, with this REEAD setup, it was possible to get a quantitative measure of the TOP1 activity in even a small number of cells, as low as 150–350 Caco2 cells. This high sensitivity of the assay, when performed in bulk, already proved the relevance of using the REEAD assay in the cancer research field as well as in cancer diagnostics and treatment-outcome prediction, where often the amount of cells in a biological sample is very limited [42, 52]. However, as described previously using the fluorescent readout requires time, training, and the use of an advanced fluorescence microscope.

Figure 2.

Analyses of TOP1 activity using a fluorescence microscopic readout. (A) Representative microscopic images obtained when analyzing TOP1 activity in cell extracts from 156, 312, 625, 1250, 2500, 5000, or 10,000 Caco2 cells. Each green dot corresponds to a single TOP1 cleavage-ligation reaction. (B) Graphical depiction of the results obtained when analyzing the TOP1 activity from 156 to 10,000 Caco2 cells as indicated on the figure. A negative control without cell extract was included. Plotted data represent average from two independent experiments.

To overcome the disadvantages of using a fluorescent readout in the REEAD assay, two new readout methods, chemiluminescent or colorimetric, were introduced (as schematically depicted in Figure 1). The closed DNA circles were obtained by incubating nuclear extracts from Caco2 cells with the TOP1-specific substrate, as described under Figure 2. The circles were hybridized into separated wells created onto the surface of a glass slide in a multi-well system, called Wellmaker in the following. In addition, two more sets of nuclear extraction from 0 to 40,000 Caco2 cells were included, and the TOP1 activity was then measured in four independent experiments. Figure 3A, left panel shows a representative image of the intensities of the biotin-containing RCPs when visualized using ECL. The quantitative depiction in Figure 3A, right panel, indicates a linear relationship between TOP1 activity and the increasing number of Caco2 cells. Similar results were obtained using the colorimetric readout with a TMB substrate that can be converted into an insoluble form that precipitates onto the slide upon HRP-mediated oxidation, as shown in Figure 3B. This makes the RCPs permanently colored and visible to the naked eye. In both the ECL and the TMB readouts, the quantification can easily be performed by acquiring a picture with a CCD or a smartphone camera. Then, the Image J software can be used to determine the intensity of the rectangular-shaped areas of the slide, which correlate with the number of RCPs and in turn with the cleavage-ligation activity of TOP1 in the cell extracts. As evident form Figure 3, both readouts allowed detection of TOP1 activity with a detection limit around 1000 cells for the ECL and around 300 cells for the TMB. When using the ECL-based readout (Figure 3A), it is evident that a higher number of cells is required to be able to detect the TOP1 activity as compared with the fluorescent readout (Figure 2). However, the ECL-based readout can easily be developed using chemiluminescent developer solutions and detected either by a CCD camera or by using X-rays films (such as Kodak) in a darkroom. Strikingly, the TMB-based readout resembled that of the fluorescence microscope-based readout, with a comparable detection limit of 312 Caco2 cells, as indicated in Figure 3B. Another advantage of the TMB-based readout is that it does not require any specific equipment, and it can hence be implicated in any relevant setting. In conclusion, both the colorimetric and chemiluminescent readout methods are excellent alternatives to fluorescence in the detection of TOP1 activity using the REEAD assay. Furthermore, these readout methods make the REEAD assay usable to any relevant setting.

Figure 3.

Analyses of TOP1 activity using the chemiluminescent and colorimetric readout. (A) Left panel: Image obtained after measuring TOP1 activity in Caco2 cells using the ECL readout REEAD. The number of cells in each sample is indicated to the left of the image. Right panel: Graphical depiction of the results obtained when analyzing the TOP1 activity from 156 to 40,000 Caco2 cells as indicated on the figure. A negative control without cell extract was included. Plotted data represent average from three independent experiments. Welch’s t-test, p = 0.02. a.u: arbitrary units. (B) Same as A, except that TMB was used instead of ECL. Plotted data represent average from three independent experiments. Welch’s t-test, p = 0.01. a.u: arbitrary units.

3. Conclusion

Chemotherapy is currently one of the most common treatment methods for colorectal cancers [55]. Frequently, treatment fails because of chemoresistance onset or due to poor prediction of the chemotherapy response. Especially for the most advanced stage of colorectal cancer, TOP1 has proved to be one of the best biomarkers and targets of chemotherapy [7, 56] thanks to the well-known and clinically used TOP1 poisons, CPTs. For instance, a study reported a borderline association between increased TOP1 gene-copy number and objective response to irinotecan [57]. This is in agreement with a previous clinical trial (FOCUS) where a significant association between immune-histochemistry-based assessment of TOP1 protein level and response to Irinotecan was reported [58]. However, a subsequent study from the same group (FOCUS3) and a large prospective trial (CAIRO) failed to confirm this findings [59, 60]. Indeed, in the clinical settings often it is the level of DNA-RNA or amount of the TOP1 that is measured, even though it is the TOP1 activity that determines the effect of an inhibitor.

