IntechOpen

Home > Books > Wastewater Treatment

Open access peer-reviewed chapter

Emerging Human Coronaviruses (SARS-CoV-2) in the Environment Associated with Outbreaks Viral Pandemics

Written By

Chourouk Ibrahim, Salah Hammami, Eya Ghanmi and Abdennaceur Hassen

Submitted: 29 January 2022 Reviewed: 22 February 2022 Published: 19 May 2022

DOI: 10.5772/intechopen.103886

Wastewater Treatment IntechOpen
Wastewater Treatment Edited by Muharrem Ince

From the Edited Volume

Wastewater Treatment

Edited by Muharrem Ince and Olcay Kaplan Ince

Book Details Order Print

Chapter metrics overview

185 Chapter Downloads

View Full Metrics
Advertisement

Abstract

In December 2019, there was a cluster of pneumonia cases in Wuhan, a city of about 11 million people in Hubei Province. The World Health Organization (WHO), qualified CoVid-19 as an emerging infectious disease on March 11, 2020, caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) which spreads around the world. Coronaviruses are also included in the list of viruses likely to be found in raw sewage, as are other viruses belonging to the Picornaviridae family. SRAS-CoV-2 has been detected in wastewater worldwide such as the USA, France, Netherlands, Australia, and Italy according to the National Research Institute for Public Health and the Environment. In addition, the SARS-CoV-2 could infect many animals since it has been noticed in pigs, domestic and wild birds, bats, rodents, dogs, cats, tigers, cattle. Therefore, the SARS-CoV-2 molecular characterization in the environment, particularly in wastewater and animals, appeared to be a novel approach to monitor the outbreaks of viral pandemics. This review will be focused on the description of some virological characteristics of these emerging viruses, the different human and zoonotic coronaviruses, the sources of contamination of wastewater by coronaviruses and their potential procedures of disinfection from wastewater.

Keywords

  • SARS-CoV-2
  • human coronaviruses
  • zoonotic coronaviruses
  • disinfection procedures
  • wastewater

1. Introduction

The recent pandemic of the highly contagious coronavirus disease 2019 (COVID-19) caused by a novel severe acute respiratory syndrome coronavirus (SARS-CoV-2) has developed devastating consequences on human health, economy, and ecosystem services as an important public health concern [1]. Until 13 January 2022, over 307,373,791 cases have been reported, including over 5,492,154 deaths [2]. SARS-CoV-2 is a beta coronavirus that belongs to the family Coronaviridae and the order Nidovirales [3]. Coronaviruses (CoVs), and the newly discovered SARS-CoV-2, are spherical or pleomorphic enveloped viruses with a diameter of 100–160 nm [4] characterized by spike proteins projecting to the virion surface [5]. The primary structure comprises four structural proteins: spike (S), envelope (E), membrane (M), and nucleocapsid (N) encoded at the 3′ end of the viral genome [5, 6]. SARS-CoV-2 has a single-stranded genomic RNA (gRNA) positive-sense, approximately 30 kb [7]. This gRNA is among the largest RNA genomes known with a 5′-cap structure and a 3′-poly (A) tail acting like an mRNA for the immediate translation of viral polyproteins [8]. The 5′ and 3′ ends of the gRNA contain highly structured untranslated regions (UTR) that regulate RNA replication and transcription. There is one stem-loop and one pseudo-knot present in the 3′-UTR region mutually exclusive, since their sequences overlap, while seven stem-loop structures are included in the 5′-UTR region. The SARS-CoV-2 genome contains 14 open reading frames (ORFs), preceded by transcriptional regulatory sequences (TRS). The two main transcriptional units, ORF1a and ORF1ab, encode polyprotein replicase 1a (PP1a) and polyprotein 1ab (PP1ab), respectively [9]. These polyproteins are co- and post-translationally processed into 16 nonstructural proteins (NSPS), most of which drive viral genome replication and sub-genomic mRNA (sgmRNA) synthesis [8]. Usually, the transmission of SARS-CoV-2 was accounted occurs through inhalation of respiratory droplets diffused by coughing or sneezing from an infected patient, and through direct contact with contaminated surfaces or objects [10]. This respiratory syndrome leads to developing several chronic or acute disorders in patients such as fever, cough, fatigue, anosmia and ageusia, dyspnea, chest pain, muscle pain, chills, sore throat, rhinitis, headache [11], and gastrointestinal symptoms (nausea, vomiting, diarrhea) [11]. SARS-CoV-2 genomic RNA has been detected in patient stool and urine samples [12], suggesting the possibility that the virus may be transmitted via the fecal-oral route, besides droplet and fomite transmission. Therefore, the mode of transmission of SARS-CoV-2 becomes crucial paramount for human and environmental health. Recently, the world faces a large wave of COVID-19 infections caused by the highly contagious variant of SARS-CoV-2 Omicron can infect people even if they are vaccinated. The record number of people catching the COVID-19 from the beginning of the pandemic has left health systems under severe strain especially in developed countries. However, It has proven the particular importance of WBE (wastewater-based epidemiology) in monitoring the circulation and the transmission of the epidemic in the community, it could provide an early warning sign that reflects possible disease outbreaks in a community [13, 14] and an effective tool for epidemiological surveillance of SARS-CoV-2 viral diversity in samples and to anticipate the detection of certain mutations before they are detected in clinical samples. This communication will provide a basis for understanding SARS-CoV-2 and other viruses from the environmental perspective to design alternative strategies to counteract enteric virus transmission and to reduce the severity of the pandemic [15]. In this review, we present the different human and zoonotic coronaviruses, the sources of contamination of wastewater by coronaviruses, and their potential procedures of disinfection and eradication from wastewater.

Advertisement

2. Human coronaviruses

Coronaviruses (CoV) are enveloped viruses with a single positive-strand RNA genome (∼26–32 kb). They belong to the subfamily Ortho-Coronaviridae of the family Coronaviridae and are classified into four genera: Alpha coronavirus (α), Beta coronavirus (β), Gamma-coronavirus (γ) and Delta-coronavirus (δ) [16].

Until the present time, seven human coronaviruses (HCoVs) can be transmitted between humans. Human alpha coronaviruses, 229E and NL63, and beta-coronaviruses, OC43, and HKU1 are common respiratory viruses usually causing mild upper respiratory illness. Unlike these, the three other human beta-coronaviruses, severe acute respiratory syndrome coronavirus (SARS), Middle East respiratory syndrome coronavirus (MERS), and SARS-CoV-2, are highly pathogenic in humans [17]. All seven HCoVs are the product of a Spillover, they have a zoonotic origin from bats, mice, or domestic animals. Multiple justifications support an evolutionary origin of all HCoVs from bats, where viruses are non-pathogenic and well adapted, so they show great genetic diversity. Genome analysis of the virus identified a high sequence similarity with Chinese bat coronaviruses (highest homology to bat coronavirus RaTG13). Beta coronavirus phylogenetic tree showing that SARS-CoV-2 is related to bat coronaviruses ZC45 and ZXC21. SARS-CoV-2 showed 99% sequence homology with pangolin CoV according to the findings of a research team from the South China University of Agriculture [18].

2.1 HCoV-229E and HCoV-OC43

HCoV-229E is the first strain isolated from patients with upper respiratory tract contamination in the year 1966 [19]. Patients infected with HCoV-229E showed cold symptoms, including headache, sneezing, malaise, and sore throat, with fever and cough in 10–20% of cases [20]. Later, in 1967, HCoV-OC43 was disengaged from organ culture, resulting in a sequential entry in the cerebrum of nursing mice. The clinical features of HCoV-OC43 infection give off an impression of resembling those caused by HCoV-229E, which are indistinguishable from diseases with other respiratory tract pathogens such as influenza A viruses and rhinoviruses [21]. Both HCoV-229E and HCoV-OC43 circulate globally, and they are prevalently diffused during the cold period in a moderate climate [22]. Developing these two viruses is less than one week, straggled by around a 2-week disease [21]. According to a human volunteer study, healthy individuals infested with HCoV-229E developed a slight common cold [23].

2.2 SARS-CoV

The first case of SARS-CoV-1 was discovered in late 2002 in Guangdong Province of China. SARS is an infectious disease caused by a virus belonging to the coronavirus family, SARS-CoV-1. The SARS epidemic has expanded across many countries and continents and caused about 8096 reported cases with 774 deaths. The incubation period of SARS-CoV-1 was 4 to 7 days and the peak of viral load was estimated on the 10th day of illness.

Patients infected with SARS-CoV-1 showed initial symptoms of myalgia, headache, fever, malaise, and chills, followed by dyspnea, cough, and respiratory distress as late symptoms of lymphopenia. However, deranged liver function tests and elevated creatine kinase are common laboratory abnormalities of SARS [24, 25]. The insectivorous bat has been identified as an animal reservoir of the SARS coronavirus. The intermediate host that allowed the virus transmission to humans is the masked palm civet, a wild animal sold in markets and eaten in southern China [26].

