Open access peer-reviewed chapter

Hemorheological Evaluation and Cytokine Production in Dogs Naturally Infected with Anaplasmataceae

Written By

Saulo Pereira Cardoso, Giane Regina Paludo, José Nivaldo da Silva, Adenilda Honório-França and Eduardo Luzia França

Submitted: November 20th, 2019 Reviewed: January 14th, 2020 Published: February 24th, 2020

DOI: 10.5772/intechopen.91191

Chapter metrics overview

688 Chapter Downloads

View Full Metrics

Abstract

In this chapter, we describe that naturally infected dogs with Anaplasmataceae show altered rhreological parameters. Also, we have showed that lower viscosity correlated with the lower erythrocyte number and release of IFN-γ. The rheometry of the fresh blood samples was measured by using the Modular Compact Rheometer—MCR 102 (Anton Paar® GmbH, Ostfildern, Germany), and the graphs were obtained using Rheoplus software. Blood count data were obtained by analysis in a private laboratory. Diagnostic confirmation was obtained by molecular PCR technique that was used to determine the groups of not infected and infected by Anaplasmataceae. Serum cytokines were dosed by flow cytometry (FACScalibur BD®) using BD® Biosciences Cytometric Bead Array (CBA) Human Th1/Th2/Th17 Cytokine kits. The results showed a correlation between blood viscosity (p < 0.05, r = 0.73) and shear rate (p < 0.05; r = −0.676) with IFN-γ in the group of infected dogs that presented anemia, as well as correlations of shear rate with erythrocytes (p < 0.05; r = −0.88). Thus, IFN-γ appears to play an important role in the immunomodulation of the rheological behavior of naturally infected dogs to Anaplasmataceae. The alterations in cytokines profile and their relationship with blood viscosity and hematological parameters was related in this study the first time of dogs naturally infected with Anaplasmataceae.

Keywords

  • Anaplasmataceae
  • rheology
  • immunomodulation
  • cytokines
  • dogs

1. Introduction

In the environment, animals can naturally suffer from co-infections with more than one pathogen, primarily high-incidence diseases such as invertebrate vector-borne hemoparasites, which multiply in short cycles. The diseases caused by microorganisms of the Anaplasmataceae family, transmitted by the Rhipicephalus sanguineusectoparasite vector, such as Ehrlichia canisand Anaplasma platys[1] are highly prevalent in Brazil and worldwide [2, 3].

E. canisis a causative bacterium of Canine Monocytic Ehrlichiosis (CME) that infects mononuclear cells, mainly found in monocytes, where they develop and replicate using the cellular apparatus, and subsequently spread and infect new cells [4]. The A. platysonly infects platelets leading to transient thrombocytopenia [5] without developing severe dog disease, known as Canine Cyclic Thrombocytopenia [6].

Infectious diseases may alter the hematological parameters of the affected individuals and, consequently, there is alteration of hemorheological behavior [7, 8, 9]. In addition, immunological factors are also responsible for the change in blood viscosity. On the other hand, cytokines may play an important role in the immunomodulation of hemorheological behavior. Cytokine IL-17 has immunomodulatory effect on blood viscosity of human patients infected with Plasmodium vivax, such response may be important for maintaining erythrocyte integrity [7].

The therapeutic use of cytokines may help in the treatment of individuals with changes in blood viscosity [7]. In addition, it can modulate Th1 type responses [10, 11].

Studies on the hemorheological behavior of dogs with infectious diseases, as well as the immunomodulation of this process help to understand the immunophysiopathological mechanisms [7, 9].

This chapter deals with cytokines involved in the immunomodulation of hematological and rheological parameters of the blood of dogs naturally infected by bacteria from Anaplasmataceae family.

1.1 Etiology, occurrence, and distribution

The microorganisms of the Anaplasmataceae family belong to the order Alphaproteobacteria and to the class Rickettisiales. They are gram negative, intracellular-obligatory [12]. They have coccoid or rod shapes, varying in size from 0.2 to 0.5 micrometers (μm) in diameter and 0.8–2.0 μm in length. They are found forming colonies within intracytoplasmic vacuoles. These colonies are surrounded by a membrane that delimits them, being this colony-vacuole set called morula [13].

The Rickettsiales class microorganisms have an infective form, the dense nucleus cell. After infection, it develops the vegetative form, the reticulated cell, which multiplies by binary fission. In the process of infection, they are phagocytized by the host cell and remain inside vacuoles or phagosomes, where fusion with lysosomes does not occur, and develop there and form the morula. After vegetative forms mature, they can become infectious forms and be released from the cytoplasm by exocytosis or lysis of host cells, thereby infecting new cells [4].

The Anaplasmataceae family comprises the following species reported as infectious agents of dogs: E. canis, E. ewingii, E. chaffeensis, A. phagocytophilum, A. platys,and Nanophyetus helminthoeca[14, 15]. There are also reports of E. risticiiinfection [16]. However, to date in the Brazilian territory, the clinically important species for pets that cause hematological disorders in dogs are E. canis and A. platys[17, 18]. E. canishas mononuclear cell tropism, mainly monocytes, whereas A. platysinfects platelets [19]. E. ewingiiinfections in dogs can also cause hematological changes and other signs of hemoparasitosis [2].

Prevalence studies of Anaplasmataceae show that these infectious agents are widely distributed in tropical and subtropical countries [20]. Dogs with suspected CME have high rates of positivity for Anaplasmataceae infections [1, 21], whereas in domestic cats, this rate is low [22].

Most studies involving the Anaplasmataceae family aim not only to identify the taxonomic family of agents, but also to try to identify genus and species. Thus, the epidemiology of E. canis and A. platys, which are the main species of this family that affect dogs in Brazil, will be presented below.

1.1.1 Ehrlichia canis

In the year 1935, researchers first detected a rickettsial microorganism parasitizing dog mononuclear cells [23]. Only in 1945 did Mashkovsky reclassify this agent as E. canis[24]. However, it has become known worldwide as a causative agent of CME in an outbreak of infection with a high mortality rate in German shepherd dogs used by the US military during the Vietnam War [25]. In Brazil, it had its first report in dogs in the 1970s [26].

Dogs infected with E. canisdevelop CME, a worldwide disease found in different continents: South America, Central America, Europe, Asia, Oceania [27], North America [28], and Africa [29]. They are in the tropical and subtropical regions of these continents where there is the ectoparasite vector R. sanguineusand the highest prevalence rates of CME [27, 30].

The genus Ehrlichiais widely distributed in Brazil [17], being positive for 20% of dogs seen in the country [31]. In 1996, in Venezuela, the first report of chronic E. canisinfection in humans occurred [32]. There are also reports in humans in the United States causing a chronic disease that can be fatal [33, 34]. Clinical signs are variables such as fever, weakness, muscle and bone pain, headache, nausea, vomiting, abdominal pain, arthralgia, and rash. Hematological parameters present anemia, thrombocytopenia, and leukopenia [32]. Thus, E. canisinfection can also be treated as a public health issue and not just veterinary [27, 35].

1.1.2 Anaplasma platys

A. platysis the causative agent of Canine Cyclic Thrombocytopenia (CRT), which colonizes and replicates in dog platelets. Its first description was in the 1970s, Florida-USA, as a Rickettsia-like organism capable of infecting dog platelets [6]. In addition to reporting the visualization of this agent in blood smears, Harvey et al. [6] reproduced the infection experimentally in other dogs. No animal showed macroscopic alteration, the only alteration being a transient thrombocytopenia, without causing evident hemorrhages in the infected ones [6].

In different countries in Europe, the prevalence of this agent can range from 0.4 to 70.5% according to molecular research using blood samples from dogs, age, animal breed or gender does not appear to influence the development of CRT [36, 37].

In Brazil, the prevalence of A. platysinfection in dogs varies in different regions, being higher in the northeast [1, 2, 22, 38, 39, 40].

Molecular studies have also detected A. platysin humans in the United States and Venezuela, indicating potential risk of zoonosis [41, 42].

1.1.3 Coinfecção por E. canise A. platys

E. canisand A. platyscoinfection using molecular detection in dogs are reported in Brazil [43], with prevalence ranging from 5.5 to 53.3% [1, 44, 45].

In other countries, co-infections with these bacteria also occur in dogs. In the USA, they found a 5% prevalence in dogs with a history of tick exposure [46]. This same rate was found by Yabsley et al. [47, 48] in blood samples from dogs from Granada, Spain.

1.2 Transmission

The microorganisms of the Anaplasmataceae family are transmitted to their hosts mainly by vectors that inoculate them in susceptible animals. The increase in the number of cases of infections in dogs by these bacteria in a given region is linked to the presence of the transmitting vector in the environment and its behavior of feeding on mammalian blood, with a preference for canids. Infection occurs at the moment when the tick R. sanguineusperforms hematophagy and ends up injecting saliva contaminated with Anaplasmataceae at the bite site [47, 48].

Both larvae and nymphs, as well as adult forms of the R. sanguineustick infected by E. canis, are capable of transmitting it to the host [47, 48]. There is no transovarian transmission from adult ticks to their larval forms in the reproduction process of R. sanguineus[27]. Ticks only become infected when they feed on infected animals that are in the bacteremia phase of the disease [49]. Although vector transmission of E. canisis the main mode of infection, it can also occur in cases of blood transfusion from an infected to an uninfected host [50, 51].

