Cloning and Identification System of Apis mellifera Melittin cDNA in Escherichia coli

Abstract

Honey bee venom, known as apitoxin, is composed of several peptides, the most important of which is melittin. This peptide is a current focus of research since it can improve the immune system and act against cancer due to its anti-mutagenic, anti-inflammatory, and even contraceptive effects. This makes it very desirable to obtain melittin-producing bacteria, and for this reason, this study has aimed at the cloning of Escherichia coli with the melittin gene from western bee. In order to do this, the total RNA of the western honey bee (Apis mellifera) has been extracted, and a reverse transcription polymerase chain reaction (RTPCR) has been carried out, at different annealing temperatures (68.0, 68.2, 68.4, 68.6, 68.8, and 69.0°C) to amplify the melittin cDNA. The annealing temperature of 68.4°C has allowed the highest production. Subsequently, this cDNA has been cloned into the pGEM-T vector, which has transformed E. coli JM109. This transformation has been corroborated by the blue/white test mediated by X-gal.

1. Introduction

Bee venom is a unique weapon in the primordial animal kingdom in the defense of the colony. This poison is formed by a complex mixture of efficient proteins designed to protect bees against a wide variety of predators [1]. Bee venom is found in the abdominal cavity (inside a gland) and contains at least 18 active components that have a wide variety of pharmaceutical properties such as melittin, apamin, adolapin, mast cell degranulation peptide (MCD), enzymes (such as phospholipase), biologically active amines (histamine and epinephrine), and non-peptidic components [2]. Melittin is the main component in the venom of the western bee representing 50% of the total dry weight of the apitoxin [3, 4].

Melittin is synthesized in the form of a precursor called prepromelittin, which plays a crucial role in the attachment of the growing polypeptide chain to the membrane of the endoplasmic reticulum and its vectorial discharge into the lumen [5]. This is because it contains a signal peptide that could be removed by the enzyme signal peptidase on the luminal side of the endoplasmic reticulum (ER) [6], giving rise to a peptide called promelittin [7].

Prepromelittin was detected upon translation of melittin mRNA in cell-free systems [8], but it has not been found in any cellular system. Promelittin also contains some polar amino acids more than melittin at the N-terminal end that are eliminated by a protease after translation [9]. These polar amino acids at this end ensure that this toxic peptide is never present during its translation into the ribosomes [10]. The main reason for this is that the N-terminal region of melittin is predominantly hydrophobic while the carboxy-terminal region is hydrophilic due to the presence of a stretch of positively charged amino acid [7], leading to an amphipath that allows it to interact with the biological membranes [11]. Melittin has diverse biological and pharmacological activities [12], in particular the ability to modify the functions of the immune system in the body [13]. It has been seen that the addition of melittin to bacteria increases the turgor pressure of the cells followed by a decrease in the cell pressure, which could destroy the cellular envelope and could be the reason for cell lysis and its antimicrobial properties [14]. In human erythrocytes, melittin binds rapidly to its membrane and forms pores leading to an alteration of the permeability that causes the release of hemoglobin to the extracellular medium, and this causes the hemolysis at room temperature [7]. It also has the capacity to affect the dynamics of membrane proteins, causing their aggregation and immobilizing them in the plane of the lipid bilayer [15] and acting as a potent inhibitor of Ca²⁺ ATPase, H⁺ K⁺ ATPase, Na⁺ K⁺ ATPase, and protein kinase (Figure 1) [7].

Figure 1.

Electrophoresis gel of PCR from Apis mellifera melittin at different melting temperatures.

Recent experiments have shown beneficial effects in the application of this poison on human health acting as anti-mutagenic, anti-inflammatory, contraceptive, and radioprotectant against cancer [16, 17, 18]. Melittin causes the cancer cell death by apoptosis by activating caspases and matrix metalloproteinases [2]. In addition, melittin has a direct suppressive effect in the production of HIV-1 [19]. Due to the multiple therapeutic applications of this oligopeptide, it is desirable to obtain melittin-producing bacteria for their large-scale production in biological reactors. The objective of this study has been precisely to transform Escherichia coli with western honey bee (A. mellifera) gene through a plasmidic vector as a first step for an industrial production.