2.3 HCoV-NL63 et HCoV-HKU1

In late 2004, HCoV-NL63 was isolated from a 7-month-old child in the Netherlands. It was initially prevalent in young children, the elderly, and immunocompromised patients with respiratory illnesses [27]. The common symptoms of the disease caused by HCoV-NL63 are coryza, conjunctivitis, fever, and bronchiolitis [28]. It is distributed globally and it has been estimated that HCoV-NL63 accounts for nearly 4.7% of common respiratory diseases, and its peak incidence occurs during early summer, spring, and winter [22].

In the same year, HCoV-HKU1 was isolated in Hong Kong from a 71-year-old man hospitalized with pneumonia and bronchiolitis [29]. HCoV-HKU1 was reported to be associated with acute asthmatic exacerbation besides community-acquired pneumonia and bronchiolitis [30]. Alike to HCoV-NL63, HCoV-229E, and HCoV-OC43, HCoV-HKU1 was found worldwide, producing mild respiratory diseases [30].

These four community-acquired HCoVs have been well accustomed to humans and are less probable to mutate to produce exceptionally pathogenic diseases, however, accidents can occur for unclear details as in the uncommon case of subtype HCoV-NL63, which is more virulent and has recently been reported to cause severe lower respiratory tract infection in China [31].

As it has been shown for HCoV-NL63, HCoV-229E, and HCoV-OC43, HCoV-HKU1 has a worldwide distribution and causes mild respiratory diseases [30]. However, the subtype HCoV-NL63, which was found to be more virulent, caused recently severe respiratory tract infection in China [31].

2.4 MERS-CoV

In 2012, a new respiratory virus called MERS-CoV for Middle East Respiratory Syndrome coronavirus was detected in the lung of a 60-year-old patient who developed acute pneumonia and renal failure in Saudi Arabia [32, 33].

The virus was then reported in several countries in the Middle East. Since then, 1219 cases have been diagnosed, resulting in 449 deaths. Few cases have been detected in Europe, including 2 cases in France and 3 cases in Tunisia in 2013 [34]. Later in 2015, 186 confirmed cases were reported in South Korea. Compared to SARS, MERS is a similar disease with a progressive acute pneumonia. However, unlike SARS, many patients with MERS also developed acute renal failure [32, 33]. Over 30% of patients also showed gastrointestinal symptoms, such as diarrhea and vomiting [32, 33].

As of February 2020, over 2500 confirmed cases were accounted for with an intense case fatality of 34.4%, making MERS-CoV one of the most pathogenic viruses known to humans [35].

2.5 SARS-CoV-2

SARS-CoV-2 was first reported in a group of pneumonia patients of unknown etiology who witnessed their visit to Huanan Seafood Wholesale Market in December 2019 in Wuhan, Hubei Province, China [36, 37]. At the beginning of the 2020s, the 2019 coronavirus disease emerged around the world and become a pandemic, which disrupts human activity through general confinements and strict sanitary measures. The incubation of SARS-CoV-2 lasts from 2 to 14 days [38]. The most frequent signs in patients were fever, cough, fatigue, anosmia, ageusia, muscle pain, chills, sore throat, rhinitis, and headache head [11]. Additionally, gastrointestinal symptoms have been reported, diarrhea, stomach pain, vomiting, nausea, and poor appetite [11]. The nucleotide sequence of SARS-CoV-2 revealed about 51.8 and 79.0% of similarity with MERS-CoV and SARS-CoV-1, respectively, and is closely related to SARS-like coronavirus of bald origin—mouse (bat-SL-CoVZC45) with 87.6–89% identity [16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 27, 28, 29, 30, 31, 32, 33, 35, 36, 37, 38, 39]. Recent studies strongly support the hypothesis that SARS-CoV-2 may have originated in bats and may have undergone host jumping to another intermediate mammal, including pangolins (Manis javanica) [10, 40]. Phylogenetic analyzes of the SARS-CoV-2 genome revealed this virus bind with the same human cellular receptor (ACE2: Angiotensin-Converting Enzyme 2) as same as SARS-CoV-1 to get into host cells with 10 times affinity higher than SARS-CoV-1, while MERS-CoV uses another (DPP4) [41, 42] … Genetic variability of SARS-CoV-2 can be the consequence of nucleotide incorporation errors by viral RNA polymerase, genomic editing by cellular restriction factors, or even homologous recombination. The expansion of SARS-CoV-2 variants was observed in fall 2020 [43]. The evolutionary mutation rate of SARS-CoV-2 is estimated at 1.103 nucleotide substitutions per site per year [44] equivalent to approximately one substitution every two weeks in the genome [45]. Currently, the WHO considered five variants as “worrying,” which were first detected in England, South Africa, and then later in Brazil (two variants were observed there, including P1 classified as worrying). In October 2020, a fourth variant (Delta) appeared in India received particular attention. This country of 1.3 billion people has seen an explosion of cases is resisted by other nations. At the end of November 2021, it was the Omicron variant, detected in South Africa, which caused the recent wave and concern all over the world.

Besides other variants called VOI (“variant under investigation” or “variant of interest” in English) has been detected in multiple countries and identified with mutations that lead to amino acid changes associated with phenotypic changes (confirmed or suspected) responsible for community transmission or multiple confirmed cases or clusters (Table 1) [46].

WHO labelPango lineageClade/lineage GISAIDClade next strainFirst samplesListed designation date
LambdaC.37GR/452Q.V120DPeru, Dec. 202014 June 2021
MuB.1.621GH21 hColombia, Jan. 202130 August 2021

Table 1.

Variants to follow VOI of SARS-CoV-2 [46].

And diverse variants called under evaluation, or VUM (“variant under monitoring”) exhibit genetic changes suspected of affecting the characteristics of the virus, indicating that it may pose a future risk without evidence of phenotypic or epidemiological repercussions being clear at this time, and which should be investigated repeated evaluation and enhanced surveillance pending confirmation of new evidence (Table 2) [46].

Lines PANGO*Clade GISAIDClade next strainFirst samples listedDate of designation
B.1.427 B.1.429GH/452R. V121CU.S.A., Mar 2020VOI: 5 Mar, 2 July 2021
VUM: 6 Apr 2021
R.1GR—Many countries, Jan 202107 Apr 2021
B.1.466.2GH—Indonesia, Nov 202028 Apr 2021
B.1.1.318GR20BMany countries, Jan 202102 June 2021
B.1.1.519GR20. B/S.732 AMany countries, Jan 202002 June 2021
C.36.3GR—Many countries, Jan 202116 June 2021
B.1.214.2G—Many countries, Nov 202030 June 2021
B.1.1.523GR—Many countries, May 202014 July 2021
B.1.619G20 A/S.126 AMany countries, May 202014 July 2021
B.1.620G—Many countries, Nov 202014 July 2021
C.1.2GR—South Africa, May 202101 Sept 2021
B.1.617.1§G/452R. V321BIndia, Oct 2020VOI: 4 Apr 2021
VUM: 20 Sept 2021
B.1.526GH/253G. V121FU.S.A., Nov 2020VOI: 24 Mar 2021
VUM: 20 Sept 2021
B.1.525G/484 K. V321DMany countries, Dec 2020VOI: 17 Mar 2021
VUM: 20 Sept 2021

Table 2.

Variants under intensive care or VUM of SARS-CoV-2.

Advertisement

3. Animal coronavirus diseases

3.1 Pet coronavirus (dogs and cats)

Canine coronaviruses: Canine enteric coronavirus (CCoV) typically infects dogs, especially those housed in large groups such as kennels, shelters, and breeding facilities. CCoV belongs to the family Coronaviridae, order Nidovirales, and was first isolated in 1971 during an outbreak of gastroenteritis in military dogs and then perceived as a pathogen of dogs [47]. Dogs attracted with CCoV developed self-limiting enteritis with mild diarrheal disease. Two types of canine coronaviruses are known: CCoV is a member of the Alpha-coronavirus genus [48], and canine respiratory coronavirus (CRCoV) belonging to the beta coronavirus genus [49]. CCoV is closely associated with infectious gastroenteritis virus (TGEV) of pigs, ferret coronavirus, and feline coronavirus (FCoV) [48], while CRCoV is more related to bovine coronavirus [50]. All enteric CCoVs (along with the related viruses of cats, pigs, and ferrets) are given the similar strain designation (Alpha-coronavirus-1) from a taxonomic perspective. However, there are two distinct serotypes of CCoV: type I and type II [51, 52].