Regarding A. platystransmission, it is not clear how it occurs. It is suspected to be similar to E. canisby ticks, but the process has not yet been confirmed experimentally [52, 53]. Some more recent studies point to possible vertical transmission from mother to pups, but the transmission process has not been confirmed [53, 54].

The R. sanguineusectoparasite (Acari: Ixodida), known as the brown dog tick, is the main vector of E. canis[55]. It is also believed to serve as a vector for A. platys, although the infection has not been reproduced in the laboratory so far. One of the main evidence of this possibility is the discovery of A. platysDNA in female R. sanguineususing molecular technique [44, 56]. This tick has a cosmopolitan distribution in tropical regions and, taking advantage of global warming, proliferates in regions of temperate climate, but under conditions of shelter that provides its development [47, 48].

Once infected with E. canis, this vector becomes a source of lifelong infection. Thus, a larva may remain infected even after undergoing changes in its life cycle, maintaining trans-state transmission [57]. E. caniscolonizes oral salivary gland cells and is also found in vector cells, called hemocytes, and tick intestinal cells [58].

Other ticks like Ixodes spp. and Dermacentorssp. are also capable of transmitting the Anaplasmataceae family pathogens to susceptible hosts at the time of the bite [59, 60].

1.3 Immunological response and mechanisms of immune evasion of microorganisms from Anaplasmataceae family

Host resistance to the Anaplasmagenus is linked to IFN-γ production [61]. This protective effect is potentiated by TNF-α [62]. On the other hand, there is a description that TNF-α may favor the aggravation of the clinical condition of dogs, as observed in cases of distemper [63].

The process of immune response to members of the Anaplasmataceae family can lead to tissue damage in the liver of the infected host regardless of the bacterial load in their body, due to a simple induction of proinflammatory mechanisms that induce a cellular response that develops such damage. These lesions are generally more severe than those directly induced by the infectious agent itself, as observed in a study with experimental A. phagocytophiluminfection in mice [64].

Ehrlichia-infected monocytes have a slower response to LPS when compared to uninfected monocytes, as this pathogen inhibits activation of the nuclear factor kappa beta (NF-κβ) transcription factor. This infection also disrupts toll-like receptor expression (TLR 2 and 4) and inhibits other signaling pathways that rely on monocyte activation receptors [65]. In addition, infection induces inhibition of gene transcription for IL-12, IL-15, and IL-18 production [66].

In persistent Ehrlichiainfections, it has been experimentally demonstrated in mice that the host maintains its survival when there is increased IFN-γ production by CD4 + and CD8 + T lymphocytes, low concentration of TNF-α and antibody production to Ehrlichia, mainly IgG2 [67].

The survival of the genus Ehrlichiain monocytes depends on the mechanisms that this bacterium uses to block the fusion of phagosomes with lysosomes, inhibiting cell apoptosis to utilize its nutrients and energy longer [68].

Susceptibility to the development of CME has immunomodulatory mechanisms involved in the process. Experimental infections in mice with E. muris, intracellular mononuclear leukocyte parasite demonstrated high concentration CD8 + T production of TNF-α as well as systemic inflammatory response mediated by this cytokine and inhibition of Th1 profile T CD4 proliferation [67].

Regarding E. canis, NK cells play their role in the immune response, but are not primordial in the host resistance process [69]. Although some animals with CME have bone marrow cell depletion in the chronic phase, subclinical neutropenia and transient lymphopenia in the acute phase, it was found in an experimental study that in the acute and subacute phases of the disease, E. caniswas not able to induce immunosuppression in young dogs, up to 1 year old on average [69].

One study showed that dogs experimentally infected with E. canishad elevated TNF-α production by splenocytes and leukocytes during acute CME, followed by high levels of IL-10 for both cell lines and, finally, only the leukocytes showed IFN-γ production in small scale [70]. TNF-α production at high levels in the experimental infection with E. caniswas also verified by Rikihisa and Tajima [5]. Since in naturally infected dogs, Lima et al. [71] found elevated levels of TNF-α and IL-10, but the analysis found no difference between the means of groups infected and uninfected for both cytokines.

Studies report that specific immune response to A. platysis innovative. Research involving Anaplasmagenus and its immune response mostly describe the species A. phagocytophilum, which infects granulocytes of different animal species [72], or A. marginalewhich infect red blood cells and bovine monocytes [73].

The control of infection by A. phagocytophilumin humans and other animals, including the dog, is dependent on the IFN-γ production and macrophage activation, which leads to the control of a recent bacteremia [74]. This occurs in an initial immune response, with the role of NK cells to produce IFN-γ, but that is not important for eliminating the infectious agent.

Contrary to expectation, the immune response to A. phagocytophilumis not dependent Th1 cytokines such as IL-12 and IFN-γ, but CD4 + effector T cells are also strictly necessary for the eradication of the pathogen [75].

A. marginaleinfections induce CD4 T cell proliferation as well as a humoral response with high levels of IgG1 and IgG2. This bacterium has great ability to generate variant forms by converting gene segments, which allows an escape from the immune response [76].

Intracellular organisms have different mechanisms of escape from the immune response to maintain their survival and multiply. Some may induce non-fusion of phagosome with lysosome, while others escape from phagosome to cytosol. By using their structural apparatus to disrupt the phagosome environment and inhibit its fusion to lysosomes, these pathogens gain time to take on a more resistant form to the acid and proteolytic environment and perpetuate within the infected cell [77].

In many cases, these infectious agents may induce a Th2-type cellular response. IL-10 secretion by Th2 inhibits Th1 response and macrophage activation by the classical pathway [78]. Intracellular organisms may also inhibit IL-12 production by infected macrophages [79].

1.4 Pathophysiology of CME and CRT and clinical signs

E. canisuses different strategies from other traditional intracellular bacteria in the process of infection because is a bacterium with deficiency of structural membrane components such as peptidioglicanos and LPS. Its genome has genes that encode proteins responsible for evasion to the immune system and for playing an important role in parasite-host interaction. Surface proteins present in the genus Ehrlichiawith repeats of serine and threonine components are responsible for membrane attack and host cell entry [80]. Twelve tandem repeating proteins, three specific for E. canis, were identified, demonstrating a variability of membrane protein repertoire, which facilitates escape to the immune system [81].

The manifestations and clinical signs in positive dogs can variable and are observed in the different phases of the CME. The acute phase occurs after an incubation period ranging from 8 to 20 days [82]. The subclinical course of infection, which occurs when no clinical signs of the disease are observed, may develop after an acute course of course in dogs that have not cleared the agent. And finally, there is the chronic course phase with signs of severe disease [83].

Significant low platelet count in CME is the main sign observed in the hematological parameters of dogs [84]. Such a fall is linked to different factors: excessive platelet consumption due to endothelial lesions, destruction by immunological action, and an increased splenic sequestration of these platelets [85]. It has been reported that there is a platelet migration inhibiting factor that favors splenic sequestration [86].

In CRT, the mechanism of platelet reduction occurs by phagocytosis of these blood components that have been damaged by the bacteria or destroyed in an immunomediated manner [6]. In addition, it has been shown that A. platysinfection can occur in platelet-generating myeloid precursors, such as promegakaryocytes and megakaryocytes [87].

1.4.1 Fase aguda da CME

During the acute phase of CME, there is an elevation of inflammatory cytokines linked to the immune response, such as TNF-α, IL-10, and IFN-γ [70]. However, Lima et al. [71] reported in their work that TNF-α and IL-10 are not associated with early-stage clinical signs of CME. Some dogs may present in the acute phase thrombocytopenia and anemia; however, thrombocytopenia is also detected in dogs in the subclinical phase when the animal is not treated [84], and leukopenia may also occur [88]. In the acute phase, there are the appearances of several nonspecific clinical signs such as anorexia, fever, weight loss, lymphadenomegaly, splenomegaly, and apathy, also occurring vasculitis [83].

In the study by Sousa et al. [89], dogs with E. canisinfection showed nonspecific clinical signs, such as apathy, anorexia, fever, and mucosal pallor. They also presented ophthalmic disorders, tendencies to hemorrhage and splenomegaly. Other studies reported diarrhea, emesis, hematemesis, abdominal pain, dilation of the abdomen, difficulty in walking [90].

Ophthalmologic lesions can occur at any stage of CME and include anterior uveitis, retinal or subretinal hemorrhage with detachment, chorioretinitis, and blindness [91].

Clinical and laboratory findings consist of an increase or decrease in the number of leukocytes (neutrophils and lymphocytes) and platelets and predominantly anemia [89]. It also presents anemia as the most frequent hematological disorder, followed by thrombocytopenia [90].

1.4.2 Subclinical phase of CME

The chronic course can last up to 5 years, in a subclinical state, until the serious disease develops. In the subclinical phase, there is thrombocytopenia [88], high antibody production, mainly due to hypergammaglobulinemia, but with hypoalbuminemia [88, 92].

1.4.3 Chronic phase of CME

In the severe phase, weight loss, wasting, lymphadenopathy, fevers, hemorrhages, non-regenerative anemia, thrombocytopenia, spinal cord pancytopenia, and death are observed [88, 93, 94]. Hyperglobulinemia is also observed and may favor the development of blood hyperviscosity [95]. Animals die due to bleeding or septicemia caused by E. canis[88].

