Abstract
Cadmium (Cd) is a chemical element present in the soil. At high concentrations Cd can cause physiological and morphological damages to plants and it is highly toxic to human beings. Minimizing the intake of Cd and other heavy metals from food consumption is an important health issue. Efforts have been made to identify genetic elements that are involved in Cd detoxification in plants. Heavy metal transporter 3 (HMA3) plays a role in sequestration of Cd into vacuoles in soybean (Glycine max). Inheritance studies revealed that low Cd accumulation in soybean seed is controlled by a major gene (Cda1) with the allele for low accumulation being dominant. Major QTL for seed Cd accumulation, Cda1 and cd1, have been identified independently for low Cd accumulation and both mapped to the same location as on LG-K (Chromosome 9) with simple sequence repeat (SSR) markers. A single nucleotide substitution causing a loss of function of the ATPase was found. The SSR markers linked to the Cda1 and Cd1gene(s)/or QTLs and the SNP marker in the P1B-ATPase metal ion transporter gene in soybean can be utilized in marker assisted selection (MAS) for developing food grade soybean varieties.
Keywords
- cadmium
- soybean
- SSR markers
- QTLs
- marker-assisted selection
1. Introduction
Cadmium (Cd) is a highly toxic element for human beings because of its extremely long biological half-life. Vast areas of agricultural soils are contaminated with Cd through the use of super phosphate fertilizers, sewage sludge, and inputs from the mining and smelting industries [1]. Cd2+ is readily taken up by roots and can be translocated into aerial organs, where it affects photosynthesis and consequently root and shoot growth. At high concentrations, Cd can cause severe physiological and morphological damages to plants, such as stunted root and shoot growth [2–4], chlorosis, decreased reproducibility [5], and reduced water and nutrient uptake [6]. Cd stress can affect enzyme activities [3, 7], alter membrane permeability [6], and disrupt cell transport processes [8]. Cd stress can also disturb cellular redox control [9], damage the light-harvesting complex II [10] and photosystems I and II [11], and decrease carbon assimilation and chlorophyll content [12]. Soybean has long been a staple food for Asians, especially as soymilk, tofu, and oil [13]. Many soybean cultivars can accumulate high Cd concentration in seed when grown on Cd-polluted soil [2, 14].
Cd can accumulate in the human body over time from ingestion of food containing Cd, leading to a risk of chronic toxicity with excessive intake. In humans, it can damage kidneys, causing a loss of calcium and associated osteoporosis [15]. It is desirable to limit the concentration of Cd in crops used for human consumption to reduce potential health risks. Due to growing concern about safety of foods and human health, Codex Alimentarius Commission of Food and Agriculture Organization/World Health Organization (FAO/WHO) has proposed an upper limit of 0.2 mg kg-1 for Cd concentration in soybean grain [16]. The results of a large-scale survey of domestic agricultural products revealed that the Cd concentration of 16.7% of soybean seeds exceeded the international allowable limit of 0.2 mg kg-1 proposed by the Codex Committee until 2001, which is much higher than that of other upland crops [17].
Considering the health issues due to the intake of Cd and other heavy metals through food grains, cultivars with reduced uptake of these metals are needed for human health. Breeding cultivar with reduced Cd is an attractive method for changing the element profile of crops as the benefit will persist in the seed that can reduce the requirement for other management practices [18]. The amount of Cd that enters the human diet from a crop depends on the amount of Cd accumulated in the portion of the plant that is edible rather than solely on total plant uptake. Both accumulation and distribution of Cd in the plant differ depending on the species, the cultivar, and the growing conditions. In general, the distribution of Cd within the plant is influenced by transport from roots to the shoots via the xylem, transfer from the xylem to the phloem, and transport through the phloem from sources to sinks and other environmental factors [19].
2. Genetic variation for Cd uptake
Natural variation occurs in the uptake and distribution of essential and nonessential trace elements among crop species and among cultivars within species. Plant breeding can be an important tool to either increase the concentration of desirable trace elements or reduce that of potentially harmful trace elements such as Cd. Since the Cd trait is highly heritable, incorporation of the genes influencing low Cd accumulation can help to reduce the average grain Cd to levels below the recommended international limit. The allele for low Cd concentration can be incorporated into other cultivars through breeding program without affecting other agronomic traits [20]. Cd uptake depends both on the Cd concentration in the soil and on the characteristics of the specific cultivars. Accumulation of large amounts of Cd in the root may limit the accumulation of Cd in edible aboveground portions of the plant. It was reported that Cd concentration in soybean seeds was reduced when high accumulating soybean lines (rootstock) were grafted with low accumulating lines. This indicated that the Cd accumulation in the seed was reduced by high accumulation in the root and was controlled by the rootstock cultivar [21]. Differences in seed Cd concentration among different varieties may be in part related to differences in the abilities of plants to control movement of Cd from the xylem into the phloem, and via the phloem to the soybean seeds [2, 22, 23]. There was also considerable genetic variation observed among soybean cultivars [2, 23–26], with low Cd cultivars appearing to retain more Cd in the root and translocate less to the seed than high Cd cultivars [22].