Cat coronaviruses: Two alpha coronaviruses are known for cats: feline enteric coronavirus or feline enteric peritonitis (FECV) associated with mild or asymptomatic diarrhea and can mutate to cause more serious feline infectious peritonitis (FIP) or feline infectious peritonitis (FIPV). Subclinical carriers of FECV handle the shedding and transmission of the virus to different felines through the fecal-oral route. Experiences realized on young, ancient, or immunocompromised subjects have revealed two clinical forms of FIP, a wet form, and a dry form. The wet form developed ascites which can be clinically apparent (abdominal distention) and confirmed by ultrasound. The dry form is associated with granulomatous lesions of various locations, basically affecting the eye, the central nervous system, the liver, and kidneys. In Addition, uveitis with keratin deposits on the level of the cornea was reported. The FIP is lethal and there is no particular treatment or vaccine marketed in France for this disease. Cats can also be infected with other coronaviruses such as SARS-CoV-2, transmissible porcine gastroenteritis, canine coronavirus, or human coronavirus 229E [53].

3.2 Coronaviruses of production animals

The bovine, porcine, and avian coronaviruses are mainly affecting production animals. These coronaviruses belong to alpha, beta, gamma, and/or delta-coronaviruses.

Bovine Coronavirus: Bovine coronaviruses (BCoVs) are pneumo-enteric viruses that infect the upper and lower respiratory tract of cattle and wild ruminants and it is rejected in feces and nasal secretions. In cattle, BCoV causes 3 different clinical syndromes in cattle: calf diarrhea, winter dysentery with hemorrhagic diarrhea in adults and respiratory infections in cattle of different ages and the bovine respiratory disease complex or shipping fever of feedlot cattle. Distinction between these syndromes is not yet possible as antigenic or genetic specific markers have not been recognized. To our knowledge, no BCoV vaccines to prevent respiratory BCoV diseases in cattle [54].

Swine Coronavirus: Porcine coronaviruses are members of three genera: alpha-, beta- and delta- coronavirus. Since 1946, transmissible gastroenteritis virus or TGEV in alpha coronaviruses has been discovered. It developed severe, often fatal enteritis in piglets. Symptoms of vomiting and profuse diarrhea are registered for piglets less than a week old and the mortality rate was about 100%.

Later, in 1971, porcine epidemic diarrhea or DEP (Porcine enteritis disease virus or PEDV) was first described in England and caused watery diarrhea occasionally accompanied by vomiting [55]. Since 2013, a severe pathogenic variant of DEP has affected North America and then spread throughout the world, causing serious economic losses. This disease has been included in France to the list of first-category health hazards for emerging animal species. Several variants of the TGE virus are the source of several strains of porcine respiratory coronavirus (Porcine respiratory coronavirus or PRCV), responsible for discreet respiratory disorders [53]. Among these viruses, one of them infected almost most European pig herds in 1984. Two other coronaviruses were identified in 2016 also with digestive tropism [55]: the porcine enteritis coronavirus (swine enteritis coronavirus or SeCoV), a recombinant virus containing a TGEV genome in which the gene S is replaced by that of PEDV, and the porcine acute diarrhea virus (swine acute diarrhea syndrome or SADS) [56].

3.3 Avian coronaviruses

CoVs in the chicken: Among avian coronaviruses classified as gamma and delta-coronaviruses, the first avian coronavirus (infectious bronchitis virus or IBV virus) was described in 1931 and caused many economic losses in poultry farms (laying eggs and broilers). The disease is characterized by various lesions and damages in the genital tract with a drop in the rate of laying, malformation of the eggs, and low mortality. Besides other systems may be affected such as the respiratory tract, kidneys, etc. [53].

CoV of turkeys: Aside from IBV in chickens, the main avian species in which CoV has been definitively associated with the disease are the turkey, pheasant, and guinea fowl. Turkey coronavirus (TCoV) has been known, since the 1940s, to cause of enteric disease in turkeys in the USA. This disease is reported is found worldwide [57, 58]. Turkeys of all ages can be infected with high mortality in young poults. Most frequently reported clinical signs include decreased feed and water intake, wet droppings, diarrhea, and loss of body weight. TCoV is likewise associated with poultry enteritis and mortality syndrome (PEMS) which means high mortality, growth retardation, and immune dysfunction. Inbreeding turkeys, aberrant egg-laying performance is related to TCoV disease, similar to that seen in IBV infections of chickens [57, 58].

CoVs of pheasants (PhCoV): In pheasants, respiratory and renal problems have been associated with infections with CoV. PhCoV is closely related closely related to IBV and TCoV [59].

CoVs of guinea fowl (GfCoV): GfCoV causes acute enteritis, showing a high death rate, possibly pancreatic degeneration, and fulminating disease in guinea fowl [60]. Genetically, GfCoV shows similarity to both IBV and TCoV, however, differences were observed in the spike gene, and a common ancestor has been suggested for the three viruses [60].

3.4 SARS-CoV-2 animal infections

Under natural conditions, SARS-CoV-2 infection has been observed in owner-infected animals. This case is called Spillback when infections are gained by animals through contact with humans. Few confirmed cases of SARS-CoV-2 in pets were reported in diverse countries: France (2 cats), Spain (2 cats), Germany (1 cat), Russia (1 cat), China (2 dogs and a cat in Hong Kong), Belgium (4 cats), the United States (31 cats and 24 dogs), United Kingdom (one cat), Japan (4 dogs), Chile (one cat), Canada (one dog), Brazil (one cat), Denmark (a dog), Italy (a dog) [61]. A recent French study has shown for the first time a significant circulation of SARS-CoV-2 in a population of pets (34 cats and 13 dogs) whose owners were infected with COVID-19 [62].

Experimental conditions have revealed that pigs and poultry are resistant to every inoculation with SARS-CoV-2 [63] while rabbits (which are also pets or laboratory animals) [64], and other laboratory animals include the golden hamster (Mesocricetus auratus) and rhesus macaque (Macaca mulatta) have been susceptible to SARS-CoV-2 [65]. Contrarily, laboratory mice and rats were resistant to SARS-CoV-2 [66]. The SARS-CoV-2 could also threaten many species beyond the great apes. In January 2021, gorillas at the San Diego Zoo were tested positive for COVID-19. None of the animals died, luckily, but were suffered from high fevers, lethargy, and cough like humans [67].

On November 29, 2021, recent reports have proven that SARS-CoV-2 has been transmitted from humans to wild white-tailed deer in the United States, but conversely, no cases of transmission from deer to humans have been reported. All were “apparently in good health,” and “showed no clinical signs of the disease” [67].

In the United States, 4 tigers and 3 lions were probably infected by humans in a zoo in the Bronx. They presented mild respiratory symptoms. Since then, a tiger and a puma have been also reported infected [68]. Recent studies from the Friedrich-Loeffler Institute in Germany reported raccoon dogs (canids bred in China for their fur) previously susceptible to SARS-CoV-1 were also susceptible to SARS-CoV-2 and could contaminate other raccoon dogs by direct contact with no clinical signs. These animals can be intermediate hosts potentially involved in the emergence of COVID-19 [69]. On the other side, infected mink farms by SARS-CoV-2 were detected (2 on April 26, 33 to August 14, then 52 to September 14). Two million mink were then culled by the Dutch authorities. As of September 1, the first human cases contaminated by mink were reported [70] 66 of the 97 employees of these farms tested positive for SARS-CoV-2, with whole-genome sequencing revealing mink-like variants in 47 cases [71].

Advertisement

4. Detection of SARS-CoV-2 in wastewater

Wastewater-Based epidemiology (WBE) has been successfully used to investigate polio circulation within the community. This novel biomonitoring tool has been successfully used to evaluate international poliovirus vaccine campaigns and to investigate the use of some illicit drugs. Additionally, this tool has been successfully used to detect the occurrence of hepatitis and norovirus outbreaks [72, 73].

The environmental circulation of viruses as human pathogens has been given more attention since the first occurrence an spread of Severe Acute Respiratory Syndrome Coronavirus 1 appeared (SARS-CoV-1) in 2003 and Middle East Respiratory Syndrome (MERS) in 2012. Even more focus on the development of surveillance systems of viruses in the environment has been reported since the first occurrence of COVID-19 in December 2019 in Wuhan, China [73, 74].

Since most patients infected with SARS-Cov-2 might be asymptomatic, rapid and accurate detection of potential virus carriers is a critical step to suppress the risk of disease transmission at an early stage of the disease [75]. SARS-CoV-2 has been shown to replicate actively in enterocytes of the human intestine, where there is the highest expression of ACE2 in the human body and the virus is excreted in the feces [76]. SARS-CoV-2 RNA has been detected worldwide in raw wastewater and sometimes in treated wastewater, which could imply potential environmental transmission via the water cycle [77, 78, 79]. SARS-CoV-2 RNA has been reported in wastewater treatment plants in various nations around the world such as Australia, Italy, Spain, the Netherlands, the United States, Japan, Germany, the Arab Emirates States, Istanbul, and Brazil [12]. The duration of the shedding through feces can be as long as 33 days, with a decreased shedding rate, ranging from 106 to 1012 gc/L, which is lower than some other infectious viruses, like MERS-CoV, and SARS-CoV-1 [80, 81].