1.4.4 Acute phase of TRC

TRC caused by A. platyshas an acute and cyclic phase following an incubation period of 1–2 weeks, with a parasitemia occurring every 10 to 14 days causing a transient thrombocytopenia accompanied by fever [96]. One study has shown that experimental A. platysinfection has developed lymph node enlargement in dogs [96]. However, many dogs present asymptomatic TRC [97].

In Europe and the Middle East, there are descriptions of A. platysstrains that are more virulent and cause disease with clinical signs similar to dogs with CME [98, 99]. Thus, dogs with infection with virulent A. platysstrains may show clinical signs of abdominal pain, splenomegaly, high fever, thrombocytopenia, hypoproteinemia, large platelets, monocytosis, and low hematocrit [88, 100]. Another study found dogs naturally infected with A. platyswith acute clinical signs of anorexia, depression, weight loss, transient epistaxis, pale mucosae, severe thrombocytopenia, anemia, leukopenia, and hyperproteinemia [98].

1.4.5 Chronic phase of TRC

In Brazil, TRC does not develop severe clinical signs in dogs, only a decrease in platelet counts in general. Dogs that have A. platysinfection have cyclic thrombocytopenia, but do not have bleeding episodes as in dogs with CME [101].

The chronic phase demonstrates an adaptation of the infected animal’s organism to infection. At this stage, infected dogs have a cyclic period of low parasitemia accompanied by moderate thrombocytopenia [102].

Advertisement

2. Diagnostic methods

2.1 Parasitological diagnosis

Pathogen identification can be done using blood smears. In the acute phase of the disease, E. canismorulae can be observed inside mononuclear cells or, in the case of A. platys, on platelets. However, these agents may not be found in many of these cases, as they are more commonly found in dogs sick in the febrile phase [103].

Direct visualization of the agent in mononuclear cells, especially lymphocytes, seen in blood smears is known to be a definitive diagnosis of CME, as visualization of morulae with correct morphological characterization is considered a pathognomonic sign of the disease [103]. However, there are other agents that infect mononuclear cells, and differential diagnosis should be made correctly in order to avoid false-negative diagnosis [104].

2.2 Serologic diagnosis

For the detection of CME, there are several diagnostic methods. At the veterinary clinic, a rapid test with only one drop of blood is routinely performed based on the serum evaluation of anti-Ehrlichiaantibodies [88]. Similarly, there are kits for detection of A. platysand A. phagocytophilum[105].

Indirect immunofluorescence a serological test used more in research, marks the specific target with antibodies to be viewed and can be used as a definitive diagnosis [55, 106].

2.3 Culture and isolation

Members of the Rickettsialles family, such as Ehrlichia, can be cultured in cultured cells under controlled conditions, but proliferation time is prolonged. This, in addition to the fact that many techniques depend on purification of the agent relative to the host cell component of the culture, makes the process even more difficult and time consuming [107].

2.4 Molecular diagnosis

The definitive diagnosis can also be performed by molecular examinations by detecting genetic material from microorganisms in the samples [108, 109] and specificity [110]. Over the years, it has become an increasingly modern and improved technique for pathogen identification and safe against possible contamination, such as quantitative PCR (qPCR) [111].

2.5 Clinical and laboratory diagnosis

The presumptive clinical diagnosis of CME made by the professional in the veterinary office can be performed by observing clinical signs; however, there is a high chance of giving a different result than the real one, since CME has a multisystemic character and nonspecific clinical signs, thus requiring other tools [35].

In clinical and laboratory analyzes, thrombocytopenia presented by dogs with clinical signs suggestive of CME helps to rule out other diseases, being this parameter used in routine veterinary clinics as a strong suspicion of being positive for E. canis[112]. Other signs such as anemia, leukocytosis, and leukopenia are observed in dogs with CME, which helps in the diagnosis [89]. Observation of isolated thrombocytopenia without other clinical signs are suggestive of CRT [6].

2.6 Differential diagnosis

The clinical and laboratory signs presented observed in CME and CRT can be observed in other diseases caused by other infectious agents, especially those transmitted by ticks. Infections such as hepatozonosis, babesiosis, and distemper may present similar clinical signs and should be considered in the differential diagnosis [113]. Another disease to be considered is canine visceral leishmaniasis (CVL) in cases of thrombocytopenia, anemia, medular aplasia, and hemorrhages [114], especially in regions endemic for CVL [113].

2.7 Hemorheological diagnosis

Animals infected with hematozoa, including Anaplasmataceae, may present changes in hematological parameters [89]. However, hematozoa can also lead to alteration of the rheological behavior of the blood, as a work that demonstrated alteration of blood viscosity of humans infected with Plasmodiumssp. [7], and another that demonstrated changes in blood viscosity of dogs infected with Leishmaniassp. [9].

Rheometry is an auxiliary tool that allows the measurement of the fluid viscosity curve, as well as the blood, and can be used to monitor these altered parameters in dogs with hematological and rheological disorders, thus serving as an ally in the therapeutic monitoring of sick dogs. Such a tool has been used experimentally to measure blood viscosity in both Plasmodiumssp. infected humans [7], as in dogs infected with Leishmaniassp. [9].

2.8 Rheology

Rheometric blood analysis or hemoremometry is a technique for measuring blood viscosity that helps in understanding the pathogenesis of diseases affecting the blood [9]. Blood functions as a viscous fluid, with different viscosities depending on the amount of cells, platelets, and other blood solutes [114, 115], so if a disease alters the amount of cells, the deformability erythrocyte or serum components, the viscosity also changes.

Rheometry allows the measurement of blood viscosity using the rheometer, a device that measures the ability of a liquid to flow based on its resistance to dissipation when pressure is applied to it [116]. To understand how immunomodulation of blood rheological behavior occurs in metabolic or infectious diseases, the change in blood viscosity can be compared between sick and healthy, and these data correlate with cytokine profile for investigation of the immunophysiopathological process, as demonstrated by França et al. [8] and Scherer et al. [7].

This branch of science allows an understanding of how hemorheological behavior is influenced by cellular components and blood plasma on blood viscosity, peripheral resistance, circulating volume, and blood pressure. The capacity of erythrocyte deformation is influenced by blood pressure, and this phenomenon is important for maintaining macro tantone blood flow as well as microcirculation [114]. Blood viscosity is also influenced by blood cell count. Patients with anemia demonstrate decreased blood viscosity [117].

The increased amount of leukocytes and platelets disturbs the normal flow of erythrocytes, especially in microcirculation. Another phenomenon that impairs this flow is when the erythrocytes lose their capacity for deformation, or when the pressure of the blood vessels is increased, making it difficult to pass, such as diabetes mellitus, changes in the physical characteristics of erythrocytes are observed [114].

Viscosity and blood flow become compromised to cellular and plasma changes that occur in various diseases. Metabolic diseases such as diabetes mellitus lead to erythrocyte changes [118], in addition to other factors such as increased serum osmolarity [119] and endothelial lesions lead to blood hyperviscosity syndrome [120]. In infectious diseases, such as those caused by obligate intracellular parasites, increased blood viscosity occurs, as observed in dogs with Canine Visceral Leishmaniasis [9] and in humans with malaria [7].

This technique has been used in research to help understand diseases by blood parasites such as Plasmodiumspp., causative agent of malaria. Infected individuals showed elevated blood viscosity and high levels of IFN-γ and IL-17, as well as low TGF-β concentration compared to uninfected ones [7]. In addition to infectious diseases, metabolic diseases such as diabetes melittus lead to changes in blood viscosity [8]. Thus, blood viscosity may also be influenced by the action of substances present in serum such as cytokines.

Rheometry, considered as a low-cost auxiliary technique, can be used as a tool for monitoring the hematological condition and haemorrheological behavior of animals infected with infectious diseases, as shown in a study that evaluated dogs naturally infected with Leishmaniasp. [9].

Advertisement

3. Metodology aspects, results, and discussion

The procedures were previously approved by the Animal Use Ethics Committee-CEUA/UFMT, Brazil, and collection of clinical samples was authorized by the dog owners by signing the informed consent form.

Blood samples were collected from 72 dogs, regardless of males and females, of different ages and breeds, during the 19 months in Barra do Garças—MT (52.2599 15° 53′ 35 South, 52° 15′ 36″ Oeste), Midwest region of Brazil to analyze the rhreometry parameters and cytokines concentrations. Diagnostic confirmation was obtained by molecular Polymerase Chain Reaction (PCR) technique that was used to determine the groups of not infected and infected by Anaplasmataceae. The rheometry of the fresh blood samples was measured by using the Modular Compact Rheometer—MCR 102 (Anton Paar® GmbH, Ostfildern, Germany), and the graphs were obtained using Rheoplus software. Blood count data were obtained by analysis in a private laboratory. Serum cytokines were dosed by flow cytometry (FACScalibur BD®) using BD® Biosciences Cytometric Bead Array (CBA) kits.

For the statistical analysis of the concentration of cytokines, rheological and hematological parameters used the Student t test. For the correlation analyses, the Pearson correlation test was used. Data were expressed as mean ± standard error. Values less than 0.05 (p < 0.05) were considered significant.

Thus, serological screening was initially performed to check for natural infection using the SNAP 4DX Plus of IDEXX ELISA test for detection of both Ehrlichiassp. and Anaplasmaspp. High rates of infection (75%) with Anaplasmataceae were observed (Table 1). Interestingly, studies on dogs with suspected infection also had high rates of infection with these bacteria [21].