In field-grown soybean, a wide range of Cd concentrations varying from 0.08 to 1.1 mg kg-1 in seed have been reported depending on growing environment and soybean genotype [2, 27–29]. Low soil pH, vicinity to mining sites or sludge applications, has contributed to an increased Cd level in soybean seed [28–30]. In most studies, soybean Cd levels were considerably higher in roots, stems, leaves, or pods than in seeds. Moreover, a high soil Cd concentration is also toxic to soybean reducing plant growth and photosynthesis apart from other effects [31]. Due to genetic differences in soybean cultivar for seed Cd accumulation, a three- to sixfold Cd concentration increase was observed between lowest and highest accumulating genotypes. It was reported that the variation in the Cd accumulation level between genotypes was due to differences in both uptake and Cd retention of the roots [2]. Cadmium concentration in roots showed far higher than that in shoots of soybean genotypes. The root morphological traits such as the total root length (RL), root surface area (SA), and root volume (RV) were closely related to Cd tolerance at young seedlings under Cd treatments [26].
Genotypic differences in Cd uptake and distribution were observed in soybeans cultivated in pot and under low Cd concentrations in the field [2]. Cultivars with low Cd uptake accumulated much higher Cd in their roots than those of the cultivar with high Cd uptake [32]. Decreasing soil Cd concentration reduced Cd concentration in soybean seeds [33]. Interaction of Cd and nitrogen resulted in decreased Cd uptake by soybean seedling roots cultivated at a high nitrogen nutrition level [34]. Cd adversely affected soybean growth, nodulation, and N2 fixation as a function of time and increase in Cd concentration [35]. The risk of toxicity from Cd in food is influenced not only by Cd concentration but also by concentrations of other trace elements such as Zn and iron (Fe) [36]. Breeding programs are underway to increase the concentration of essential trace elements to enhance the nutritional value of staple crops. Breeding programs to increase concentrations of essential trace elements would have the combined benefit of enhancing the nutritional value of staple crops while reducing the bioavailability of Cd, particularly if low Cd was included as a selection criterion [20].
Growth stage or the age of the plants and the time of exposure to the heavy metal also affect Cd absorption and distribution between different cultivars and between plant parts. The soybean cultivar “Doko” showed an increase in Cd concentration in the roots from the VC (cotyledon stage) to V2 (second node) stage while the cultivar “Bossier” showed the opposite trend in roots. The Cd content of both cultivars (cvs) in stems, however, did not change much from VC to V2. The highest Cd concentration in roots, stems, and leaves was found approximately at the 8th, 10th, and 13th day after Cd addition, respectively. After these maxima, Cd concentration remained approximately constant in the stem and the leaves but decreased in the roots of both cvs [37]. Using tracer Cd, it was reported that Cd transported to seeds was absorbed before full seed stage and Cd absorbed at the beginning of growing stage was accumulated in leaves [38, 39]. The growing stage where Cd concentration in seeds becomes the highest was from full pod to full seed stage [40]. The relationship between Cd concentration in soil and soybean seeds was different among cultivars. There were significant differences of Cd uptake among soybean cultivars cultivated in the same upland fields. The order of Cd concentration in green beans and in matured soybean seeds was Enrei < Tsurunoko < Tsukui. The translocation of Cd to mature seeds increased rapidly after green seed formation [41].
3. Genetic control of Cd accumulation
Higher plants possess six possible ways to overcome heavy metal exposure at the cellular level: control metal influx, reduce metal bioavailability, chelate metals, promote metal efflux, compartmentalize and sequester metals, and detoxify metal-induced reactive oxygen species (ROS) [42–47]. Efforts have been made to identify gene(s) that are involved in Cd detoxification in plants. Cadmium accumulation in grain may be affected by the uptake by roots, xylem-loading-mediated translocation to shoots, and further transportation to seed via the phloem [48]. Cd translocation from roots to shoots is driven by transpiration in leaves [49]. Cd accumulation in the edible parts is thus likely to be controlled by the general translocation properties of leaves, stems, and roots via the xylem and phloem. Genetic variability for Cd uptake has been reported in soybean [2, 22, 23, 25, 50–52]. The seed Cd concentration of certain genotypes was consistently low under all field and soil conditions. Cd concentration in young tissue of the soybean correlated well to the final Cd concentration of the mature seed, which would facilitate breeding [23]. However, limited efforts have been made in the past to utilize the genetic variability for reduced Cd accumulation in crops. Now, because of market requirements and/or concerns for human health, researchers have placed greater emphasis on producing low Cd cultivars [20]. In soybean, inheritance studies using an F2:3 population showed that low Cd accumulation in soybean seed is under the control of a major gene (
Genetic control of Cd accumulation was also evaluated in a recombinant inbred line (RIL) population (F6:8) derived from the cross between soybean genotype AC Hime (high Cd accumulator in seeds) and Westag-97 (low Cd accumulator). The amount of Cd accumulation in the seeds of the parents AC Hime (0.537 ± 0.046 mg kg-1) and Westag-97 (0.170 ± 0.01 mg kg-1) differed significantly (
4. Breeding for low Cd accumulation
Genetic variation in Cd uptake and translocation had been found in crop plants. Plant-breeding approaches became feasible for the selection of genotypes with reduced Cd accumulation. Genetic variability for Cd accumulation within a species provides an opportunity to utilize plant breeding to select for genetically low Cd concentration. Cultivar selection is an important way to limit Cd uptake and accumulation in crops. Breeder should study the genetic variability for seed Cd concentration in germplasm. An understanding of the heritability of the genetic variability is essential in designing the breeding strategy. It would help in incorporation of the low Cd accumulation trait with suitable modern cultivars. However, identifying low Cd phenotypes by analysis of the grain is challenging due to the high cost of analysis [20]. Developing inexpensive methods would assist in transferring the low Cd accumulation traits with other desirable traits. In soybean grain, Cd concentration was found to be controlled by a single gene, with low Cd dominant in the crosses studied [53]. Lines with the low Cd trait had restricted root-to-shoot translocation, which limited the Cd accumulation in the grain. Genetic variability in soybean [2, 22, 23, 25, 51, 54] has been reported.