Detection of SARS-CoV-2 RNA in wastewater was performed by PCR-based methods such as reverse transcription-polymerase chain reaction (RT-PCR) and digital PCR using the amplification of parts of the viral genome, such as the genes coding for the nucleocapsid [82] and the viral envelope [83]. To gain insights into the fate and transport of SARS- CoV-2 in WWTFs, the general workflow for SARS-CoV-2 testing in wastewater is conducted in the following order sample collection, sample concentration, RNA extraction and analysis, and data reporting [84, 85]. Molecular detection of viral RNA involves three major steps:

Viral concentration/enrichment: A viral enrichment step is recommended before RNA extraction because of the potential low concentration of viral titer in the wastewater. Viral particles are concentrated and recovered by polyethylene glycol (PEG) precipitation, or by filtration using 0.2 μm filters [7] ultrafilters [78], and ultracentrifugation [86]. Direct RNA extraction from electronegative membranes (0.45 μm) is another method that can be used [87]. For virus concentration, a variety of techniques have been explored, including polyethylene glycol (PEG)-NaCl precipitation, ultrafiltration, AlCl3, flocculation, and others [88]. Because of its better selectivity and tolerance to PCR inhibitors in wastewater, PEG-NaCl precipitation is the most widely used technique [89].

RNA extraction: RNA extraction has typically been performed using commercial kits from a variety of supplies. The most commonly used RNA extraction kits are the RNeasy Power Microbiome kit [78, 87, 90], the BioMérieux Nuclisens kit [78], Power Fecal Pro-Kit [78], and RNeasy Power water Kit [87].

Amplification of viral RNA: Amplification of viral RNA extracted from wastewater was performed with a set of five primers/probes. These primers and probes target different regions of the viral particle in Table 3.

GeneProbeSequenceReferences
The nucleocapsid (N)2019-nCoV_N1-F
2019-nCoV_N1-R
2019-nCoV_N1-P		5′-GACCCCAAAATCAGCGAAAT-3 ′
5′-TCTGGTTACTGCCAGTTGAATCTG-3 ′
5′-FAM- ACCCCGCATTACGTTTGGTGGACC-ZEN/Iowa Black-3′		[7, 79, 92]
[7, 79]
The nucleocapsid (N)2019-nCoV_N2-F5′-TTACAAACATTGGCCGCAAA-3
2019-nCoV_N2-R5′-GCGCGACATTCCGAAGAA-3′
2019-nCoV_N2-P5′-FAM—ACAATTTGCCCCCAGCGCTTCAG—ZEN/Iowa Black-3′
The the nucleocapsid (N)2019-nCoV_N3-F5′-GGGAGCCTTGAATACACCAAAA-3′[7, 79]
2019-nCoV_N3-R5′-TGTAGCACGATTGCAGCATTG-3
2019-nCoV_N3-P5′-FAM- AYCACATTGGCACCCGCAATCCTG-ZEN/Iowa Black-3′
Envelop (E)E_Sarbeco_F5′-ACAGGTACGTTAATAGTTAATAGCGT-
3′		[79, 93]
E_Sarbeco_ R
E_Sarbeco_ P1
Cor-p-F2 (+)
Cor-p-F3 (+)		5′ — ATATTGCAGCAGTACGCACACA-3′
5′-FAM— ACACTAGCCATCCTTACTGCGCTTCG—
ZEN/Iowa Black-3′
5′-CTAACATGCTTAGGATAATGG-3′
5′-GCCTCTCTTGTTCTTGCTCGC-3′		[94]
Cor-p-R1 (−)5′-CAGGTAAGCGTAAAACTCATC-3′
ORF1ab5′ — CCCTGTGGGTTTTACACTTAA-3′
5′-ACGATTGTGCATCAGCTGA-3′
5′-FAM- CCGTCTGCGGTATGTGGAAAGGTTATGG
-BHQ1–3′		[95, 96, 97]

Table 3.

Primers/probes used for amplification of SARS-CoV-2 RNA in wastewater [91].

Varying results have been reported using these primer/probe sets targeting different parts of the viral genome. For example, [79] found that primer N1 resulted in positive amplification of all study sites (6), but primers N3 and E resulted in positive amplification of 5 and 4 study sites, respectively. However, Rimoldi et al. [97] found a high frequency of positive amplification targeting the ORF1ab gene, compared to only three positive wastewater samples for the N and E genes. As a result, our findings are equivocal in terms of the optimum primer/probe combination for viral RNA amplification in wastewater. This could be attributed to the sensitivity of primers/probes, PCR inhibitors in wastewater samples from different regions/sites, and the potential stability of the virus and viral genome in these different areas [98]. Droplet digital PCR is another molecular technique used for the detection of coronaviruses in clinical and sewage samples. This was found to have an improved, more sensitive, and more accurate lower limit of detection than RT-PCR for environmental samples [99, 100].

Khan et al. [101] discovered that smaller sample volumes (50–100 ml), 30% (w/v) PEG-NaCl, a 12-hour incubation interval, and a 24-hour storage period resulted in improved RNA recoveries in terms of N1 and N2. RNA concentrations were always at least one order of magnitude greater in RT-qPCR than in RT-ddPCR. However, under all test conditions, both RT-qPCR and RT-ddPCR revealed that RNA is generally absent in the sludge samples, resulting in a false-negative result.

Advertisement

5. Risks of environmental transmission of SARS-CoV-2 in wastewater

Fecal-oral transmission of SARS-CoV-2 is yet to be approved, but additional research is essential to clarify the potential risks of the novel coronavirus in sanitation systems. The SARS-CoV-2 virus has been detected in fecal samples and effluents. Contaminated drinking water, contaminated raw, undercooked aquatic aquaculture, sewage-irrigated food, and vector-mediated transmission are all possible sub-pathways of the fecal-oral mode of transmission. Seepage from sanitation systems (pit latrines and septic tanks), landfill leachates without geomembrane protection toward shallow groundwater systems can pollute drinking water sources. In other types of coronaviruses, one study found 99.9% percent fatality after 10 days in tap water at 23°C and over 100 days at 4°C. This data also suggests that coronaviruses have a longer survival duration in tap water than in wastewater [102].

The exposure of humans to viruses, including SARS-CoV-2 through bioaerosol and wastewater aerosols has been highlighted. For example, a laboratory study investigating the persistence of SARS-CoV-2 in aerosols showed that the virus keeps its viability and infectivity in aerosols for up to 16 h [103].

Therefore, human and animal exposure to SARS-CoV-2 via wastewater aerosols could be significant in shared sanitation systems, especially in crowded informal settlements in developing countries [104]. Various studies have registered the prevalence of SARS-CoV-2 in urban and rural sewer systems. This wastewater might contaminate fresh water; it can pass through untreated effluent discharged to surface waters or leak and affect the supply of traditionally treated graywater. These recycled urban waters also represent possible modes of transmission [104].

In some regions with a high prevalence of COVID-19 disease, SARS-CoV-2 was prevalent in surface water, including both saltwater and freshwater. Coronaviruses from anthropogenic activities were confirmed in different water bodies [102, 105]. Marine and fresh aquatic foods such as fish and crustaceans may be contaminated by raw wastewater. Marine foods from coastal areas receiving untreated wastewater, aquatic food acquired from surface aquatic systems receiving raw or partially treated wastewater, and raw wastewater-irrigated salad crops are all possible sources of food transmission.

Raw wastewater-aquacultural systems and raw wastewater irrigation of crops consumed raw, such as salads, are two more techniques that promote food contamination. However, more research is needed to determine the prevalence and durability of SARS-CoV-2 in marine and surface aquatic systems, as well as food derived from these sources. Such research should also look into the effects of various food pre-treatments and culinary processes on SARV-CoV-2 persistence. Studies based on genomic and phylogenetic analyses are needed to evaluate whether SARS-CoV-2 may leap from aquatic environments to humans. This is important given the interactions between humans and wildlife, including the widespread consumption of aquatic and terrestrial animals [106].

Advertisement

6. Disinfection and eradication procedures of SARS-CoV-2 in wastewater

Information from the general suppression of viruses and surrogates of coronaviruses could be used, with caution, to give additional information on the possible suppression of these viruses. For example, [107] observed that activated sludge treatment (ASP) processes in subtropical conditions removed over 3 logs 10 of enteric viruses. ASP is a commonly used wastewater treatment process around the world [108, 109, 110]. This treatment process includes primary settling, biological degradation, and secondary clarification [107, 111]. Ye et al. [112] demonstrated that during ASP processes, the highest removal of coronaviruses can occur at the primary settling stage.