2. Strategies for cloning and expression

2.1 Melittin primers

The preparation of the melittin cDNA primers, both forward and reverse, was carried out first by searching for its sequence in Gen Bank (NCBI), with the accession NC_007073.3. This sequence contains 100 bp and was published by Suchanek et al. [20]. The sequences of restriction sites for ApaLI and SacII were added to the selected primers. Thus, the final sequences of the primers were the following: primer forward 5′TTTTGGGCCCTTAACAGGAAGGA AGGAAGGAA3′ primer reverse 5′AAAACCGCGGAGATCGATAAATCG GCATCG3′.

2.2 RNA extraction

Fifty bees were collected in duly sterilized glass bottles and frozen at −30°C for 30 min in order to conserve the genetic material. The PureYield ™ RNA Midiprep System RNA extraction kit was used to extract and purify the total RNA. The quantification of total RNA was carried out by using the Quantus™ fluorometer [21]. The retrotranscription to total cDNA was carried out using the PureYield RNA Midiprep System (Promega), adding 5 μl of the total RNA extraction to the reaction mixture obtaining a final volume of 20 μl per tube.

2.3 PCR amplification

The PCR mixture was prepared according to the components and the amounts described briefly: a volume (μl) of nuclease-free water 13.25 μl; 5× GoTaq® flexi reaction buffer 5.00 μl; 25 mM MgCl₂ 2.00 μl; 10 mM PCR nucleotide mix 0.50 μl; 133.1 pM upstream primer 147.9 pM downstream primer 5 u/μl GoTaq® Flexi DNA polymerase 78 ng/μl cDNA obtained a final volume of 25.0 μl.

The mixture was placed in a thermocycler preheated to 94°C to start the denaturation with for 30 seg. Different temperatures were used for annealing (Tm) in order to determine which of them gave a greater number of copies at the end of the PCR (68.0, 68.2, 68.4, 68.6, 68.8, and 69.0°C; named respectively as Tm1, Tm2, Tm3, Tm4, Tm5, and Tm6) for 60 seg. Finally, the elongation temperature was 72°C for 90 seg, all of them for 40 cycles, and the complete PCR lasted 2 h.

The PCR product was run on 1.5% agarose gel electrophoresis, and the exact amount of cDNA obtained on the most visible band was established by the use of Quantus™ fluorometer (Promega).

2.4 Sequencing

The sample was sent to Macrogen-Korea in order to sequence this amplified fragment by sequencing of new generation. Once the sequence was obtained, it was compared with the melittin accession NC_007073.3 by searching for DNA homologies using the BLAST v1.4 program in GenBank (http://www.ncbi.nlm.nih.gov/BLAST/).

2.5 Insertion of the melittin cDNA in the pGEM-T easy vector

The PCR product was purified using the PCR CleanUp System™ to eliminate primer dimers or other unwanted reaction products in order to improve the ligation efficiency. In order to insert the gene in the vector, 1 μl of the PCR product was taken and mixed with 5 μl of 2× rapid ligation buffer (T4 DNA), 1 μl of pGEM®-T Easy vector (50 ng/μl), 1 μl of T4 DNA ligase (3 μg/μl), and 2 μl of nuclease-free water. These vectors were prepared by cutting with EcoRV and adding a 3’terminal thymidine to both ends. They contain T7 and SP6 RNA polymerase promoters flanking a multiple cloning region within the alpha-peptide coding region of the enzyme beta-galactosidase. Insertional inactivation of the alpha-peptide allows recombinant clones to be directly identified by blue/white screening on indicator plates. The reagents were incubated for 1 h at room temperature. In order to obtain a maximum number of transformants, the reactions were then incubated overnight at 4°C.

2.6 Bacterial transformation

The commercial strain of E. coli JM109 was used, maintained at −30°C. Once thawed, 50 μl of this tube was transferred to 1.5 ml microcentrifuge tube, inserted in the ice, and 2 μl of the ligation product was added. The transformed cells were subjected to ice for 2 min, and 950 μl of Super Optimal Broth with Catabolite Repression (SOC) liquid medium [22] at room temperature was added. This solution was incubated for 1.5 h at 37°C with shaking at 150 rpm. Subsequently, aliquots of 100 μl were placed in different plates with Luria-Bertani (LB) semisolid broth medium [23] with 100 μg/ml of ampicillin, 0.5 mM of IPTG, and 80 μg/ml of X-Gal. The plates were incubated overnight at 37°C to perform the Blue-White Screening for positive bacterial transformed colonies/clones.