Based on the importance of soybean as a staple food crop, the development of low Cd soybean cultivars should be a priority [2, 22, 23, 52]. Inclusion of low Cd as a selection criterion adds an additional trait to an already lengthy list of characteristics that need to be incorporated into a potential new cultivar. The basic characteristics of yield, seed quality, biotic, and abiotic resistance should always be considered. Breeding for low Cd accumulation trait should be assessed based on time and resources available for other characters while determining the priorities. However, care should be taken when considering certain selection activities that may indirectly influence seed cadmium concentration. For breeding aluminum tolerance in crops growing on acid soils and selecting for improved bioavailability of zinc, it may be necessary to incorporate genes to limit the high Cd uptake that would occur at high pH soils (pH of <5.5) and uptake by plants due to similarity of these elements with Zn, respectively [20]. The Cd concentration in both low and high Cd cultivars can increase, if environmental factors, soil salinity, high Cl irrigation water, or management practices increase the phytoavailable Cd. Correction of Zn deficiencies, flooding of rice paddies combined with the application of organic matter and possibly limiting or addition of organic residues can reduce Cd uptake by crops [55]. Low Cd-accumulating cultivars combined with management practices would be more effective in decreasing Cd movement into the food chain than growing low Cd cultivars alone. Although appropriate cultivars and management practices can decrease Cd in crops, the risk of long-term accumulation of phytoavailable Cd in agricultural soils may exist, which could increase the Cd concentration in both low and high Cd cultivars. Cultivar selection can be effective in reducing the potential Cd concentration in crops. However, the availability of an inexpensive methods to detect and select for genetic differences in Cd concentration at an early developmental stage will reduce the time and cost of a breeding program [23, 51, 56, 57].
5. Marker-assisted selection for low Cd accumulation in soybean
5.1. Developing markers for marker-assisted selection of low Cd accumulation
Marker-assisted selection (MAS), the use of molecular markers linked to or located at a desired gene locus, could be an alternative to phenotypic selection. In soybean, DNA markers linked to low Cd accumulation were identified using recombinant inbred line population (

Figure 1.
Frequency distribution of seed cadmium concentration in the AC Hime × Westag-97 population. (a) Frequency distribution in the
Primer | Primer sequence (5′–3′) | Repeat DNA |
Size (bp) |
Reference |
---|---|---|---|---|
SatK 138F | AATGAATGTGATGTGATTTGTCA | (AT)29 | 313 | Jegadeesan et al. [53] |
SatK 138R | TGAGTTAGGTAAGATGGTCATTAAAA | |||
SatK 139F | AACTAAACAATGTAATGTGATTTGTCA | (AT)25 | 201 | |
SatK 139R | AAGTTAAACCTTAATTCAAGAAATGTG | |||
SatK 140F | AACTTTAATCGAAAAGTTATTGCTGA | (AT)13 | 200 | |
SatK 140R | CAGCTAGAACCTAGAAGATTACGC | |||
SatK 147F | CCATGGATATCTCCTAATCTCCTG | (AT)18 | 203 | |
SatK 147R | TCTGCAAATTAAAACTTAGAGGGTG | |||
SacK 149F | TGAACACATGCTCAACTTGTCA | (AC)18 | 236 | |
SacK 149R | CGTGTGGTTGCTATTAACTAAATGA | |||
SaatK 150F | TGATGTCTCCGTACATAAAAGATCAC | (AAT)8 | 286 | |
SaatK150R | CTTCAACCATACGCTTGTGAA | |||
SattK 152F | AAAATGTGACCAAACGGGAC | (ATT)20 | 205 | |
SattK 152R | CACGCCAGTAAATCAAAACTCA | |||
Gm09: 4770663-F | AAAGCACGGCTGCTTATATAGTT | Benitez et al. [27] | ||
Gm09: 4770663-F | CGTCGTGCATGTGTTATATATTATT | |||
Gm09:4790483-F | AAGCCCACGATTAGTACTTGGA | |||
Gm09:4790483-R | ACCAGGCATGTAGTTTCTGTAGC | |||
Gm-dCAPS-HMA1-F | TGACATCGGTATCTCACTGG | 90 | Benitez et al. [74] | |
Gm-dCAPS-HMA1-R | ATGACATTCTCAATTAGCTTTC | |||
GCTGACATCGGTATCTCA | Wang et al. [61] (Figure 5) | |||
GCATTGCCTGTTTCATTTG |
Table 1.
DNA markers linked to low cadmium accumulating locus Cda1 and Cd1 located on soybean linkage group K (Gm:09).
The closest flanking SSR markers linked to

Figure 2.