In the case of TOP1, multiple factors can influence the activity and the drug sensitivity in the patients, and for this reason there is an increasing need of tools that allow the measure of TOP1 activity in samples with few hundreds of cells.

In this chapter, we described two alternative readout formats of the highly sensitive and fast, fluorescence-microscope-based REEAD assay, which has single-event sensitivity and recently proved to allow measurement of TOP1 activity in few cells, even a single cell [50, 51]. Even with such a great detection limit, the REEAD has the limitation of the need for skilled personnel and time-consuming image acquisition and analysis. For these reasons, the presented ECL and colorimetric readouts provide excellent alternatives. Both methods are fast, simple, and do not require expensive equipment or trained technicians. Especially the TMB-based method provides an excellent alternative as the limit of detection even resembles the very sensitive fluorescent readout. This modified REEAD assay provides a great platform for a fast and simple detection of TOP1 activity and for using TOP1 as a biomarker for drug susceptibility in cancer cells isolated from colorectal cancer patients. We believe that the presented results may pave the road for the use of the REEAD assay in the clinical setting for the identification of the best outcome for colon cancer patient treatment with CPTs.

4. Material and methods

4.1 Materials

4.1.1 Oligonucleotides

All oligonucleotides for construction of the TOP1-specific REEAD substate and the REEAD primer were synthesized by Merck Life Science A/S, Søborg, Denmark. The sequences of the oligonucleotides were as follows:

1. 5′-amine REEAD primer: 5′-/5AmMC6/CCAACCAACCAACCAAGGAGCCAAACATGTGCATTGAGG

2. TOP1 dumbbell substrate: 5′-AGAAAAATTTTTAAAAAAACTGTGAAGATCGCTTATTTTTTTAAAAATTTTTCT AAGTCTTTTAGATCCCTCAATGCACATGTTTGGCTCCGATCTAAAAGACTTAGA

4.1.2 Reagents

CodeLink HD Activated slides (#DHD1-0023) and BioFX TMB enhanced one compound HRP (ESPM-0100-01) were from SurModics and the custom silicon isolator grids were from Grace-Biolabs. Vectashield without DAPI (#H-1000) was from Vector Laboratories. ATTO-488 dUTP (#95387) and biotin-16-dCTP (NU-809-BIO16L) were from Jena Bioscience. Anti-Biotin HRP conjugated antibody (#A4541) was from Merck, and ECL mixture (#RPN2236) was from Cytiva. The synthetic gene of the phi29 polymerase was from GenScript, and the GST Gravitrap columns (#28952360) were from GE Healthcare.

4.2 Methods

4.2.1 Cell culture

Caco2 cells were cultured in MEM supplemented with 20% FBS, 1% non-essential amino acids, 1% penicillin-streptomycin. Cells were incubated in a humidified incubator (5% CO₂/95% air atmosphere) at 37°C and harvested by trypsin treatment. Fresh cell pellets were used for all analyses.

4.2.2 Phi29 purification

The synthetic gene of the phi29 polymerase was purchased from GenScript and cloned into the pGEX vector resulting in a recombinant N-term GST-tagged phi29 Polymerase expression plasmid. E. coli competent cells BL21 (Promega) were transformed with the plasmid and grown in 2xTY media supplemented with 100 μg/ml of ampicillin. Expression of the fusion protein was induced in log phase cells at OD₆₀₀ = 0.8, by addition of 1 mM isopropyl b-D-1-thiogalactopyranoside at 37°C for 2 h. Cells were harvested after induction and resuspended in sonication buffer (50 mM Tris-HCL pH 7.5, 2.5 M NaCl, 1 mM EDTA, 1 mM DTT, 10 mg/ml of Lysozyme). Following 1 h of incubation on ice, the cells were then lysed by freezing and thawing in liquid N₂ followed by sonication. After centrifugation, the lysate was mixed with 4% Streptomycin Sulfate for 1 h at 4°C. The insoluble particles were removed by centrifugation and the lysate was filtered by using a 0.45 μm filter. The lysate was loaded onto a pre-equilibrated GST Gravitrap column (GE Healthcare) following manufacturer’s instructions. The column was washed in 10-time volumes of sonication buffer. Protein was eluted in 10-time column volumes of elution buffer (10 mM Tris-HCl pH 8, 5 mM Glutathione, 500 mM NaCl) and collected in fractions. The fractions were analyzed on a protein gel. The fractions were then adjusted to 50% glycerol, 0.5% Tween20, 1 mM DTT, and 0.5% NP40 and stored at −20°C.