NegativeAnaplasmataceaeEhrlichiaspp.Anaplasmaspp.Ehrlichia+ AnaplasmaTotal
Number144329141257
Prevalence (%)2575512521

Table 1.

Detection of specific antibody for Anaplasmataceae family (Ehrlichiassp. and Anaplasmaspp.) using SNAP 4DX Plus of IDEXX ELISA test in dogs from the city of Barra do Garças—MT.

Seroprevalence of 51% (29/57) for Ehrlichiaspp. was higher in dogs evaluated when compared with other studies [1, 21, 55]. In the literature, there are data on seroprevalence of A. platysin Brazil and worldwide [2, 3]. In this work, the prevalence of Anaplasmaspp. was 25%, whereas in other studies in Brazil and Asia were showed lower prevalence [2, 3].

Diagnostic confirmation was performed by PCR molecular examination using the primer oligonucleotides shown in Table 2. The results showed a prevalence of 52% of Anaplasmataceae infection, which is slightly lower compared to other similar work also developed in Mato Grosso [1]. Such high rates are also found in a seroprevalence study in northeastern Brazil that shows to be greater than 50% in the Alagoas state [17].

IdentificationSequence 5′-3′AuthorPrimer
AnaplasmataceaeGGTACCYACAGAAGAAGTCCInokuma et al. [121]EHR16sd
TAGCACTCATCGTTTACAGCInokuma et al. [121]EHR16sr
E. canisCAATTATTTATAGCCTCTGGCTATAGGAMurphy et al. [122]ECAN5
TATAGGTACCGTCATTATCTTCCCTATMurphy et al. [122]HE3
A. platysGATTTTTGTCGTAGCTTGCTATGLima et al. [22]PLATYS
TAGCACTCATCGTTTACAGCLima et al. [22]EHR16sr

Table 2.

Primers used in the PCR tests of the present study.

In contrast, in the amplification of the E. canisand A. platysDNA gene16S, there were prevalences of 28 and 32%, respectively. Regarding E. canis, other authors found a prevalence of 38.4–59% [1, 21]. Studies with A. platysusing molecular techniques in Mato Grosso revealed 26.2% [1]. However, higher prevalence of infection has been reported in other regions of Brazil [11, 123].

Coinfection by A. platysand E. canisare also commonly found in dogs in areas containing the R. sanguineusvector [34]. In the animals evaluated in this study, it was observed a prevalence of 20% of coinfection (Table 3).

NegativeAnaplasmataceaeE. canisA. platysE. canis+ A. platys
Number1213785
Prevalence (%)4852283220

Table 3.

Results of PCR tests for detection of Anaplasmataceae, E. canisand A. platysbacteria.

Table 4 presents the results of the mean values of erythrogram, leukogram, platelet, and total protein parameters that were analyzed in the samples of negative dogs positive for Anaplasmataceae. Blood count showed a significant difference between mean erythrocyte values (p = 0.03) in the group of animals infected with Anaplasmataceae, suggesting a mild to severe anemia in these animals. Reduction in erythrocyte count showed a strong positive correlation (p = 0.013; r = 0.7) with blood viscosity, but was more evident in a negative erythrocyte correlation with shear rate in this same group (p = 0.0001; r = −0.88).

NegativeAnaplasmataceaeStatistical
Erythrocytes (tera/L)7.5 ± 1.095.76 ± 1.91p < 0.05
Hemoglobin (g/dL)17.18 ± 2.4613.09 ± 4.19p < 0.05
Hematocrit (%)50.3 ± 6.7738.4 ± 12.7p < 0.05
Leukocytes(1/μL)10.92 ± 2.4011.81 ± 5.29p > 0.05
Neutrophils (1/μL)6.57 ± 1.878.02 ± 3.98p > 0.05
lymphocytes (1/μL)2.87 ± 0.982.5 ± 1.7p > 0.05
Monocytes (1/μL)0.42 ± 0.250.4 ± 0.24p > 0.05
Platelets (1/μL)177.16 ± 81.74191.58 ± 103.56p > 0.05
Total Protein (g/dL)6.83 ± 0.866.15 ± 1.2p > 0.05

Table 4.

Hemogram and total protein values of dogs negative and positive for Anaplasmataceae bacteria.

Dogs naturally infected by Anaplasmataceae showed changes in blood viscosity compared to uninfected dogs (Table 5). Viscosity values were inversely proportional to shear rate in both groups studied (Figure 1). Also, there were differences in shear rate (p = 0.008). Previous work on dogs infected with Leishmania also showed changes in blood viscosity [9]. Blood flow curves and their respective hysteresis areas in infected animals revealed lower shear rates compared to uninfected animals (Figure 2).

NegativeAnaplasmataceaeStastitical
Viscosity (Pa/s)7.44 ± 5.8 × 10−35.5 ± 5.67 × 10−3p < 0.05
Share rate (1/s)405.68 ± 51.09592.56 ± 223.24p < 0.05

Table 5.

Mean and standard deviation of the rheology of healthy dogs and dogs naturally infected by bacteria of the Anaplasmataceae.

Figure 1.

Viscosity curves of dog whole blood infected or not by bacteria of Anaplasmataceae.

Figure 2.

Histerese area of flow curve of dog whole blood infected or not by bacteria of Anaplasmataceae.

The mean viscosity and shear rate values in both groups revealed significant differences for both parameters (Table 5). There were differences in shear rate (p = 0.008) and also in viscosity (p < 0.0001). There was no difference in the averages analyzed between the groups regarding the leukocyte, platelet, and total protein concentrations.

The serum profile of inflammatory, anti-inflammatory, and regulatory cytokines, IL-2, IL-4, IL-6, IL-10, TNF-α, IFN-γ, IL-17A were evaluated according to Scherer et al. [7] and Silva et al. [9]. Among the cytokines, the only one that showed difference between the infected and uninfected groups was IL-10 (Table 6). The serum concentration of this interleukin was lower in the infected group when compared to dogs Anaplasmataceae negative.

CytokinesAnaplasmataceae (−)Anaplasmataceae (+)
IL-267.1 ± 10.673.0 ± 14.7
IL-431.2 ± 9.934.5 ± 4.9
IL-631.3 ± 11.632.0 ± 3.8
IL-1032.7 ± 8.237.1 ± 3.7*
IL-17371.7 ± 224.2502.1 ± 379.1
TNF-α533.8 ± 260.4319.6 ± 245.4
IFN-γ253.8 ± 172.5256.2 ± 156.4

Table 6.

Cytokine concentrations in dogs non-infected and dogs with Anaplasmataceae.

P < 0.05.


The results were expressed in mean and standard error.

The hemogram, rheometry, and serum cytokines parameters were correlated using Pearson’s correlation test (Figure 3). There was an inversely proportional correlation between viscosity and shear rate, shear rate and erythrocytes, and shear rate and IFN-γ. We also observed directly proportional correlations between erythrocytes and blood viscosity, IFN-γ and blood viscosity, and IFN-γ and erythrocytes.

Figure 3.

Correlation between viscosity with erythrocytes, shear rates and IFN-γ; erythrocytes with shear rates and IFN-γ; and IFN-γ with shear rates of dogs infected with Anaplasmataceae.

Dogs naturally infected by Leishmania have altered blood viscosity related to decreased erythrocytes [9]. In this study, there was a negative correlation between shear rate and hematocrit (p = 0.0004; r = −0.85).

The explanation for the occurrence of hemorheological alterations observed in dogs infected by Anaplasmataceae in this study may be related to alteration of erythrocyte morphology which, in turn, leads to alteration of blood viscosity as a systemic disease. Diseases caused by infectious agents that parasitize erythrocytes or monocytes lead to changes in the rheological properties of blood [7, 9, 124].

Infectious agents of the Anaplasmataceae family cause diseases with systemic manifestations in dogs, with morphological changes in erythrocytes and anemia in dogs with CME are common [21].

Morphological changes in leukocytes, platelets, and erythrocytes have also been described in cattle infected with a variety of agents including Anaplasmataceae bacteria, protozoa, and filaroid parasites [125]. Dogs with different types of anemia also have morphological changes, including anemia secondary to systemic inflammatory disease [126].

Dogs infected with Leishmaniashowed no correlation between blood viscosity or shear rate and leukocyte, platelet, total protein and globulin parameters [9]. In this study, dogs naturally infected by bacteria of the Anaplasmataceae showed no correlation between viscosity and leukocytes, platelets and interleukins (IL-2, IL-4, IL-6, IL-10, TNF-α, and IL-17a).

The cytokine TNF-α may aggravate the clinical signs in animals infected by Anaplasmataceae [63], but in this study no correlations of this cytokine with alteration of viscosity, anemia or leukocytes were found. The data presented corroborate the one presented by Lima et al. [71] who found no correlation of anemia with TNF-α and IL-10 in dogs naturally infected with E. canis.

Total proteins were strongly correlated with blood viscosity in relation to the group of animals infected by Anaplasmataceae bacteria (p = 0.0007; r = 0.84). Studies by Silva et al. [9] found no correlation between these parameters in Leishmania-positive dog samples, nor even a correlation between viscosity and immunoglobulins. However, it has been reported that fibrinogen binding may occur in erythrocytes due to increased serum fibrinogen concentration [127].