Linkage group-K which corresponds to chromosome 9 (Gm: 09) indicating the location of the newly developed SSR markers and the location of the major gene Cda1 or QTL controlling low Cd accumulation in soybean seed. Location of the major QTL associated with low Cd accumulation mapped on the LG-K with its LOD score values are shown for the AC Hime × Westag-97
5.2. Validation of markers linked to low Cd accumulation
SSR markers linked to low Cd accumulation were validated using diverse soybean genotypes differing in their seed Cd concentration. Of the 12 primers evaluated, three (SatK 147, SatK 149, and SattK 152) effectively differentiated all the high and low Cd genotypes and could be used effectively in MAS for identifying low Cd-accumulating genotype in soybean seed [53]. The reliability of these linked SSR markers was also tested using another RIL population (95 lines) involving Leo 9 × Westag-97. Leo 9 and Westag-97 had seed Cd concentrations of 0.435 ± 0.046 and 0.170 ± 0.001 mg kg-1, respectively. The concentration of Cd in the seeds of the Leo × Westag-97 population varied from 0.065 to 0.878 mg kg-1, with a mean of 0.305 ± 0.019 mg kg-1. Of the 95 lines analyzed, 42 were in the low (≤0.2 mg kg-1) and 53 were in the high (≥0.21 mg kg-1) category. Eight SSR primer pairs (SatK 122, SatK 131, SatK 140, SatK 147, SatK 149, SaatK 150, SattK 152, and SaatK 155) were found to be linked to the
Furthermore, these SSR markers were validated for their suitability to discriminate the low and high Cd-accumulating soybean genotypes grown in Europe [59]. The reliability of the SSR markers for the
6. Candidate gene(s) controlling Cd accumulation in soybean
Soybean genome sequence available from phytozome (http://www.phytozome.net/soybean.php) via SoyBase (http://soybase.org/gbrowse/cgi-bin/gbrowse/gmax1.01/) was analyzed to identify the candidate genes located between the tightly linked flanking markers (SatK 140 and SaatK 155). Three potential genes homologous to serine-threonine protein kinase, plant type (nt. 4909157–4913830) and two homologous to cation-transporting ATPase (nt. 4918664–4926453 and 5011045–5020110) were identified based on the predicted gene model for the DNA sequence from nt.4909157 to nt.5020110, flanked by SatK 140 and SaatK 155. “Moreover, 13 soybean ESTs, including TA47883_3847 [plasma membrane H+-ATPase (
In another parallel study, the evaluation of the

Figure 3.
Physical location of the SSR markers in Gm:09 tightly linked to Cda1 controlling low Cd accumulation in soybean seeds. Putative genes located in the vicinity of the tightly linked markers (http://soybase.org/) based on the predicted and known gene function with EST support for soybean genomic sequences are shown.
Among them, Glyma09g06170 encodes a putative heavy-metal transporter (GmHMA3). Its homologs, AtHMA3 and OsHMA3, which belong to P1B-ATPases and localized on the vacuolar membrane in

Figure 4.
Alignment of two allelic amino acid sequences (GmHMA3a and GmHMA3w) from AC Hime and Westag 97, respectively. Blue box indicated the single amino acid mutation. Red boxes showed all typical motifs of P1B-HMA. Transmembrane domains were underlined with black lines.

Figure 5.
HRM analysis of the SNP for the parents (A) and the 166 RILs (B).
The regulation of metal homeostasis is complex and controlled by several metal-specific and metal nonspecific genes located in different membranes and long-distance transport systems to move throughout the plant. The presence of higher levels of heavy metal ions in the soil triggers a wide range of cellular responses including the synthesis of metal-detoxifying peptides and change in gene expression. Cd- and copper-responsive genes have been shown to code for signal transduction components, such as
In soybean, candidate genes related to heavy metal transport or homeostasis were located in the vicinity of the identified QTL (Cda1). Protein kinase, putative adagio-like protein, and plasma membrane H+-ATPase were found in the QTL vicinity. Genes uniquely induced by Cd ions in
The gene was designated as
Wang et al. [78] studied gene expression pattern of the low and high Cd-accumulating soybean genotypes Westag-97 and AC Hime and reported different expression levels of five metal nonspecific genes, a receptor-like serine/threonine-protein kinase (RSTK, glyma09g06160), a plasma membrane H+-transporting ATPase (H+-ATPase, glyma09g06250), an iron-sulfur cluster scaffold protein nfu-related (ISCP, glyma09g06300), and two uncharacterized conserved protein (UCP1, glyma09g06220, and UCP2, glyma09g06310), which were previously found at the
7. Role of miRNAs in cadmium tolerance
Many abiotic conditions including heavy metal result in oxidative stress in plants [80]. Recently, increasing evidences have revealed that miRNAs played the crucial role on the regulation of plant genes at the posttranscriptional level in responding to metal stresses. Several miRNAs are involved in the regulation of genes responsible for antioxidation. MiR398 is the first miRNA identified to regulate plant responses to oxidative stress [81]. MiRNAs are small, non-protein coding single-stranded RNA, around 22–24 nucleotides in higher plants, which regulate gene expression at the posttranscriptional and translational levels [82–84]. Several studies have demonstrated that miRNAs involved in most of the essential physiological processes in plants, including signal transduction, development regulation, and stress responses [85, 86]. MiRNAs are of importance for plant to respond to heavy metal stress [87–89]. Novel miRNAs responsive to Cd were reported in Brassica and rice [90–93].