4.2.3 Preparation of slides

A custom-designed silicone isolator grid, the Wellmaker (Grace-bio lab, USA), was attached to the CodeLink HD slides (Surmodics, USA). The 5′-amine REEAD primer was coupled to the slides in print buffer (300 mM Na₃PO₄, pH 8) and incubated overnight in a humidity chamber with saturated NaCl. The slides were blocked in 50 mM Tris, 50 mM Tris-HCl, 50 mM Ethanolamine, pH 9 for 30 min at 50°C, and subsequently washed in 4xSSC, 0.1% SDS for 30 min at 50°C.

4.2.4 Circularization and rolling circle amplification

The circularization of the TOP1-specific dumbbell substrate was carried out by incubating a serial dilution of cell extract from Caco2 cells with 0.1 μM substrate in 10 mM Tris-HCl, pH 7.5, 5 mM EDTA, and 50 mM NaCl for 1 h at 37°C in a humidifier chamber. The circularization reaction was terminated by heat inactivation for 5 min at 95°C. Subsequently, the circles were hybridized to the primer-coupled slides for 1 h at 37°C in a humidifier chamber. The slides were washed for 1 min at room temperature in wash buffer 1 (100 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.3% SDS) followed by 1 min wash at room temperature in wash buffer 2 (100 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.05% Tween-20). Finally, the slides were dehydrated for 1 min in 70% ethanol and air-dried.

Rolling circle amplification was carried out for 2 h at 37°C in a humidifier chamber in 1× Phi29 buffer (50 mM Tris-HCl, pH 7.5, 10 mM MgCl₂, 10 mM (NH₄)₂SO₄, 4 mM DTT) supplemented with 0.2 μg/μL BSA, 100 μM dATP, 100 μM dTTP, 100 μM dGTP, 90 μM dCTP, 10 μM biotin-dCTP, and 1 unit/μL Phi29 polymerase for colorimetric readout. Alternatively, the rolling circle amplification was carried out in 1× Phi29 buffer supplemented with 0.2 μg/μL BSA, 100 μM dATP, 100 μM dCTP, 100 μM dGTP, 90 μM dTTP, 10 μM ATTO-488-dUTP, and 1 unit/μL Phi29 polymerase for fluorescent readout. The reaction was stopped by washing the slide in wash buffer 1 and 2 for 5 min, dehydrated in 70% ethanol, and air-dried.

4.2.5 Detection of rolling circle products

For the fluorescent readout, the slide was mounted with Vectashield without DAPI and visualized using a 60x objective in a fluorescent microscope (Olympus IX73). The signals detected in an average of 12 images were counted in ImageJ and plotted as mean.

Alternatively, the slide was blocked in 1xTBST (20 mM Tris-HCl pH 9, 150 mM NaCl, 0.05% Tween-20) supplemented with 5% nonfat dry milk and 5% BSA for 30 min at room temperature followed by a 2-min wash in 1xTBST. This was repeated before an incubation with 1:300 HRP conjugated anti-Biotin antibody in a 1xTBST supplemented with 5% nonfat dry milk and 5% BSA buffer for 50 min at room temperature in a humidifier chamber. The slide was washed three times for 3 min in 1xTBST buffer. The chemiluminescent detection was performed by adding 2 μL 1:1 ECL mixture and visualized in a CCD camera. The colorimetric detection was performed by incubation with 2 μL TMB for 30 min followed by 1 min wash in 70% EtOH. The slide was air-dried, and a picture of the color development was taken using the camera of a smartphone.

4.2.6 Statistical analysis

Data were analyzed using GraphPad Prism software and expressed as mean ± standard deviation.

Statistical significance between two groups was assessed with a two-tailed unpaired Student’s t-test, applying Welch correction.

Acknowledgments

The authors would like to thank laboratory technician Noriko Y. Hansen (Department of Molecular Biology and Genetics, Aarhus University, 8000 Aarhus, Denmark) for technical assistance in relation to Phi29 enzyme purifications. We like to acknowledge the support from Food & Bio Cluster Denmark.

Conflicts of interests

The authors C.T. and B.R.K. declare that they are named inventors on the patent EP2022/057172 filed in the name of VPCIR Biosciences ApS. The author C.T. is employee of VPCIR Biosciences ApS. C.T. and B.R.K. are shareholders and/or share option holders. The other authors declare that they have no competing interests.

List of abbreviations

CPT

camptothecin

CPTs

CPT derivatives

ECL

enhanced chemiluminescence

HRP

horse radish peroxidase

RCA

rolling circle amplification

RCPs

rolling circle products

REEAD

rolling circle enhanced enzyme activity detection

TMB

3,3′,5,5′-Tetramethylbenidine

TOP1

topoisomerase 1

TOP1cc

topoisomerase 1-DNA cleavage complex