Interestingly, in this work, the serum IFN-γ concentration was promising. Regarding the group of animals infected by bacteria of the Anaplasmataceae family, this interleukin showed a strong positive correlation with blood viscosity (p = 0.007; r = 0.73), negative correlation with shear rate (p = 0.016; r = −0.68), which may indicate a modulation of hemorheological behavior, mainly a decrease in blood viscosity and, consequently, an increase in shear rate in animals infected by bacteria of the Anaplasmataceae family.

Cytokine immunomodulation is also reported in other mandatory intracellular parasite infections. Studies by Scherer et al. [7] demonstrated that in P. vivax-infected patients, IL-17a was the cytokine responsible for decreasing blood viscosity, which probably decreased erythrocyte rupture, as these cells demonstrated easy osmotic shock due to infection.

The possible correlation of IFN-γ with erythrocytes (p = 0.04; r = 0.6) in relation to the group of infected animals allows us to infer that IFN-γ was able to pathologically immunomodulate, aggravating the anemic condition in dogs. Martin et al. [61] described that IFN-γ is linked to the survival of the Anaplasmataceae infected patient, and this cytokine may have its effect increased in the presence of TNF-α [62]. No correlations were found between IFN-γ and TNF-α, even though there were serum concentrations of both cytokines in the blood of animals infected by bacteria from Anaplasmataceae family. Perhaps, TNF-α may influence the effect of IFN-γ on disease stage differences caused by Anaplasmataceae family bacteria in dogs.

Although IFN-γ is important in controlling infection with a Th1-type immune response [75], it can also be detrimental to erythrocytes in animals infected with Anaplasmataceae as it may lead to a severe decrease in cell count, if not immunoregulated by another cytokine.

Serum IL-10 levels showed a difference between the studied groups [Table 6], being relevant the increase of its concentration in dogs infected by Anaplasmataceae bacteria. Studies by Faria et al. [70] demonstrated that experimentally infected E. canisinfected lymphocytes and splenocytes have high IL-10 and low IFN-γ production, indicating modulation to a Th2-like profile, as IL-10 negatively modulates IFN-γ production.

The use of IL-12 [11] and continuous use of IFN-γ [10] assist in the treatment of Leishmania infected animals, as the Th1 response profile is effective in eliminating the parasite. Experimental controlled use of anti-IL-10 antibodies also demonstrated improvement in Leishmania positive animals [128]. Thus, dogs undergoing treatment with Anaplasmataceae are likely to have a better chance of eliminating the agent using IFN-γ at controlled doses. In the case of dogs with anemia, perhaps the regulated use of IL-10 may immunomodulate the response and prevent the deleterious action of IFN-γ on erythrocytes.

Advertisement

4. Conclusion

Dogs naturally infected by Anaplasmataceae have serum concentration of different cytokines, but IFN-γ seems to be responsible for decreasing blood viscosity in these animals and causing disturbances in erythrocytes that are harmful. However, IFN-γ is also important in eliminating Anaplasmataceae by regulating the proliferation of these bacteria in infected dogs.

Alteration of blood rheology in dogs naturally infected with Anaplasmataceae probably occurs due to the systemic character of the infection that leads to erythrocyte alterations, which in turn disrupt the normal blood flow in these animals. Thus, cytokine modulation reflects the hemorheological profile of infected animals and mainly the viscosity and shear rates.

It is not known which proteins could be involved in this process of viscosity alteration in dogs infected by bacteria of the Anaplasmataceae family. Thus, further studies are needed to understand which proteins are related to the decrease in viscosity in these animals.

It is proposed that the determination of blood rheological parameters as well as their therapeutic accompaniment may be important for dogs naturally infected with Anaplasmataceae. Controlled use of IFN-γ may be a tool to aid treatment, but anemia rates should be considered. In addition, infected dogs with moderate to severe anemia rates could benefit from IL-10 treatment.

Advertisement

Acknowledgments

This research received grants from the Mato Grosso Research Support Foundation (FAPEMAT No299032/ 2010), from the National Council for Scientific and Technological Development (CNPq No. 447218/ 2014-0 No. 308600/2015-0), in Brazil and Propes/IFMT (No. 36/2017).

Advertisement

Conflict of interests

The authors declare that there is no conflict of interest and non-financial competitors.