Similarly, to study the regulatory mechanism of miRNAs in response to Cd treatment in soybean, a miRNAs microarray chip was used to detect the expression of miRNAs in HX3 and ZH24 roots with Cd stress or Cd-free. Under Cd stress, 26 Cd-responsive miRNAs were found [94]. Of these 26 miRNAs identified, gma-miR1535b, which was detected as being up-regulated in HX3 and down-regulated in ZH24 and all other miRNA, showed similar expression patterns in HX3 and ZH24. This suggested that miRNA regulation may represent the fundamental mechanism of adapting to Cd exposure [94]. Further, it was reported that miR397a, miR408, and miRNA398c showed almost the similar up-regulated alteration in response to Cd exposure, which might imply that SPL7 (SQUAMOSA promoter-binding protein-like 7) is involved in the regulation of Cu deficiency and Cd response in soybean [94]. To evaluate the target transcripts of the miRNAs, a high-throughput degradome sequencing was adopted using a small RNA library. Fifty-five targets cleaved by 14 Cd-responsive miRNAs were identified. In addition, a number of Cd-responsive miRNAs and target mRNAs in soybean have been validated by quantitative RT-PCR [94]. It is well established that lignin provides structural support and contributes to plant defense mechanism against both biotic and abiotic stresses [95]. Several studies reported on an increased lignin synthesis upon metal treatment [96, 97], and reported that lignification is one defense mechanism under Cd exposure in soybean root [98, 99]. One novel soybean Cd-responsive miRNA, miR1535b, was illustrated to cleave Glyma07g38620.1 and Glyma07g38620.1 encoding isopentyl transferase (IPT). It was shown that IPT catalyses the rate-limiting first step in de novo cytokinin (CK) biosynthesis and promotes the formation of isopentenyladenosine-59-monophosphate (iPa) [100, 101]. Overexpression of
8. Conclusion
Genetic variation for Cd accumulation in soybean genotypes provides an opportunity to develop varieties with low Cd content. Breeding programs are underway to produce low Cd cultivars of soybean. The low Cd accumulation in soybean seed was reported to be genetically controlled by a major gene
Transgenic experiments may be necessary to determine the function of
References
- 1.
McGrath SP, Zhao FJ, Lombi E. Plant and rhizosphere processes involved in phytoremediation of metal-contaminated soils. Plant and Soil. 2001; 232 :207–214. - 2.
Arao T, Ae N, Sugiyama M, Takahash M. Genotypic differences in cadmium uptake and distribution in soybeans. Plant and Soil. 2003; 251 :247–253. - 3.
Tamás L, Bočová B, Huttová J, Mistrík I, Ollé M. Cadmium-induced inhibition of apoplastic ascorbate oxidase in barley roots. Plant Growth Regulation. 2006; 48 :41–49. - 4.
Yeh C-M, Hsiao L-J, Huang H-J. Cadmium activates a mitogen-activated protein kinase gene and MBP kinases in rice. Plant and Cell Physiology. 2004; 45 :1306–1312. - 5.
Larsson EH, Bornman JF, Asp H. Influence of UVB radiation and Cd2+ on chlorophyll fluorescence, growth and nutrient content in Brassica napus . Journal of Experimental Botany. 1998;323 :1031–1039. - 6.
Sanit`a di Toppi L, Gabbrielli R. Response to cadmium in higher plants. Environmental and Experimental Botany.1999; 41 :105–130. - 7.
Smeets K, Ruytinx J, Semane B. et al. Cadmium-induced transcriptional and enzymatic alterations related to oxidative stress. Environmental and Experimental Botany. 2008; 63 :1–8. - 8.
Fojtová M, Fulnečková J, Fajkus J, Kovařík A. Recovery of tobacco cells from cadmium stress is accompanied by DNA repair and increased telomerase activity. Journal of Experimental Botany. 2002; 53 :2151–2158. - 9.
Clemens S, Schroeder JI, Degenkolb T. Caenorhabditis elegans expresses a functional phytochelatin synthase. European Journal of Biochemistry. 2001;268 :3640–3643. - 10.
Krupa Z. Cadmium-induced changes in the composition and structure of the light-harvesting complex II in radish cotyledons. Physiologia Plantarum. 1998; 73 :518–524. - 11.
Siedlecka A, Baszynsky T. Inhibition of electron flow around phytosystem I in chloroplasts of cadmium-treated maize plants is due to cadmium-induced iron deficiency. Physiologia Plantarum. 1993; 87 :199–202. - 12.
DalCorso G, Farinati S, Maistri S, Furini A. How plants cope with cadmium: staking all on metabolism and gene expression. Journal of Integrative Plant Biology. 2008; 50 :1268–1280. - 13.
Tay SL, Perera CO. Physicochemical properties of 7S and 11S protein mixtures coagulated by glucono-δ-lactone. Journal of Food Science.2004; 69 :139–143. - 14.
Sugiyama M, Ae N, Hajika M. Developing of a simple method for screening soybean seedling cadmium accumulation to select soybean genotypes with low seed cadmium. Plant and Soil. 2011; 341 :413–422. - 15.
Kazantzis G. Cadmium, osteoporosis and calcium metabolism. Biometals. 2004; 17 :493–498. - 16.
Codex Alimentarius Commission. Report of the 33rd Session of the Codex Committee on Food Additives and Contaminants, Hague, The Netherlands; March 12–16, 2001; p. 285. - 17.
Ministry of Agriculture, Forestry, and Fisheries of Japan. Investigation of Cd concentration of staple crops: the outline of the results, Tokyo; 2002. - 18.
Cupit M, Larsson O, de Meeus C, Eduljee GH, Hutton M. Assessment and management of risks arising from exposure to cadmium in fertilisers: II. Science of the Total Environment. 2002; 291 :189–206. - 19.
Riesen O, Feller U. Redistribution of nickel, cobalt, manganese, zinc, and cadmium via the phloem in young and maturing wheat. Journal of Plant Nutrition. 2005; 28 :421–30. - 20.