For example, a sewage pond system [113] reported an average reduction of 1 log10 of viruses for 14.5 to 20.9 days of retention. Besides adsorption on particles, a longer HRT (hydraulic retention time) may be required for coronavirus inactivation in wastewater. Because coronaviruses adsorb to solid surfaces, a large concentration can be expected in the sludge. Anaerobic digestion of sludge, which is a typical sludge treatment method, reduces pathogenic bacteria. The most commonly used membrane technologies in wastewater treatment are microfiltration (0.1–0.2 μm) and ultrafiltration (0.005 ≈ 10 μm). There are reports of microfiltration membranes with larger pore sizes (0.2 to 0.4) being used [114]. The best membrane technology for coronavirus removal is ultrafiltration with an average viral particle diameter of 120 nm (0.12 μm) and an envelope diameter of 80 nm (0.08 μm) [115]. Adsorption of coronaviruses on wastewater solids can enhance their removal. Tertiary wastewater treatment processes such as chlorination and UV treatment can also result in further removal of remaining coronaviruses in wastewater [98]. Chlorine has been reported to inactivate viruses through the cleavage of the virus capsid protein backbone, inhibiting the injection of the viral genome into host cells [116, 117].

The inactivation of coronaviruses by UV irradiation has also been reported in several studies [118, 119, 120]. Enveloped viruses, like coronaviruses, are more sensitive to UV than non-enveloped viruses. The mechanism by which UV inactivates coronaviruses is the generation of pyrimidine dimers which damage nucleic acid [94]. Methods of disinfection used in the drinking water treatment inactivate efficiently SARS-CoV-2 in water [121]. However, there is a need to investigate and ameliorate the performance of disinfection technologies to be adopted for the inactivation of SARS-CoV-2 in municipal and hospital wastewater to reduce the related risk of possible infections [121].

Advertisement

7. Conclusion

There has been a significant expansion that proved pathogenic viruses in the wastewater and/or treatment plants, including the novel coronavirus. Understanding the destiny of SARS-CoV-2 in wastewater treatment plants has arisen as an issue of extreme importance. The epidemiological surveillance of these viruses in wastewater would help to prevent the spread of the viral disease while producing safe treated water for reuse. Thus, the performance of various treatment procedures is now being explored to reduce viral disease outbreaks.

Potential dangers of SARS-CoV-2 transmission through water infrastructure are a major source of concern in the environmental setting, and detection and eradication will play a key role in limiting the virus’s spread in the population. To comprehend the early warning of outbreaks and to effectively inactivate before emerging, the virus must be a regular criterion for routine monitoring with other quality metrics with environmental samples. A regulatory framework that incorporates environmental systems will help to protect the global community from future outbreaks and transmissions.