References

  1. 1. Almeida ABPF, Paula DAJ, Dutra V, Nakazato L, Mendonça AJ, Sousa VRF. Infecção porEhrlichia caniseAnaplasma platysem cadelas e neonatos em Cuiabá, Mato Grosso. Archives of Veterinary Science. 2010;15:127-134
  2. 2. Lasta CS, Santos AP, Messick JB, Oliveira ST, Biondo AW, Vieira RF, et al. Molecular detection ofEhrlichia canisandAnaplasma platysin dogs in southern Brazil. Revista Brasileira de Parasitologia Veterinária. 2013;22:360-366
  3. 3. Yuasa Y, Tsai YL, Chang CC, Hsu TT, Chou CC. The prevalence ofAnaplasma platysand a potential novelAnaplasmaspecies exceed that ofEhrlichia canisin asymptomatic dogs andRhipicephalus sanguineusin Taiwan. Journal of Veterinary Medical Science. 2017;79:1494-1502
  4. 4. Pruneau L, Moumène A, Meyer DF, Marcelino I, Lefrançois T, Vachiéry N. Understanding Anaplasmataceae pathogenesis using “Omics” approaches. Frontiers in Cellular and Infection Microbiology. 2014;4:1-7
  5. 5. Rikihisa Y. Diagnosis of emerging ehrlichial diseases of dogs, horses, and humans. Journal of Veterinary Internal Medicine. 2000;14:250-251
  6. 6. Harvey JW, Simpson CF, Gaskin JM. Cyclic thrombocytopenia induced by rickettsi-like agent in dogs. The Journal of Infectious Diseases. 1978;137:182-188
  7. 7. Scherer EF, Cantarini DG, Siqueira R, Ribeiro EB, Braga EM, Honório-França AC, et al. Cytokine modulation of human blood viscosity from vivax malaria patients. Acta Tropica. 2016;158:139-147
  8. 8. França EL, Ribeiro EB, Scherer EF, Cantarini DG, Pessôa RS, França FL, et al. Effects ofMomordica charantia L. on the blood rheological properties in diabetic patients. BioMed Research International. 2014;2014:1-8
  9. 9. Silva JN, Cotrim AC, Conceição LAV, Marins CMF, Marchi PGF, Honório-França AC, et al. Immunohaematological and rheological parameters in canine visceral leishmaniasis. Revista Brasileira de Parasitologia Veterinária. 2018;27:211-217
  10. 10. Murray HW. Effect of continuous administration of interferon-y in experimental visceral leishmaniasis. The Journal of Infectious Diseases. 1990;161:992-994
  11. 11. Murray HW, Montelibano C, Peterson R, Sypek JP. Interleukin 12 regulates the response to chemotherapy in experimental visceral leishmaniasis. The Journal of Infectious Diseases. 2000;182:1497-1502
  12. 12. Correa ES, Paludo GR, Scalon MC, Machado JA, Lima ACQ , Pinto ATB, et al. Investigação molecular deEhrlichiaspp. eAnaplasma platysem felinos domésticos: alterações clínicas, hematológicas e bioquímicas. Pesquisa Veterinaria Brasileira. 2011;31:899-909
  13. 13. Hackstadt T. The diverse habitats of obligate intracelular parasites. Current Opinion in Microbiology. 1998;1:82-87
  14. 14. Ganta RR. Anaplasmataceae:Anaplasma. In: Mcvey DS, Melissa K, Chengappa MM, editors. Veterinary Microbiology. Chichester: John Wiley & Sons, Inc; 2013a. pp. 302-305
  15. 15. Ganta RR. Anaplasmataceae:EhrlichiaandNeorickettsia. In: Mcvey DS, Melissa K, Chengappa MM, editors. Veterinary Microbiology. Chichester: John Wiley & Sons, Inc; 2013b. pp. 297-301
  16. 16. Suksawat J, Hegarty BC, Breitschwerdt EB. Seroprevalence ofEhrlichia canis,Ehrlichia equi, andEhrlichia risticiiin sick dogs from North Carolina and Virginia. Journal of Veterinary Internal Medicine. 2000;14:50-55
  17. 17. Vieira RFC, Biondo AW, Guimaraes MAS, Santos AP, Santos RP, Dutra LH, et al. Ehrlichiosis in Brazil. Revista Brasileira de Parasitologia Veterinária. 2011;20:1-12
  18. 18. Ribeiro CM, Matos AC, Azzolini T, Bones ER, Wasnieski EA, Richini-Pereira VB, et al. Molecular epidemiology ofAnaplasma platys,Ehrlichia canisandBabesia vogeliin stray dogs in Paraná, Brazil. Pesquisa Veterinária Brasileira. 2017;37:129-136
  19. 19. Zobba R, Anfossia AG, Visco S, Sotgiu F, Dedola C, Pinna Parpaglia ML, et al. Cell tropism and molecular epidemiology ofAnaplasma platys-like strains in cats. Ticks and Tick-borne Diseases. 2015;6:272-280
  20. 20. Fontalvo MC, Braga IA, Aguiar DM, Horta MC. Serological evidence of exposure toEhrlichia canisin cats. Ciência Animal Brasileira. 2016;17:418-424
  21. 21. Dagnone AS, Souza AI, André MR, Machado RZ. Molecular diagnosis of Anaplasmataceae organisms in dogs with clinical and microscopical signs of ehrlichiosis. Revista Brasileira de Parasitologia Veterinária. 2009;18:20-25
  22. 22. Lima MA, Aquino LC, Paludo GR. Evaluation of Anaplasmataceae family agents infection in domestic cats. Pakistan Veterinary Journal. 2017;37:201-204
  23. 23. Donatien A, Lestoquard F. Existence en Algérie d’uneRickettsiadu chien. Bulletin de la Société de Pathologie Exotique. 1935;28:418-419
  24. 24. Machado RZ. Erliquiose canina. In: XIII Congresso Brasileiro de Parasitologia Veterinária & I Simpósio Latino-Americano de Rickettsioses. Revista Brasileira de Parasitologia Veterinária. 2004;13:53-57. Available from:https://docplayer.com.br/15106223-Xiii-congresso-brasileiro-de-parasitologia-veterinaria-i-simposio-latino-americano-de-ricketisioses-ouro-preto-mg-2004.html[Accessed on: 07 Feburary 2019]
  25. 25. Huxsoll DL, Hildebrandt PK, Nims RM, Walker JS. Tropical canine pancytopenia. Journal of the American Veterinary Medical Association. 1970;157:1627-1632
  26. 26. Costa JO, Silva M, Batista Júnior JA, Guimarães MP.Ehrlichia canisinfection in dog in Belo Horizonte – Brazil. Arq Esc Vet Bela Horizonte. 1973;25:199-200
  27. 27. Straube J. Canine Ehrlichiosis – From acute infection to chronic disease. CVBD: Digest. 2010;7:1-12
  28. 28. Ojeda-Chi MM, Rodriguez-Vivas RI, Esteve-Gasent MD, Pérez de León AA, Modarelli JJ, Villegas-Perez SL.Ehrlichia canisin dogs of Mexico: Prevalence, incidence, co-infection and factors associated. Comparative Immunology, Microbiology and Infectious Diseases. 2019;67:101351
  29. 29. Keefe TJ, Holland CJ, Salyer PE, Ristic M. Distribution ofEhrlichia canisamong military working dogs in the world and selected civilian dogs in the United States. Journal of the American Veterinary Medical Association. 1982;181:236-238
  30. 30. Hildebrandt PK, Conroy JD, Mckee AE, Nyindo MB, Huxsoll DL. Ultrastructure ofEhrlichia canis. Infection and Immunity. 1973;7:265-271
  31. 31. Labarthe N, Pereira M, Barbarini O, Mckee W, Coimbra C, Hoskins J. Serologic prevalence ofDiroflaria immitis, Ehrlichia canis, andBorrelia burgdorferiinfections in Brazil. Veterinary Therapeutics. 2003;4:67-75
  32. 32. Perez M, Rikihisa Y, Wen B.Ehrlichia canis-like agent isolated from a man in Venezuela: antigenic and genetic characterization. Journal of Clinical Microbiology. 1996;34(9):2133-2139
  33. 33. Dumler JS, Barbet AF, Bekker CP, Dasch GP, Palmer GH, Ray SC, et al. Reorganization of genera in the families Rickettsiaceae and Anaplasmataceae in the order Rickettsiales: Unification of some species ofEhrlichiawithAnaplasma,CowdriawithEhrlichiaandEhrlichiawithNeorickettsia, descriptions of six new species combinations and designation ofEhrlichia equiand ‘HGE agent’ as subjective synonyms ofEhrlichia phagocytophila. International Journal of Systematic and Evolutionary Microbiology. 2001;5:2145-2165
  34. 34. Mcquiston JH, Mccall CL, Nicholson WL. Ehrlichiosis and related infections. Journal of the American Veterinary Medical Association. 2003;223:1750-1756
  35. 35. Neer TM, Harrus S. Ehrlichiosis, Neorickettsiosis, Anaplasmosis, and Wolbachia infection. In: Greene CE, editor. Infectious Diseases of the Dog and Cat. St Louis: Elsevier; 2006. pp. 203-232
  36. 36. De La Fuente J, Torina A, Naranjo V, Nicosia S, Alongi A, Lamantia F, et al. Molecular characterization ofAnaplasma platysstrains from dogs in Sicily, Italy. BMC Veterinary Research. 2006;2:1-5
  37. 37. De Caprariis D, Dantas-Torres F, Capelli G, Mencke N, Stanneck D, Breitschwerdt EB, et al. Evolution of clinical, haematological and biochemical findings in young dogs naturally infected by vector-borne pathogens. Veterinary Microbiology. 2011;149:206-212
  38. 38. Rodrigues D, Daemon E, Rodirgues AFSF, Feliciano EA, Soares AO, Souza AD. Levantamento de hemoparasitos em cães da área rural de Juiz de Fora, Minas Gerais, Brasil. Revista Brasileira de Parasitologia Veterinaria. 2004;3:371
  39. 39. Ferreira RF, Cerqueira AMF, Pereira AM, Guimarães CM, Sá AG, Abreu FS, et al.Anaplasma platysdiagnosis in dogs: Comparison between morphological and molecular tests. International Journal of Applied Research in Veterinary Medicine. 2007;5:113-119
  40. 40. Ramos CAN, Ramos RAN, Araujo FR, Guedes DSJr., Souza IIF, Ono TM, Vieira AS, Pimentel DS, Rosas EO, Faustino MAG, Alves LC. Comparison of nested-PCR with blood smear examination indetection ofEhrlichia canisandAnaplasma platysin dogs. Revista Brasileira de Parasitologia Veterinária. 2009;1:58-62
  41. 41. Maggi RG, Mascarelli PE, Havenga LN, Naidoo V, Breitschwerdt EB. Co-infection withAnaplasma platys,Bartonella henselaeandCandidatus Mycoplasmahaematoparvum in a veterinarian. Parasites & Vectors. 2013;6:103
  42. 42. Arraga-Alvarado CM, Qurollo B, Parra OC, Berrueta MA, Hegarty BC, Breitschwerdt EB. Molecular evidence ofAnaplasma platysinfection in two women from Venezuela. The American Journal of Tropical Medicine and Hygiene. 2014;91:1161-1165