Grant CA, Clarke JM, Duguid S, Chaney RL. Selection and breeding of plant cultivars to minimize cadmium accumulation. Science of the Total Environment. 2008; 390 :301–310. - 21.
Sugiyama M, Ae N, Arao T. Role of roots in differences in seed cadmium concentration among soybean cultivars-proof by grafting experiment. Plant and Soil. 2007b; 295 :1–11. - 22.
Ishikawa S, Ae N, Sugiyama M, Murakami M, Arao T. Genotypic variation in shoot cadmium concentration in rice and soybean in soils with different levels of cadmium contamination. Soil Science & Plant Nutrition 2005; 51 :101–108. - 23.
Arao T, Ishikawa S. Genotypic differences in cadmium concentration and distribution of soybeans and rice. JARQ Japan Agricultural Research Quarterly. 2006; 40 :21–30. - 24.
Boggess SF, Willavize S, Koeppe DE. Differential response of soybean varieties to soil cadmium. Agronomy Journal. 1978; 70 :756–60. - 25.
Bell MJ, McLaughlin MJ, Wright GC, Cruickshank A. Inter- and intra-specific variation in accumulation of cadmium by peanut, soybean and navy bean. Australian Journal of Agricultural and Resource Economics.1997; 48 :1151–1160. - 26.
Wang P, Deng X, Huang Y, Fang X, Zhang J, Wan H, Yang C. Root morphological responses of five soybean [ Glycine max (L.) Merr] cultivars to cadmium stress at young seedlings. Environmental Science and Pollution Research International. 2016 23(2):1860-1872 - 27.
Benitez ER, Hajika M, Yamada T, Takahashi K, Oki N, Yamada N, Nakamura T, Kanamaru K. A major QTL controlling seed cadmium accumulation in soybean. Crop Science. 2010; 50 :1728–1734. - 28.
Salazar MJ, Rodriguez JH, Nieto GL, Pignata ML. Effects of heavy metal concentrations (Cd, Zn and Pb) in agricultural soils near different emission sources on quality, accumulation and food safety in soybean [ Glycine max (L.) Merrill]. Journal of Hazardous Materials. 2012;234 :244–253. - 29.
Zhuang P, Li ZA, Zou B, Xia HP, Wang G. Heavy metal contamination in soil and soybean near the Dabaoshan mine, South China. Pedosphere. 2013; 23 :298–304. - 30.
Moon KH, Kim JY, Chang MI, Kim US, Kim SJ, Baek SH. Heavy metal and amino acid contents of soybean by application of sewage and industrial sludge. Journal of the Korean Society of Food Science and Nutrition. 2013; 42 :268–277. - 31.
Li X, Zhang L, Li Y, Ma L, Bu N, Ma C. Changes in photosynthesis, antioxidant enzymes and lipid peroxidation in soybean seedlings exposed to UV-B radiation and/ or Cd. Plant Soil. 2012; 352 :377–387. - 32.
Sugiyama M, Ae N, Arao T. Accumulation of large amounts of Cd in the root may limit the accumulation of Cd in edible above-ground portions of the plant. Plant and Soil. 2007a; 295 :1–11. - 33.
Maejima Y, Makino T, Takano H, Kamiya T. Remediation of cadmium-contaminated paddy soils by washing with chemicals: Effect of soil washing on cadmium uptake by soybean. Chemosphere. 2007; 67 :748–754. - 34.
Konotop Y, Mezsaros P, Matušíková I, Batsmanova L, Taran N. Application of nitrogen nutrition for improving tolerance of soybean seedlings to cadmium. Environmental and Experimental Biology. 2012; 10 :139–144. - 35.
Rizwan AS, Bashir K, Hayat R, Akhtar MS. Effect of cadmium on soybean ( Glycine max L) growth and nitrogen fixation. African Journal of Biotechnology. 2012;11 :1886–1891. - 36.
Chaney RL, Ryan JA, Li Y-M, Brown SL. Soil cadmium as a threat to human health. In: McLaughlin ML, Singh BR, editors. Cadmium in soils and plants. Dordrecht: Kluwer Academic Publishers; 1999. p. 219–256. - 37.
Oliveira JA, Oliva MA, Cambraia J, Venegas VHA. Absorption, accumulation and distribution of cadmium by two soybean cvs. Revista Brasileira de Fisiologia Vegetal. 1994; 6 :91–95. - 38.
Kawasaki A, Oda H. Application of 113Cd as a tracer in evaluation of cadmium uptake by soybeans under field conditions. Japanese Journal of Soil Science and Plant Nutrition. 2005; 76 :261–267. - 39.
Kawasaki A, Oda H, Yamada M. Application of 113Cd as a tracer in evaluation of cadmium uptake by soybeans under pot conditions. Japanese Journal of Soil Science and Plant Nutrition. 2004; 75 :667–672. - 40.
Oda H, Senda S, Kawasaki A. Uptake and transport of Cd supplied at different growth stages in hydroponically cultured soybean plants. Biomedical Research on Trace Elements. 2004; 15 :289–291. - 41.
Kobori G, Okazaki M, Motobayashi T, Matsukawa K. Differences in cadmium uptake and accumulation in three soybean cultivars. Pedologist. 2011; 54 :214–221. - 42.