References

  1. 1. Alafeef M, Dighe K, Moitra P, Pan D. Monitoring the viral transmission of SARS-CoV-2 in still waterbodies using a lanthanide-doped carbon nanoparticle-based sensor Array. ACS Sustainable Chemistry & Engineering. 2022;10(1):245-258. DOI: 10.1021/acssuschemeng.1c06066
  2. 2. ECDC COVID-19 Situation Updates Worldwide, as of Week 1. 2022. Available from: https://www.ecdc.europa.eu/en/geographical-distribution-2019-ncov-cases [Accessed: January 2022]
  3. 3. Xu X, Yu C, Qu J, Zhang L, Jiang S, Huang D, et al. Imaging and clinical features of patients with 2019 novel coronavirus SARS-CoV-2. European Journal of Nuclear Medicine and Molecular Imaging. 2020;47:1275-1280. DOI: 10.1007/s00259-020-04735-9
  4. 4. Chen Y, Liu Q, Guo D. Emerging coronaviruses: Genome structure, replication, and pathogenesis. Journal of Medical Virology. 2020;92(4):418-423. DOI: 10.1002/jmv.25681
  5. 5. Beniac DR, Andonov A, Grudeski E, Booth TF. Architecture of the SARS coronavirus profusion spike brief communications. Nature Structural & Molecular Biology. 2006;13(8):751-752. DOI: 10.1038/nsmb1123
  6. 6. Delmas B, Laude H. Assembly of coronavirus spike protein into trimers and its role in epitope expression. Journal of Virology. 1990;64(11)
  7. 7. Wu F, Zhang J, Xiao A, Gu X, Lin Lee W, Armas F, et al. SARS-CoV-2 titers in wastewater are higher than expected from clinically confirmed cases. Msystems. 2020. DOI: 10.1128/mSystems.00614-20
  8. 8. Sola I, Almazán F, Zúñiga S, Enjuanes L. Continuous and discontinuous RNA synthesis in coronaviruses. Annual Review of Virology. 2015, 2015;2:265-288. DOI: 10.1146/annurev-virology-100114-055218
  9. 9. Gorbalenya AE, Enjuanes L, Ziebuhr J, Snijder EJ. Nidovirales: Evolving the largest RNA virus genome. Virus Research. 2006;117(1):17-37. DOI: 10.1016/j.virusres.2006.01.017
  10. 10. Hozhabri H, Sparascio FP, Sohrabi H, Mousavifar L, Roy R, Scribano D, et al. The global emergency of novel coronavirus (SARS-CoV-2): An update of the current status and forecasting. International Journal of Environmental Research and Public Health. 2020;17(16):1-35. DOI: 10.3390/ijerph17165648
  11. 11. Ciechanowicz P, Lewandowski K, Szymańska E, Kaniewska M, Rydzewska GM, Walecka I. Skin and gastrointestinal symptoms in COVID-19. Przeglad Gastroenterologiczny. 2020;15(4):301-308. DOI: 10.5114/pg.2020.101558
  12. 12. Tanhaei M, Mohebbi SR, Hosseini M, Rafieepoor M, Kazemian S, Ghaemi A, et al. The first detection of SARS-CoV-2 RNA in the wastewater of Tehran, Iran. Environmental Science and Pollution Research. 2021;28(29):38629-38636. DOI: 10.1007/s11356-021-13393-9
  13. 13. Olive G, Lertxundi U, Barcelo D. Early SARS-CoV-2 outbreak detection by sewage-based epidemiology. Science of the Total Environment. 2020;732:139298. DOI: 10.1016/j.scitotenv.2020.139298
  14. 14. O’Bannon D. Femmes dans la qualité de l’eau. 2020. Available from: https://link.springer.com/content/pdf/10.1007/978-3-030-17819-2.pdf
  15. 15. Mohan SV, Hemalatha M, Koppert H, Ranjith I, Kumar AK. SARS-CoV-2 in environmental perspective: Occurrence, persistence, surveillance, inactivation, and challenges. Chemical Engineering Journal. 2021;405:126893. DOI: 10.1016/j.cej.2020.126893
  16. 16. Ren L-L, Wang Y-M, Wu Z-Q, Xiang Z-C, Guo L, Xu T, et al. Identification of a novel coronavirus causing severe pneumonia in human: A descriptive study. Chinese Medical Journal. 2020;133(9):1015-1024. DOI: 10.1097/CM9.0000000000000722
  17. 17. Chu DKW, Pan Y, Cheng SMS, Hui KPY, Krishnan P, Liu Y, et al. Molecular diagnosis of a novel coronavirus (2019-nCoV) causing an outbreak of pneumonia. Clinical Chemistry. 2020;66(4):549-555. DOI: 10.1093/clinchem/hvaa029
  18. 18. Cyranoski D. Did pangolins spread the China coronavirus to people? Nature. 2020. DOI: 10.1038/d41586-020-00364-2
  19. 19. Hamre D, Procknow JJ. A new virus isolated from the human respiratory tract. Proceedings of the Society for Experimental Biology and Medicine. 1966;121(1):190-193. DOI: 10.3181/00379727-121-30734
  20. 20. Tyrrell DA, Cohen S, Schlarb JE. Signs and symptoms in common colds. Epidemiology and Infection. 1993;111(1):143-156. DOI: 10.1017/s0950268800056764
  21. 21. McIntosh K, Dees JH, Becker WB, Kapikian AZ, Chanock RM. Recovery in tracheal organ cultures of novel viruses from patients with respiratory disease. Proceedings. National Academy of Sciences. United States of America. 1967;57(4):933-940. DOI: 10.1073/pnas.57.4.933
  22. 22. Su S, Wong G, Shi W, Liu J, Lai ACK, Zhou J, et al. Epidemiology, genetic recombination, and pathogenesis of coronaviruses. Trends in Microbiology. 2016;24(6):490-502. DOI: 10.1016/j.him.2016.03.003
  23. 23. Bradburne AF, Bynoe ML, Tyrrell DA. Effects of a “new” human respiratory virus in volunteers. British Medical Journal. 1967;3(5568):767-769. DOI: 10.1136/bmj.3.5568.767
  24. 24. Cheng VC, Lau SK, Woo PC, Yuen KY. Severe acute respiratory syndrome coronavirus as an agent of emerging and reemerging infection. Clinical Microbiology Reviews. 2007;20(4):660-694. DOI: 10.1128/CMR.00023-07
  25. 25. Peiris JS, Lai ST, Poon LL, et al. Coronavirus as a possible cause of the severe acute respiratory syndrome. Lancet. 2003;361(9366):1319-1325. DOI: 10.1016/s0140-6736 (03)13077-2
  26. 26. Available from: https://www.pasteur.fr/fr/centre-medical/fiches-maladies/sras
  27. 27. van der Hoek L, Pyrc K, Jebbink MF, Vermeulen-Oost W, Berkhout RJ, Wolthers KC, et al. Identification of a new human coronavirus. Nature Medicine. 2004;10(4):368-373. DOI: 10.1038/nm 1024
  28. 28. Abdul-Rasool S, Fielding BC. Understanding human coronavirus HCoV-NL63. Open Virology Journal. 2010;4:76-84. DOI: 10.2174/1874357901004010076
  29. 29. Woo PC, Lau SK, Chu CM, Chan KH, Tsoi HW, Huang Y, et al. Characterization and complete genome sequence of a novel coronavirus, coronavirus HKU1, from patients with pneumonia. Journal of Virology. 2005;79(2):884-895. DOI: 10.1128/JVI.79.2.884-895.2005
  30. 30. Lau SK, Woo PC, Yip CC, Tse H, Tsoi HW, Cheng VC, et al. Coronavirus HKU1 and other coronavirus infections in Hong Kong. Journal of Clinical Microbiology. 2006;44(6):2063-2071. DOI: 10.1128/JCM.02614-05
  31. 31. Wang Y, Li X, Liu W, Gan M, Zhang L, Wang J, et al. Discovery of a subgenotype of human coronavirus NL63 associated with severe lower respiratory tract infection in China. Emerg Microbes Infect. 2018;9(1):246-255. DOI: 10.1080/22221751.2020.1717999
  32. 32. Hilgenfeld R, Peiris M. From SARS to MERS: 10 years of research on highly pathogenic human coronaviruses. Antiviral Research. 2013;100(1):286-295. DOI: 10.1016/j.antiviral.2013.08.015
  33. 33. Gao H, Yao H, Yang S, Li L. From SARS to MERS: Evidence and speculation. Frontiers in Medicine. 2016;10(4):377-382. DOI: 10.1007/s11684-016-0466-7
  34. 34. Available from: https://www.pasteur.fr/fr/centre-medical/fiches-maladies/mers-cov
  35. 35. Ye ZW, Yuan S, Yuen KS, Fung SY, Chan CP, Jin DY. Origines zoonotiques des coronavirus humains. International Journal of Biological Sciences. 2020;16(10):1686-1697. DOI: 10.7150/ijbs.45472
  36. 36. Lu H, Stratton CW, Tang Y-W. The outbreak of pneumonia of unknown etiology in Wuhan, China: The mystery and the miracle. Journal of Medical Virology. 2020;92. DOI: 10.1002/jmv.25678
  37. 37. Johnson M. Wuhan 2019 novel coronavirus – 2019-nCoV. Materials and Methods. 2020;10(Jan):1-5. DOI: 10.13070/mm.en.10.2867
  38. 38. Wu F, Zhao S, Yu B, Chen Y-M, Wang W, Song Z-G, et al. A new coronavirus associated with human respiratory disease in China. Nature. 2020;579. DOI: 10.1038/s41586-020-2008-3
  39. 39. Chan JFW, Yuan S, Kok KH, To KKW, Chu H, Yang J, et al. A familial cluster of pneumonia associated with the 2019 novel coronavirus indicating person-to-person transmission: A study of a family cluster. The Lancet. 2020;395(10223):514-523. DOI: 10.1016/S0140-6736(20)30154-9
  40. 40. Zhang N, Wang L, Deng X, Liang R, Su M, He C, et al. Recent advances in the detection of respiratory virus infection in humans. Journal of Medical Virology. 2020:92. DOI: 10.1002/jmv.25674
  41. 41. Wan Y, Shang J, Graham R, Baric RS, Li F, Wan CY. Receptor recognition by the novel coronavirus from Wuhan: An analysis based on decade-long structural studies of SARS coronavirus. Journal of Virology. 2020;94:127-147. DOI: 10.1128/JVI.00127-20
  42. 42. Wrap D, Wang N, Corbett KS, Goldsmith JA, Hsieh CL, Abiona O, Graham BS, Mclellan JS. Cryo-EM Structure of the 2019-nCoV Spike in the Profusion Conformation. 2019. Available from: http://science.sciencemag.org/
  43. 43. Bertholom C. Évolution génétique du Sars-CoV-2 et ses conséquences. Option/Bio. 2021;32(639):22. DOI: 10.1016/S0992-5945(21)00197-5
  44. 44. Candido DS, Claro IM, Jésus JG, Souza WM, Moreira FRR, Dellicour S, et al. Evolution and epidemic spread of SARS-CoV-2 in Brazil. Science, New York. 2020;369(6508):1255-1260. DOI: 10.1126/SCIENCE.ABD2161