  43. 43. Sousa VRF, Bomfim TCB, Almeida ABPF, Barros LA, Sales KG, Justino CHS, et al. Coinfecção porAnaplasma platyseEhrlichia canisem cães diagnosticada pela PCR. Acta Scientiae Veterinariae. 2009;37:281-283
  44. 44. Santos AS, Alexandre N, Sousa R, Nuncio MS, Bacellar F, Dumler JS. Serological and molecular survey ofAnaplasmaspecies infection in dogs with suspected tickborne disease in Portugal. The Veterinary Record. 2009;164:168-171
  45. 45. Silva GCF, Benitez NA, Girotto A, Taroda A, Vidotto MC, Garcia JL, et al. Occurrence ofEhrlichia canisandAnaplasma platysin household dogs from northern Parana. Revista Brasileira de Parasitologia Veterinaria. 2012;21:379-385
  46. 46. Diniz PPVP, Beall MJ, Omark K, Chandrashekar R, Daniluk DA, Cyr KE, et al. High prevalence of tick-borne pathogens in dogs from an Indian reservation in northeastern Arizona. Vector Borne and Zoonotic Diseases. 2010;10:117-123
  47. 47. Souza DMB, Coleto ZF, Souza AF, Silva SV, Andrade JK, Gimenez GC. Erliquiose transmitida aos cães pelo carrapato marrom (Rhipicephalus sanguineus). Ciência Veterinária nos Trópicos. 2012;15:21-31
  48. 48. Yabsley MJ, Mckibben J, Macpherson CN, Cattan PF, Cherry NA, Hegarty BC, et al. Prevalence ofEhrlichia canis,Anaplasma platys,Babesia canis vogeli,Hepatozoon canis,Bartonella vinsonii berkhoffii, andRickettsiaspp. in dogs from Grenada. Veterinary Parasitology. 2008;151:279-285
  49. 49. Piranda EM, Faccini JLH, Pinter A, Pacheco RC, Cançado PHD, LABRUNA MB. Experimental infection ofRhipicephalus sanguineusticks with the bacteriumRickettsia rickettsii, using experimentally infected dogs. Vector-Borne and Zoonotic Diseases. 2011;11:29-36
  50. 50. Sherding RG. Rickettsiosis, Ehrlichiosis, Anaplasmosis, and Neorickettsiosis. In: Birchard SJ, Sherding RG, editors. Manual Saunders of Small Animal Pratice. St Louis: Saunders Elsevier; 2006. pp. 178-185
  51. 51. Borin S, Crivelenti LZ, Ferreira FA. Aspectos epidemiológicos, clínicos e hematológicos de 251 cães portadores de mórula deEhrlichiaspp. naturalmente infectados. Arquivo Brasileiro de Medicina Veterinária e Zootecnia. 2009;61:566-571
  52. 52. Harvey JW. Veterinary Hematology: A Diagnostic Guide and Color Atlas. Saunders: Elsevier; 2011. p. 368
  53. 53. Matei IA, Stuen S, Modrý D, Degan A, D’amico G, Mihalca AD. NeonatalAnaplasma platysinfection in puppies: Further evidence for possible vertical transmission. Veterinary Journal. 2017;219:40-41
  54. 54. Latrofa MS, Dantas-Torres F, De Caprariis D, Cantacessi C, Capelli G, Lia RP, et al. Vertical transmission ofAnaplasma platysandLeishmania infantumin dogs during the first half of gestation. Parasites & Vectors. 2016;9:149-269
  55. 55. Silva JN, Almeida ABPF, Sorte ECB, Freitas AG, Santos LGF, Aguiar DM, et al. Soroprevalência de anticorpos anti-Ehrlichia canisem cães de Cuiabá, Mato Grosso. Revista Brasileira de Parasitologia Veterinaria. 2010;19:108-111
  56. 56. Sanogo YO, Davoustb, Inokuma H, Camias JL, Parola P, Brouqui P. First evidence ofAnaplasma platysinRhipicephalus sanguineus(Acari: Ixodida) collected from dogs in Africa. The Onderstepoort Journal of Veterinary Research. 2003;70:205-212
  57. 57. Bremer WG, Schaefer JJ, Wagner ER, Ewing SA, Rikihisa Y, Needham GR, et al. Transstadial and intrastadial experimental transmission ofEhrlichia canisby maleRhipicephalus sanguineus. Veterinary Parasitology. 2005;131:95-105
  58. 58. Smith RD, Sells DM, Stephenson EH, Ristic MR, Huxsoll DL. Development ofEhrlichia canis, causative agent of canine Ehrlichiosis, in the tickRhipicephalus sanguineusand its differentiation from a symbiotic rickettsia. American Journal of Veterinary Research. 1976;37:119-126
  59. 59. Breitschwerdt EB. Canine and feline anaplasmosis: Emerging infectious diseases. In: Breitschwerdt EB, editor. Proceedings of the 2nd Canine Vector-Borne Disease (CVBD) Symposium. Sícilia, Itália: CBVD World of Knowledge; 2007. pp. 6-14
  60. 60. Welc-Faleciak R, Kowalec M, Karbowiak G, Bajer A, Behnke JM, Sinski E. Rickettsiaceae and Anaplasmataceae infections in Ixodes ricinus ticks from urban and natural forested areas of Poland. Parasites & Vectors. 2014;7:1-13
  61. 61. Martin ME, Carspersen K, Dumler JS. Immunopathology and ehrlichial propagation are regulated by interferon-γ and interleukin-10 in a murine model of human granulocytic ehrlichiosis. The American Journal of Pathology. 2001;158:1881-1888
  62. 62. Feng HM, Walker DH. Mechanisms of immunity toEhrlichia muris: A model of monocytotropic ehrlichiosis. Infection and Immunity. 2004;72:966-971
  63. 63. Beineke A, Markus S, Borlak J, Thum T, Baumgärtner W. Increase of pro-inflammatory cytokine expression in non-demyelinating early cerebral lesions in nervous canine distemper. Viral Immunology. 2008;21:401-410
  64. 64. Scorpio DG, Von Loewenich FD, Göbel H, Bogdan C, Dumler JS. Innate immune response toAnaplasma phagocytophilumcontributes to hepatic injury. Clinical and Vaccine Immunology. 2006;13:806-809
  65. 65. Lin M, Rikihisa Y.Ehrlichia chaffeensisdownregulates surface toll-like receptors 2/4, CD14 and transcription factors PU.1 and inhibits lipopolysaccharide activation of NF-kB, ERK 1/2 and p38 MAPK in host monocytes. Cellular Microbiology. 2004;6:175-186
  66. 66. Lee EH, Rikihisa Y. Protein kinase A-mediated inhibition of gamma interferon-induced tyrosine phosphorylation of Janus kinases and latent cytoplasmic transcription factors in human monocytes byEhrlichia chaffeensis. Infection and Immunity. 1998;66:2514-2520
  67. 67. Ismail N, Soong L, Mcbride JW, Valbuena G, Olano JP, Feng H-M, et al. Overproduction of TNF-a by CD8+ type 1 cells and down-regulation of IFN-g production by CD4+ Th1 cells contribute to toxic shock-like syndrome in an animal model of fatal monocytotropic ehrlichiosis. Journal of Immunology. 2004;172:1786-1800
  68. 68. Zhang JZ, Sinha M, Luxon BA, Yu XJ. Survival strategy of obligately intracellularEhrlichia chaffeensis: Novel modulation of immune response and host cell cycles. Infection and Immunity. 2004;72:498-507
  69. 69. Hess PR, English RV, Hegarty BC, Brown GD. Breitschwerdt EB, ExperimentalEhrlichia canisinfection in the dog does not cause immunosuppression. Veterinary Immunology and Immunopathology. 2006;109:117-125
  70. 70. Faria JLM, Munhoz TD, João CF, Vargas-Herández G, André MR, Pereira WAB, et al.Ehrlichia canis(Jaboticabal strain) induces the expression of TNF-α in leukocytes and splenocytes of experimentally infected dogs. Revista Brasileira de Parasitologia Veterinária. 2011;20:71-74
  71. 71. Lima AL, Santos GJL, Roatt BM, Reis AB, Freitas JCC, Nunes-Pinheiro DCS. Serum TNF-α and IL-10 inEhrlichiaspp. naturally infected dogs. Acta Scientiae Veterinariae. 2015;43:1-7
  72. 72. Dumler JS. The biological basis of severe outcomes inAnaplasma phagocytophiluminfection. FEMS Immunology and Medical Microbiology. 2012;64:13-20
  73. 73. Kocan KM, De La Fuente J, Blouin EF, Coetzee JF, Ewing SA. The natural history ofAnaplasma marginale. Veterinary Parasitology. 2010;167:95-107
  74. 74. Akkoyunlu M, Fikrig E. Gamma interferon dominates the murine cytokine response to the agent of human granulocytic ehrlichiosis and helps to control the degree of early rickettsemia. Infection and Immunity. 2000;68:1827-1833
  75. 75. Birkner K, Steiner B, Rinkler C, Kern Y, Aichele P, Bogdan C, et al. The elimination ofAnaplasma phagocytophilumrequires CD4+ T cells, but is independent of Th1 cytokines and a wide spectrum of effector mechanisms. European Journal of Immunology. 2008;38:3395-3410
  76. 76. Han S, Norimine J, Brayton KA, Palmer GH, Scoles GA, Brown WC.Anaplasma marginaleinfection with persistent high-load bacteremia induces a dysfunctional memory CD4+ T lymphocyte response but sustained high IgG titers. Clinical and Vaccine Immunology. 2010;17:1881-1890
  77. 77. Desjardins M, Descoteaux A. Inhibition of phagolysosomal biogenesis by theLeishmanialipophosphoglycan. The Journal of Experimental Medicine. 1997;185:2061-2068
  78. 78. Bogdan C, Rollinghoff M. The immune response toLeishmania: Mechanisms of parasite control and evasion. International Journal for Parasitology. 1998;28:121-134
  79. 79. Sacks D, Sher A. Evasion of innate immunity by parasitic protozoa. Nature Immunology. 2002;3:1041-1047
  80. 80. Popov VL, Yu X, Walker DH. The120 kDa outer membrane protein ofEhrlichia chaffeensis: Preferential expression on dense – Corecells and gene expression inEscherichia coliassociated with attachment and entry. Microbial Pathogenesis. 2000;28:71-80
  81. 81. Mavromatis K, Doyle CK, Lykidis A, Ivanova N, Francino MP, Chain P, et al. The genome of the Obligately intracellular bacteriumEhrlichia canisreveals themes of complex membrane structure and immune evasion strategies. Journal of Bacteriology. 2006;188:4015-4023
  82. 82. Troy GC, Forrester SD. Canine ehrlichiosis. In: Greene CE, editor. Infectious Diseases of the Dog and Cat. Philadelphia: WB Saunders; 1990. pp. 404-418
  83. 83. Harrus S, Waner T, Bark H. Canine monocytic ehrlichiosis – An update. Compendium on Continuing Education for the Practising Veterinarian. 1997b;19:431-444