Pinto AP, Mota AM, de Varennes A, Pinto FC. Influence of organic matter on the uptake of cadmium, zinc, copper and iron by sorghum plants. Science of Total Environment. 2004; 326 :239–247. - 43.
Zhang L, Wong MH. Environmental mercury contamination in China: Sources and impacts. Environmental International. 2007; 33 :108–121. - 44.
Yadav SK. Heavy metals toxicity in plants: An overview on the role of glutathione and phytochelatins in heavy metal stress tolerance of plants. South African Journal of Botany. 2010; 76 :167–179. - 45.
Lin YF, Aarts MG. The molecular mechanism of zinc and cadmium stress response in plants. Cellular and Molecular Life Science. 2012; 69 :3187–3206. - 46.
Hall JL. Cellular mechanisms for heavy metal detoxification and tolerance. Journal of Experimental Botany. 2002; 53 :1–11. - 47.
Thomine S, Wang R, Ward JM, Crawford NM, Schroeder JI. Cadmium and iron transport by members of a plant metal transporter family in Arabidopsis with homology to Nramp genes. Proceedings of the National Academy of Sciences USA. 2000;97 :4991–4996. - 48.
Clemens S, Palmgren MG, Kramer U. A long way ahead: Understanding and engineering plant metal accumulation. Trends in Plant Science. 2002; 7 :309–315. - 49.
Salt DE, Prince RC, Pickering IJ, Raskin I. Mechanism of cadmium mobility and accumulation in Indian mustard. Plant Physiology. 1995; 109 :1427–1433. - 50.
Reddy MR, Dunn SJ. Heavy metal absorption by soybean on sewage sludge treated soil. Journal of Agricultural and Food Chemistry. 1986; 34 :750–753. - 51.
Arao T, Ae N. Screening of genotypes with low cadmium content in soybean seed and rice grains. Plant nutrition: food security and sustainability of agro-ecosystems through basic and applied research. Fourteenth International Plant Nutrition Colloquium. Germany: Hannover; 2001. p. 292–293. - 52.
Morrison M. Cadmium concentration in Canadian soybean. The Pulse Beat. Manitoba Pulse Growers Association. 2005; 47: p. 33–34. - 53.
Jegadeesan S, Yu KF, Poysa V, Gawalko E, Morrison MJ, Shi C, Cober E. Mapping and validation of simple sequence repeat markers linked to a major gene controlling seed cadmium accumulation in soybean [ Glycinemax (L.) Merr]. Theoretical and Applied Genetics. 2010;121 :283–294. - 54.
Guo Y, Marschner H. Genotypic differences in uptake and translocation of cadmium in bean and maize inbred lines. Z Pflanzenern Bodenk. 1996; 159 :55–60. - 55.
Grant CA, Bailey LD, McLaughlin MJ, Singh BR. Management factors which influence cadmium concentration in crops. In: McLaughlin MJ, Singh BR, editors. Cadmium in soils and plants. Dordrecht: Kluwer Academic Publishers; 1999. p. 151–198. - 56.
Archambault DJ, Marentes E, Buckley W, Clarke J, Taylor GJ. A rapid seedling-based bioassay for identifying low cadmium accumulating individuals of durum wheat ( Triticum turgidum L.). Euphytica. 2001;117 :175–182. - 57.
Stolt P, Asp H, Hultin S. Genetic variation in wheat cadmium accumulation on soils with different cadmium concentrations. Journal of Agronomy and Crop Science. 2006; 192 :201–208. - 58.
Cregan PB, Jarvick T, Bush AL, Shoemaker RC, Lark KG, Kahler AL, Kaya N, Van Toai TT, Lohnes DG, Chung J, Specht JE. An integrated genetic map of the soybean genome. Crop Science. 1999; 39 :1464–1490. - 59.
Peter S, Nirit B, Ĺubomír R, Patrik M, Terézia G, Nadine S, Jana L, Jana M, Ildikó M. Cd accumulation potential as a marker for heavy metal tolerance in soybean, Israel Journal of Plant Sciences. 2015. DOI: 10.1080/07929978.2015.1042307. - 60.
Vollmann J, Losˇa´k T, Pachner M, Watanabe D, Musilova´ L, Hlusˇek J. Soybean cadmium concentration: validation of a QTL affecting seed cadmium accumulation for improved food safety. Euphytica. 2015; 203 :177–184. - 61.
Wang Y, Yu KF, Poysa V, Shi C, Zhou YH. A single point mutation in GmHMA3 affects cadmium (Cd)translocation and accumulation in soybean seeds. Molecular Plant. 2012a; 5 :1154–1156. - 62.
Schmutz J, et al. Genome sequence of the palaeopolyploid soybean. Nature. 2010; 463 :178–183. - 63.
Morel M, Crouzet J, Gravot A, Auroy P, Leonhardt N, Vavasseur A, Richaud P. AtHMA3, a P1B-ATPase allowing Cd/Zn/Co/Pb vacuolar storage in Arabidopsis . Plant Physiology. 2009;149 :894–904. - 64.
Ueno D, Yamaji N, Kono I, Huang CF, Ando T, Yano M, Ma JF. Gene limiting cadmium accumulation in rice. Proceedings of the National Academy of Sciences USA. 2010; 107 :16500–16505. - 65.
Xiang C, Oliver DJ. Glutathione metabolic genes coordinately respond to heavy metals and jasmonic acid in Arabidopsis . Plant Cell. 1998;10 :1539–1550. - 66.