  45. 45. van Dorp L, Ackman M, Richard D, Shaw LP, Ford CE, Ormond L, et al. Emergence of genomic diversity and recurrent mutations in SARS-CoV-2. Infection, Genetics, and Evolution. 2020;83:104351. DOI: 10.1016/J.MEEGID.2020.104351
  46. 46. SARS-CoV-2 variants of concern as of 11 May 2021. 2021. Available from: https://www.ecdc.europa.eu/en/covid-19/variants-concern
  47. 47. Binn LN, Lazar EC, Keenan KP, Huxsoll DL, Marchwicki RH, Strano AJ. Recovery and characterization of a coronavirus from military dogs with diarrhea. Proceedings, Annual Meeting of the United States Animal Health Association. 1974;78:359-366
  48. 48. King AM, Lefkowitz E, Adams MJ, Carstens EB. Virus Taxonomy: Ninth Report of the International Committee on Taxonomy of Viruses. Vol. 9. Elsevier; 2011
  49. 49. Erles K, Toomey C, Brooks HW, Brownlie J. Detection of a group 2 coronavirus in dogs with canine infectious respiratory disease. Virology. 2003;310(2):216-223. DOI: 10.1016/s0042-6822(03)00160-0
  50. 50. Erles K, Shiu KB, Brownlie J. Isolation and sequence analysis of canine respiratory coronavirus. Virus Research. 2007;124(1-2):78-87. DOI: 10.1016/j.virusres.2006.10.004
  51. 51. Decaro N, Buonavoglia C. An update on canine coronaviruses: Viral evolution and pathobiology. Veternary Microbiology. 2008;132(3-4):221-234. DOI: 10.1016/j.vetmic.2008.06.007
  52. 52. Le Poder S. Feline and canine coronaviruses: Common genetic and pathobiological features. Advances in Virology. 2011;2011:609465. DOI: 10.1155/2011/609465
  53. 53. Angot JL, Brugère-Picoux J. Introduction générale sur les coronavirus animaux et humains [General introduction to animal and human coronaviruses]. Bulletin de l’Académie Nationale de Médecine. 2021;205(7):719-725. DOI: 10.1016/j.banm.2021.05.011
  54. 54. Saif LJ. Bovine respiratory coronavirus. The Veterinary Clinics of North America. Food Animal Practice. 2010;26(2):349-364. DOI: 10.1016/j.cvfa.2010.04.005
  55. 55. Laude H. Two newly identified enteropathogenic coronaviruses in swine are related to bat or bird viruses. Bulletin de l’Académie Vétérinaire de France. 2020. DOI: 10.4267/2042/70845
  56. 56. Pan Y, Tian X, Qin P, Wang B, Zhao P, Yang YL. Discovery of a novel swine enteric alpha coronavirus (SeACoV) in southern China. Veterinary Microbiology. 2017;211:15-21
  57. 57. Jindal N, Mor SK, Goyal SM. Enteric viruses in Turkey enteritis. Virus Diseases. 2014;25:173-185. DOI: 10.1007/s13337-014-0198-8
  58. 58. Guy JS. Turkey coronavirus enteritis. In: Swayne DE, Boulianne M, McDougald LR, Nair V, Suarez DL, editors. Diseases of Poultry. Vol. I. 2020. pp. 402-408
  59. 59. JJ (Sjaak) de Wit & Jane KA Cook. Spotlight on avian coronaviruses. Avian Pathology. 2020;49(313-316). DOI: 10.1080/03079457.2020.1761010
  60. 60. Liais E, Croville G, Mariette J, Delverdier M, Lucas MN, Klopp C, et al. Novel avian coronavirus and fulminating disease in guinea fowl, France. Emerging infectious diseases. 2014;20:105-108. DOI: 10.3201/eid2001.130774
  61. 61. Plateforme ESA. 2020. COVID-19 et animaux. Available from: https://www.plateforme-esa.fr/
  62. 62. Fritz M, Rosolen B, Krafft E, Becquart P, Elguero E, Vratskikh O, et al. High prevalence of SARS-CoV-2 antibodies in pets from COVID-19+ households. One health (Amsterdam, Netherlands). 2021;11:100192. DOI: 10.1016/j.onehlt.2020.100192
  63. 63. Schlottau K, Rissmann M, Graaf A, Schön J, Sehl J, Wylezich C, et al. SARS-CoV-2 in fruit bats, ferrets, pigs, and chickens: An experimental transmission study. The Lancet Microbe. 2020;1(5):e218-e225. DOI: 10.1016/S2666-5247(20)30089-6
  64. 64. Mykytyn AZ, Lamers MM, Okba N, Breugem TI, Schipper D, van den Doel PB, et al. Susceptibility of rabbits to SARS-CoV-2. Emerging Microbes & Infections. 2021;10(1):1-7. DOI: 10.1080/22221751.2020.1868951
  65. 65. Munster VJ, Feldmann F, Williamson BN, van Doremalen N, Pérez-Pérez L, Schulz J, et al. Respiratory disease in rhesus macaques inoculated with SARS-CoV-2. Nature. 2020;585(7824):268-272
  66. 66. Cohen J. Mice, hamsters, ferrets, monkeys. Which lab animals can help defeat the new coronavirus? Science| AAAS. 2020;13
  67. 67. Yves Sciama. Wild and domestic animals, they also catch the Covid. Reporterre. 2021. Available from: https://reporterre.net/Animaux-sauvages-et-domestiques-ils-attrapent-aussi-le-Covid
  68. 68. McAloose D, Laverack M, Wang L, Killian ML, Caserta LC, Yuan F, et al. From people to Panthera: Natural SARS-CoV-2 infection in tigers and lions at the Bronx zoo. MBio. 2020;11(5):e02220-e02220. DOI: 10.1128/mBio.02220-20
  69. 69. Freuling CM, Breithaupt A, Müller T, Sehl J, Balkema-Buschmann A, Rissmann M, et al. Susceptibility of raccoon dogs for experimental SARS-CoV-2 infection. Emerging Infectious Diseases. 2020;26(12):2982-2985. DOI: 10.3201/eid2612.203733
  70. 70. Munnink BBO, Sikkema RS, Nieuwenhuijse DF, Molenaar RJ, Munger E, Molenkamp R, et al. Jumping back and forth: Anthropozoonotic and zoonotic transmission of SARS-CoV-2 on mink farms. BioRxiv. 2020
  71. 71. European Centre for Disease Prevention and Control. Detection of New SARS-CoV-2 Variants Related to Mink. ECDC: Stockholm; 2020
  72. 72. Hellmér M, Paxéus N, Magnius L, Enache L, Arnholm B, Johansson A, et al. Detection of pathogenic viruses in sewage provided early warnings of hepatitis A virus and norovirus outbreaks. Applied and Environmental Microbiology. 2014;80(21):6771-6781. DOI: 10.1128/AEM.01981-14
  73. 73. Sinclair RG, Choi CY, Riley MR, Gerba CP. Pathogen surveillance through monitoring of sewer systems. Advances in Applied Microbiology. 2008;65:249-269. DOI: 10.1016/S0065-2164 (08)00609-6
  74. 74. Sims N, Kasprzyk-Hordern B. Future perspectives of wastewater-based epidemiology: Monitoring infectious disease spread and resistance to the community level. Environment International. 2020;139:105689. DOI: 10.1016/j.envint.2020.105689
  75. 75. Hamouda M, Mustafa F, Maraqa M, Rizvi T, Aly HA. Wastewater surveillance for SARS-CoV-2: Lessons learned from recent studies to define future applications. Science of the Total Environment. 2021;759(143493). DOI: 10.1016/j.scitotenv.2020.143493
  76. 76. Mao K, Zhang H, Yang Z. Can a paper-based device trace COVID-19 sources with wastewater-based epidemiology? Environmental Science Technology. 2020;54(7):3733-3735. DOI: 10.1021/acs.est.0c01174
  77. 77. Qi F, Qian S, Zhang S, Zhang Z. Single-cell RNA sequencing of 13 human tissues identify cell types and receptors of human coronaviruses. Biochemical and Biophysical Research Communications. 2020;526(1):135-140. DOI: 10.1016/j.bbrc.2020.03.044
  78. 78. Gonzalez R, Curtis K, Bivins A, Bibby K, Weir MH, Yetka K, et al. COVID-19 surveillance in Southeastern Virginia using wastewater-based epidemiology. Water Research. 2020;186:116296. DOI: 10.1016/j.waters.2020.116296
  79. 79. Medema G, Heijnen L, Elsinga G, Italiaander R, Brouwer A. Presence of SARS-Coronavirus-2 RNA in wastewater and correlation with prevalence of COVID-19 reported in the early stage of the outbreak in the Netherlands. Letters in Environmental Science and Technology. 2020;7(7):11-516
  80. 80. Randazzo W, Truchado P, Cuevas-Ferrando E, Simón P, Allende A, Sánchez G. SARS-CoV-2 RNA in wastewater anticipated COVID-19 occurrence in a low prevalence area. Water Research. 2020;181. DOI: 10.1016/j.watres.2020.115942
  81. 81. Gupta S, Parker J, Smits S, Underwood J, Dolwani S. Excrétion virale persistante du SRAS-CoV-2 dans les fèces – un examen rapide. Dis colorectal. 2020;22(6):611-620. DOI: 10.1111/codi.15138
  82. 82. Jones DL, Baluja MQ, Graham DW, et al. Shedding of SARS-CoV-2 in feces and urine and its potential role in the person-to-person transmission and the environment-based spread of COVID-19. Science of the Total Environment. 2020;749:141364. DOI: 10.1016/j.scitotenv.2020.141364
  83. 83. CDC. Real-Time RT-PCR Diagnostic Panel. Centers for Disease Control and Prevention, CDC-006-00. 2020:1-80. Available from: https://www.fda.gov/media/134922/download
  84. 84. Corman VM, Landt O, Kaiser M, Molenkamp R, Meijer A, Chu DK, et al. Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR. Eurosurveillance. 2020;25(3):23. DOI: 10.2807/1560-7917.ES.2020.25.3.2000045
  85. 85. Kitajima M, Ahmed W, Bibby K, Carducci A, Gerba CP, Hamilton KA, et al. SARS-CoV-2 in wastewater: State of the knowledge and research needs. Science of the Total Environment. 2020;739:139076. DOI: 10.1016/j.scitotenv.2020.139076
  86. 86. Pecson BM, Darby E, Haas CN, Amha YM, Bartolo M, Danielson R, et al. SARS-CoV-2, interlaboratory consortium. Reproducibility and sensitivity of 36 methods to quantify the SARS-CoV-2 genetic signal in raw wastewater: Findings from an interlaboratory methods evaluation in the US. Environmental Science: Water Research & Technology. 2021;7:504-520. DOI: 10.1039/d0ew00946f
  87. 87. Green H, Wilder M, Collins M, Fenty A, Gentile K, Kmush BL, et al. Quantification of SARS-CoV-2 and cross-assembly phage (crAssphage) from wastewater to monitor coronavirus transmission within communities. MedRxiv. 2020;2:1-18. DOI: 10.1101/2020.05.21.20109181