3. Results

3.1 RT-PCR

It was performed at different annealing temperatures (68.0, 68.2, 68.4, 68.6, 68.8, and 69.0°C). After electrophoresis, it was observed that all the cDNA samples hybridized with the primers obtaining the most visible band at the annealing temperature of 68.4°C. This is, therefore, the hybridization temperature that has resulted in a greater amount of cDNA during PCR. After quantification with the fluorophore, the quantity of cDNA obtained resulted in 78 ng/μl. The PCR product was sequenced prior to cloning by MACROGEN-South Korea.

3.2 BLAST-DNA homology

Searching of the NCBI GenBank database (http://www.ncbi.nlm.nih.gov/) using the melittin accession (Accession no. NC_007073.3) resulted in a similarity index around 80%. The genetic transformation of E. coli JM109 with the insert in the vector pGEM-T was corroborated by the blue-white screening test. The colonies formed by nonrecombinant cells therefore appeared blue in color while the recombinant ones appeared white and allowed discrimination between transformants containing recombinant plasmids versus those maintaining self-ligated or uncut vector.

The homology is deduced from the excess of similarity recognized from statistical estimates. A common empirical rule is that two sequences are homologous if they are more than 30% identical over their entire length (much higher identities are seen in short alignments) [24], so it can be firmly stated that both sequences are similar. Due to this, it can be affirmed that E. coli has been genetically transformed with the cDNA of western bee melittin. Also, the best annealing temperature has been 68.4°C.

4. Conclusions

Recent studies have highlighted the importance of the melittin as a natural drug for different applications, due to its anti-inflammatory, anti-mutagenic, contraceptive, antimicrobial, and even an anticancer effect. Its mass production is, therefore, of great pharmacological interest and, due to this, obtaining bacteria genetically transformed with this gene becomes very desirable. In other studies, melittin cDNA has been inserted into different plasmids: pBR322 [25], pBV220 [26], and pUC118 [27]. Recently, a gene encoding a hybrid peptide with melittin, called LfcinB (1–15)-Melittin (5–12), has been inserted into the pET-32a vector [28]. In addition, in other study, E. coli has been transformed with melittin cDNA from Apis cerana [4]. In this work, melittin cDNA from A. mellifera has been inserted in E. coli using the pGEM-T vector. So, its identification and genetic cloning system have been demonstrated, for its 3’T overhangs at the insertion site, proving a binding successful. Furthermore, the mentioned vector has T7 and SP6 RNA promotors that will ensure its expression in the E. coli cells used. Also, another study worked with this vector system [4], suggesting the best way for cloning with these kinds of vectors.

However, it must be remembered that in order to obtain melittin in E. coli as a final product, the immature peptide prepromelittin should be posttranslationally modified in some steps. In the first step, the enzyme that catalyzes the hydrolysis of prepromelittin to promilittin is supposed to be widely distributed, since prepromellitin has never been obtained in a cell system. Moreover, promelittin has been obtained in venom glands of honeybees fed with radioactive amino acids [9] and in frog oocytes injected with this mRNA from queen bee [29], but melittin has never been obtained in any tissue that does not come from a species of the genus Apis.

For all these reasons, it may be thought the other studies that have cloned melittin cDNA in cell systems that do not belong to species of the genus Apis, are likely to give rise to the obtaining of promelittin as a final product, as is the case of the present study. It is necessary to clarify which is the final peptide that has been obtained. If promelittin has been finally obtained, the next focus of study could be to design a protocol to convert it to melittin into E. coli.

Acknowledgments

I would like to express my thanks to my patient and supportive, team, who has supported me throughout this research project. I am extremely grateful for our friendly meetings and discussions. I also wish to thank both Universities Ibarra Catholic and Guayaquil, who have been great source of support.