  84. 84. Waner T, Harrus S, Weiss DJ, Bar H, Keysary A. Demonstration of serum antiplatelet antibodies in experimental acute canine ehrlichiosis. Veterinary Immunology and Immunopathology. 1995;48:177-182
  85. 85. Smith RD, Ristic M, Huxsoll DL, Baylor RA. Platelet kinetics in canine ehrlichiosis: Evidence for increased platelet destruction as the cause of thrombocytopenia. Infection and Immunity. 1975;11:1216-1221
  86. 86. Abeygunawardena I, Kakoma, Smith RD. Pathophysiology of canine ehrlichiosis. In: Williams JC, Kakoma I, editors. Ehrlichiosis: A Vector-Borne Disease of Animals and Humans. Washington: Kluwer Academic Press; 1990. pp. 78-92
  87. 87. De Tommasi AS, Baneth G, Breitschwerdt EB, Stanneck D, Dantas-Torres F, Otranto D, et al.Anaplasma platysin bone marrow megakaryocytes of young dogs. Journal of Clinical Microbiology. 2014;52:2231-2234
  88. 88. Nakaghi ACH, Machado RZ, Costa MT, André MR, Baldani CD. Canine Ehrlichiosis: Clinical, hematological, serological and molecular aspects. Ciência Rural. 2008;38:766-770
  89. 89. Sousa VRF, Almeida ABPF, Barros LA, Sales KG, Justino CHS, Dalcin L, et al. Avaliação clínica e molecular de cães com erliquiose. Ciência Rural. 2010;40:1309-1313
  90. 90. Bassi PB, Moreira TK, Silva CC, Bittar ER, Bittar JFF. Aspectos clínicos, epidemiológicos, hematológicos e sorológicos de animais diagnosticados comEhrlichia canisno Hospital Veterinário de Uberaba-MG. Medvep - Revista Científica de Medicina Veterinária - Pequenos Animais e Animais de Estimação. 2011;9:678-680
  91. 91. Harrus S, Waner T. Diagnosis of canine monocytotropic ehrlichiosis (Ehrlichia canis): An overview. Veterinary Journal. 2011;187:292-296
  92. 92. Kataoka A, Santana AE, Seki MC. Alterações do proteinograma sérico de cães naturalmente infectados porE. canis. Ars Veterinaria. 2006;22:98-102
  93. 93. Mcdade JE. Ehrlichiosis – A disease of animals and humans. The Journal of Infectious Diseases. 1990;161:609-617
  94. 94. Kelly PJ. Canine ehrlichioses: An update. Journal of the South African Veterinary Association. 2000;71:77-86
  95. 95. Shaw SE, Day MJ, Birtles RJ, Breitschwerdt EB. Tick-borne infectious diseases of dogs. Trends in Parasitology. 2001;17:74-80
  96. 96. Gaunt SD, Baker DC, Babin SS. Platelet aggregation studies in dogs with acuteEhrlichia platysinfection. American Journal of Veterinary Research. 1990;51:290-293
  97. 97. Cardozo GP, Oliveira LP, Zissou VG, Donini IAN, Roberto PG, Marins M. Analysis of the 16S rRNA gene ofAnaplasma platysdetected in dogs from Brazil. Brazilian Journal of Microbiology. 2007;38:478-479
  98. 98. Kontos VC, Papadopoulos O, French TW. Natural andexperimental canine infections with a Greek strain ofEhrlichia platys. Veterinary Clinical Pathology. 1991;20:101-105
  99. 99. Harrus S, Aroch I, Lavy E, Bark H. Clinical manifestations of infectious canine cyclic thrombocytopenia. The Veterinary Record. 1997a;141:247-250
  100. 100. Aguirre E, Tesouro MA, Ruiz L, Amusategui I, Sainz A. Genetic characterization ofAnaplasma(Ehrlichia)platysin dogs in Spain. Journal of Veterinary Medicine. B, Infectious Diseases and Veterinary Public Health. 2006;53:197-200
  101. 101. Dantas-Torres F. Canine vector-borne diseases in Brazi - review. Parasites & Vectors. 2008;1:1-17
  102. 102. Harvey JW. Thrombocytotrophic anaplasmosis (A. platys[E. platys] infection). In: Greene CG, editor. Infectious Diseases of the Dog and Cat. St. Louis: Saunders Elsevier; 2006. pp. 229-231
  103. 103. Elias E. Diagnosis of ehrlichiosis from the presence of inclusion bodies or morulae ofE. canis. Journal of Small Animal Practice. 1991;33:540-543
  104. 104. Mylonakis ME, Koutinas AF, Billinis C, Leontides LS, Kontos V, Papadopoulos O, et al. Evaluation of cytology in the diagnosis of acute canine monocytic ehrlichiosis (Ehrlichia canis): A comparison between five methods. Veterinary Microbiology. 2003;91:97-204
  105. 105. Bowman D, Little SE, Lorentzen L, Shields J, Sullivan MP, Carlin EP. Prevalence and geographic distribution ofDirofilaria immitis,Borrelia burgdorferi,Ehrlichia canis, andAnaplasma phagocytophilumin dogs in the United States: Results of a national clinic-based serologic survey. Veterinary Parasitology. 2009;160:138-148
  106. 106. Davoust B, Parzy D, Vidor E, Hasselot N, Martet G. Ehrlichiose canine experimentale: étude clinique et terapeutique. Revue de Médecine Vétérinaire. 1991;167:33-40
  107. 107. Mcclure EE, Chávez ASO, Shaw DK, Carlyon JA, Ganta RR, Noh SM, et al. Engineering of obligate intracellular bacteria: Progress, challenges and paradigms. Nature Reviews. Microbiology. 2017;15:544-558
  108. 108. Martin AR, Brown GK, Dunstan RH, Roberts TK.Anaplasma platys: An improved PCR for its detection in dogs. Experimental Parasitology. 2005;109:176-180
  109. 109. Aguiar DM, Saito TB, Hagiwara MK, Machado RZ, Labruma MB. Diagnóstico sorológico de erliquiose canina com antígeno brasileiro deEhrlichia canis. Ciência Rural. 2007;46:796-802
  110. 110. Nakaghi ACH, Machado RZ, Ferro JÁ, Labruna MB, Chryssafidis AL, André MR, et al. Sensitivity evaluation of a single-step PCR assay usingEhrlichia canisp28 gene as a target and its application in diagnosis of canine ehrlichiosis. Revista Brasileira de Parasitologia Veterinaria. 2010;19:75-79
  111. 111. Doyle CK, Labruna MB, Breitschwerdt EB, Tang YW, Corstvet RE, Hegarty BC, et al. Detection of medically importantEhrlichiaby quantitative multicolor TaqMan real-time polymerase chain reaction of the dsb gene. The Journal of Molecular Diagnostics. 2005;7:504-510
  112. 112. Mendonça CS, Mundim AV, Costa AS, Moro TV. Erliquiose Canina: Alterações hematológicas em cães domésticos naturalmente infectados. Bioscience Journal. 2005;21:167-174
  113. 113. Birkenheuer AJ, Lvey MG, Breitschwerdt EB. Development andevaluation of a seminested PCR for detection and differentiationofBabesia gibsoni(Asian genotype) andB. canisDNA in canineblood samples. Journal of Clinical Microbiology. 2003;41:4172-4177
  114. 114. Llera JL, López-García ML, Martín RE, De Vivar GR. Differential serological testing by simultaneous indirect immunofluorescent antibody test in canine leishmaniosis and ehrlichiosis. Veterinary Parasitology. 2002;109:185-190
  115. 115. Baskurt OK, Meiselman HJ. Blood Reology and hemodynamics. Seminars in Thrombosis and Hemostasis. 2003;29:435-450
  116. 116. Rosencraz R, Bogen SA. Clinical laboratory measurement of serum, plasma, and blood viscosity. American Journal of Clinical Pathology. 2006;125:78-86
  117. 117. Mendlowitz M. The effect of anemia e polycythemia on digital intravascular blood viscosity. The Journal of Clinical Investigation. 1948;27:565-571
  118. 118. Linderkamp O, Ruef P, Zilow EP, Hoffmann GF. Impaired deformability of erythrocytes and neutrophils in children with newly diagnosed insulin-dependent diabetes mellitus. Diabetologia. 1999;42:865-869
  119. 119. Rizvi SI, Zaid MA. Intracellular reduced glutatione content in normal and type 2 diabetic erythrocytes: Effect of insulin and (−) epicatechin. Journal of Physiology and Pharmacology. 2001;52:483-488
  120. 120. Moutzouri AG, Athanassiou GA, Dimitropoulou D, Skoutelis AT, Gogos CA. Severe sepsis and diabetes mellitus have additive effects on red blood cell deformability. The Journal of Infection. 2008;57:147-151
  121. 121. Inokuma H, Raoult D, Brouqui P. Detection ofEhrlichia platysDNA in Brown Dog Ticks (Rhipicephalus sanquineus) in Okinawa Island, Japan. The Journal of Clinical Microbiology. 2000;38:4219-4221
  122. 122. Murphy GL, Ewing SA, Whitworth LC, Fox JC, Kocan AA. A molecular and serologic survey ofEhrlichia canis,E. chaffeensis, andE. ewingiiin dogs andticks from Oklahoma. The Journal Veterinary Parasitology. 1998;79:325-339
  123. 123. Ramos R, Ramos C, Araújo F, Oliveira R, Souza I, Pimentel D, et al. Molecular survey and geneticcharacterization of tick-borne pathogens in dogs in metropolitan Recife (North-Eastern Brazil). Parasitology Research. 2010;107:1115-1120
  124. 124. Fedosov DA, Caswell B, Kamiadakis GE. Wall shear stress-based model for adhesive dynamics of red blood cells in malária. Biophysical Journal. 2011;100:2084-2093
  125. 125. Al-Abadi BH, Al-Badrani BA. Cattle blood analyses for parasitic infestation in Mosul, Iraq. Research Opinions in Animal & Veterinary Sciences. 2012;2:535-542
  126. 126. Schaefer DMW, Stokol T. The utility of reticulocyte indices indistinguishing iron deficiency anemia from anemia of inflammatory disease,portosystemic shunting, and breed-associated microcytosis in dogs. Veterinary Clinical Pathology. 2015;44:109-119
  127. 127. Lominadze D, Dean WL. Involvement of fibrinogen specific binding in erythrocyte aggregation. FEBS Letters. 2002;517:41-44
  128. 128. Murray HW, Lu CM, Mauze S, Freeman S, Moreira AL, Kaplan G, et al. Interleukin-10 (IL-10) in experimental visceral leishmaniasis and IL-10 receptor blockade as immunotherapy. Infection and Immunity. 2002;70:6284-6293

Written By

Saulo Pereira Cardoso, Giane Regina Paludo, José Nivaldo da Silva, Adenilda Honório-França and Eduardo Luzia França

Submitted: November 20th, 2019 Reviewed: January 14th, 2020 Published: February 24th, 2020