  88. 88. Ahmed W, Angel N, Edson J, Bibby K, Bivins A, O’Brien JW, et al. First confirmed detection of SARS-CoV-2 in untreated wastewater in Australia: A proof of concept for the wastewater surveillance of COVID-19 in the community. Science of the Total Environment. 2020a;728:138764. DOI: 10.1016/j.scitotenv.2020.138764
  89. 89. Dumke R, de la Cruz Barron M, Oertel R, Helm B, Kallies R, Berendonk TU, et al. Evaluation of two methods to concentrate SARS-CoV-2 from untreated wastewater. Pathogens. 2021;10(2):195. DOI: 10.3390/pathogens10020195
  90. 90. Kumar M, Kuroda K, Patel AK, Patel N, Bhattacharya P, Joshi M, et al. Decay of SARS-CoV-2 RNA along the wastewater treatment outfitted with up-flow anaerobic sludge blanket (UASB) system evaluated through two sample concentration techniques. Science of the Total Environment. 2021;754:142329. DOI: 10.1016/j.scitotenv.2020.142329
  91. 91. Ahmed W, Bertsch PM, Bivins A, Bibby K, Farkas K, Gathercole A, et al. Comparison of virus concentration methods for the RT-qPCR-based recovery of murine hepatitis virus, a surrogate for SARS-CoV-2 from untreated wastewater. Science of the Total Environment. 2020;739(June):139960. DOI: 10.1016/j.scitotenv.2020.139960
  92. 92. Haramoto E, Malla B, Thakali O, Kitajima M. First environmental surveillance for the presence of SARS-CoV-2 RNA in wastewater and river water in Japan. Science of the Total Environment. 2020;737:140405. DOI: 10.1016/j.scitotenv.2020.140405
  93. 93. Wurtzer S, Marechal V, Mouchel JM, Maday Y, Teyssou R, Richard E, et al. Evaluation of lockdown impact on SARS-CoV-2 dynamics through viral genome quantification in Paris wastewater. MedRxiv. 2020. DOI: 10.1101/2020.04.12.20062679
  94. 94. Wang XW, Li JS, Guo TK, Zhen B, Kong QX, Yi B, et al. Concentration and detection of SARS coronavirus in sewage from Xiao Tang Shan hospital and the 309th hospital. Journal of Virological Methods. 2005;128(1-2):156-161. DOI: 10.1016/j.jviromet.2005.03.022
  95. 95. Arora S, Nag A, Sethi J, Rajvanshi J, Saxena S, Shrivastava SK, et al. Sewage surveillance for the presence of SARS-CoV-2 genome as a useful wastewater-based epidemiology (WBE) tracking tool in India. Water Science and Technology. 2020;82(12):2823-2836. DOI: 10.2166/wst.2020.540
  96. 96. Kumar M, Patel AK, Shah AV, Raval J, Rajpara N, Joshi M, et al. First proof of the capability of wastewater surveillance for COVID-19 in India through detection of the genetic material of SARS-CoV-2. Science of the Total Environment. 2020;746:141326. DOI: 10.1016/j.scitotenv.2020.141326
  97. 97. Rimoldi SG, Stefani F, Gigantiello A, Polesello S, Comandatore F, Mileto D, et al. Presence and infectivity of SARS-CoV-2 virus in wastewater and rivers. Science of the Total Environment. 2020;744:140911. DOI: 10.1016/j.scitotenv.2020.140911
  98. 98. Amoah ID, Kumari S, Bux F. Coronaviruses in wastewater processes: Source, fate and potential risks Environment International.May 2020;143:105962. 10.1016/j.envint.2020.105962.
  99. 99. Lu R, Wang J, Li M, Wang Y, Dong J, Cai W. SARS-CoV-2 detection using digital PCR for COVID-19 diagnosis, treatment monitoring and criteria for discharge. MedRxiv. 2020. DOI: 10.1101/2020.03.24.20042689
  100. 100. Dong L, Wang X, Wang S, Du M, Niu C, Yang J, et al. Interlaboratory assessment of droplet digital PCR for quantification of BRAF V600E mutation using a novel DNA reference material. Talanta. 2020;207. DOI: 10.1016/j.talanta.2019.120293
  101. 101. Khan K, Tighe SW, Badireddy AR. Facteurs influençant la récupération de l’ARN du SRAS-CoV-2 dans les eaux usées brutes et les boues d’épuration à l’aide de la méthode de concentration à base de polyéthylène glycol. Journal of Biomolecular Techniques. 2021;32(3):172-179. DOI: 10.7171/jbt.21-3203-012
  102. 102. La Rosa G, Bonadonna L, Lucentini L, Kenmoe S, Suffredini E. Coronavirus in water environments: Occurrence, persistence and concentration methods—A scoping review. Water Research. 2020;179:115899. DOI: 10.1016/j.watres.2020.115899
  103. 103. Fears AC, Klimstra WB, Duprex P, Hartman A, Weaver SC, Plante KS, et al. Persistence of severe acute respiratory syndrome coronavirus 2 in aerosol suspensions. Emerging Infectious Diseases. 2020;26(9):2168-2171. DOI: 10.3201/eid2609.201806
  104. 104. Mukherjee A, Babu SS, Ghosh S. Thinking about water and air to attain sustainable development goals during times of COVID-19 pandemic. Journal of Earth System Science. 2020;129(1). DOI: 10.1007/s12040-020-01475-0
  105. 105. Sivakumar B. COVID-19 and water. Stochastic Environmental Research and Risk Assessment. 2020;2020:1-4. DOI: 10.1007/s00477-020-01837-6
  106. 106. Sichewo PR, Vander Kelen C, Thys S, Michel AL. Risk practices for bovine tuberculosis transmission to cattle and livestock farming communities living at the wildlife-livestock-human interface in northern KwaZulu Natal, South Africa. PLoS Neglected Tropical Diseases. 2020;14(3):e0007618. DOI: 10.1371/journal.pntd.0007618
  107. 107. Sidhu JPS, Sena K, Hodgers L, Palmer A, Toze S. Comparative enteric viruses and coliphage removal during wastewater treatment processes in a subtropical environment. Science of the Total Environment. 2018;616-617:669-677. DOI: 10.1016/j.scitotenv.2017.10.265
  108. 108. Kitajima M, Iker BC, Pepper IL, Gerba CP. Relative abundance and treatment reduction of viruses during wastewater treatment processes—Identification of potential viral indicators. Science of the Total Environment. 2014;488-489(1):290-296. DOI: 10.1016/j.scitotenv.2014.04.087
  109. 109. Simmons FJ, Xagoraraki I. Release of infectious human enteric viruses by full-scale wastewater utilities. Water Research. 2011;45(12):3590-3598. DOI: 10.1016/j.watres.2011.04.001
  110. 110. Nordgren J, Matussek A, Mattsson A, Svensson L, Lindgren PE. Prevalence of norovirus and factors influencing virus concentrations during one year in a full-scale wastewater treatment plant. Water Research. 2009;43(4):1117-1125. DOI: 10.1016/j.watres.2008.11.053
  111. 111. Keegan AR, Robinson B, Monis P, Biebrick M, Liston C. Validation of activated sludge plant performance for virus and protozoan reduction. Journal of Water Reuse and Desalination. 2013;3(2):140-147. DOI: 10.2166/wrd.2013.032
  112. 112. Ye Y, Ellenberg RM, Graham KE, Wigginton KR. Survivability, partitioning, and recovery of enveloped viruses in untreated municipal wastewater. Environmental Science & Technology. 2016;50(10):5077-5085. DOI: 10.1021/acs.est.6b00876
  113. 113. Verbyla ME, Mihelcic JR. A review of virus removal in wastewater treatment pond systems. Water Research. 2015;71:107-124. DOI: 10.1016/j.watres.2014.12.031
  114. 114. Nqombolo A, Mpupa A, Moutloali RM, Nomngongo PN. Wastewater treatment using membrane technology. In: Wastewater and Water Quality. Rijeka: InTech; 2018. DOI: 10.5772/intechopen.76624
  115. 115. Neuman BW, Buchmeier MJ. Supramolecular architecture of the coronavirus particle. Advances in Virus Research. 2016;96:1-27. DOI: 10.1016/bs.aivir.2016.08.005
  116. 116. Wigginton KR, Pecson BM, Sigstam T, Bosshard F, Kohn T. Virus inactivation mechanisms: Impact of disinfectants on virus function and structural integrity. Environmental Science and Technology. 2012;46(21):12069-12078. DOI: 10.1021/es3029473
  117. 117. Page MA, Shisler JL, Mariñas BJ. Mechanistic aspects of adenovirus serotype 2 inactivation with free chlorine. Applied and Environmental Microbiology. 2010;76(9):2946-2954. DOI: 10.1128/AEM.02267-09
  118. 118. Shirbandi K, Barghandan S, Mobinfar O, Rahim F. Inactivation of coronavirus with ultraviolet irradiation: What? How? Why? SSRN Electronic Journal. 2020. DOI: 10.2139/ssrn.3571418
  119. 119. Kim J, Jang J. Inactivation of airborne viruses using vacuum ultraviolet photocatalysis for a flow-through indoor air purifier with short irradiation time. Aerosol Science and Technology. 2018;52(5):557-566. DOI: 10.1080/02786826.2018.14313
  120. 120. Casanova L, Rutala WA, Weber DJ, Sobsey MD. Survival of surrogate coronaviruses in water. Water Research. 2009;43(7):1893-1898. DOI: 10.1016/j.watres.2009.02.002
  121. 121. Smith EC, Denison MR. Coronaviruses as DNA wannabes: A new model for the regulation of RNA virus replication fidelity. PLoS Pathogens. 2013;9(12):e1003760. DOI: 10.1371/journal.ppat.1003760

Written By

Chourouk Ibrahim, Salah Hammami, Eya Ghanmi and Abdennaceur Hassen

Submitted: 29 January 2022 Reviewed: 22 February 2022 Published: 19 May 2022

© 2022 The Author(s). Licensee IntechOpen. This chapter is distributed under the terms of the Creative Commons Attribution 3.0 License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Continue reading from the same book

View All
Chapter 1 Physical Wastewater Treatment

By Bahareh Pirzadeh

1015 downloads

Chapter 2 Adsorption Isotherms: Enlightenment of the Phenome...

By Andres Abin-Bazaine, Alfredo Campos Trujillo and M...

1392 downloads

Chapter 3 Available Technologies for Wastewater Treatment

By Ifeanyi Michael Smarte Anekwe, Jeremiah Adedeji, S...

380 downloads