Suzuki N, Koizumi N, Sano H. Screening of cadmium responsive genes in Arabidopsis thaliana reveals protein denaturation and oxidative stresses to be critical components of cadmium toxicity. Plant, Cell & Environment. 2001;24 :1177–1188. - 67.
Louie M, Kondor N, Dewitt JG. Gene expression in cadmium tolerant Datura inoxia : Detection and characterization of cDNAs induced in response to Cd2+. Plant Molecular Biology. 2003;52 :81–89. - 68.
Claudia J, Hirofumi N, Heribert H. Heavy metal stress. Activation of distinct mitogen-activated protein kinase pathways by copper and cadmium. Plant Physiology. 2004; 136 :3276–3283. - 69.
Cheng-Ri Z, Takashi I, Yoshiharu S, Yuriko K, Yuji S, Takashi H, Shigeru S, Nozomu S, Daisuke S, Hiroyuki K. Comparative transcriptomic characterization of aluminium, sodium chloride, cadmium and copper rhizotoxicities in Arabidopsis thaliana . BMC Plant Biology. 2009;9 :32. Doi:10.1186/1471-2229-9-32. - 70.
Cataldo DA, Garland TR, Wildung RE. Cadmium uptake kinetics in intact soybean plants. Plant Physiology. 1983; 73 :844–848. - 71.
Astolfi S, Zuchi S, Chiani A, Passera C. In vivo and in vitro effects of cadmium on H+ATPase activity of plasma membrane vesicle from oat ( Avena sativa L.) roots. Journal of Plant Physiology. 2003;160 :387–393. - 72.
Serrano R. Structure and function of plasma membrane ATPase. Plant Molecular Biology. 1989; 40 :61–94. - 73.
Williams LE, Pittman JK, Hall JL. Emerging mechanisms for heavy metal transport in plants. Biochimica et Biophysica Acta. 2000; 1465 :104–126. - 74.
Benitez ER, Hajika M, Takahshi R. Single-base substitution in P1B-ATPase. Gene is associated with a major QTL for seed cadmium concentration in soybean. Journal of Heredity. 2012; 103 :278–286. - 75.
Matsumura H, Kitajima H, Akada S, Abe J, Minaka N, Takahashi R. Molecular cloning and linkage mapping of cryptochrome multigene family in soybean. Plant Genome. 2009; 2 :271–281. - 76.
Mills RF, Krijger GC, Baccarini PJ, Hall JL, Williams LE. Functional expression of AtHMA4, a P1B-type ATPase of the Zn/Co/Cd/Pb subclass. The Plant Journal. 2003; 35 :164–176. - 77.
Gravot A, Lieutaud A, Verret F, Auroy P, Vavasseur A, Richaud P. AtHMA3, a plant P1B-ATPase, functions as a Cd/Pb transporter in yeast. FEBS Letters. 2004; 561 :22–28. - 78.
Wang Y, Xiao X, Zhang T, Kang H, Zeng J, Fan X, Sha L, Zhang H, Yu K, Zhou Y. Cadmium treatment alters the expression of five genes at the Cda1 locus in two Soybean cultivars [Glycine max (L.) Merr]. The Scientific World Journal. 2014. Article ID 979750, doi:10.1155/2014/979750. - 79.
Wang Y, Yu K, Poysa V, Shi C, Zhou Y. Selection of reference genes for normalization of qRT-PCR analysis of differentially expressed genes in soybean exposed to cadmium. Molecular Biology Reports. 2012b; 39 :1585–1594. - 80.
Apel K, Hirt H. Reactive oxygen species: metabolism, oxidative stress, and signal transduction. Annual Review of Plant Biology. 2004; 55 :373–399. - 81.
Mendoza-Soto AB, Sanchez F, Hernandez G. MicroRNAs as regulators in plant metal toxicity response. Frontiers in Plant Science. 2012; 3 :105. - 82.
Bartel DP. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell. 2004; 116 :281–297. - 83.
Brodersen P, Sakvarelidze-Achard L, Bruun-Rasmussen M, Dunoyer P, Yamamoto YY, et al. Widespread translational inhibition by plant miRNAs and siRNAs. Science. 2008; 320 :1185–1190. - 84.
Bartel DP. MicroRNAs: target recognition and regulatory functions. Cell. 2009; 136 :215–233. - 85.
Mallory AC, Vaucheret H. Functions of microRNAs and related small RNAs in plants. Nature Genetics. 2006; 38 Suppl:S31–36. - 86.
Ruiz-Ferrer V, Voinnet O. Roles of plant small RNAs in biotic stress responses. Annual Review of Plant Biology. 2009; 60 :485–510. - 87.
Sunkar R, Zhu JK. Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis . Plant Cell. 2004;16 :2001–2019. - 88.
Sunkar R, Kapoor A, Zhu JK. Posttranscriptional induction of two Cu/Zn superoxide dismutase genes in Arabidopsis is mediated by downregulation ofmiR398 and important for oxidative stress tolerance. Plant Cell. 2006;18 :2051–2065. - 89.
Ding YF, Zhu C. The role of microRNAs in copper and cadmium homeostasis. Biochemical and Biophysical Research Communications. 2009; 386 :6–10. - 90.
Xie FL, Huang SQ, Guo K, Xiang AL, Zhu YY, et al. Computational identification of novel microRNAs and targets in Brassica napus . FEBS Letters. 2007;581 :1464–1474. - 91.
Huang SQ, Xiang AL, Che LL, Chen S, Li H, et al. A set of miRNAs from Brassica napus in response to sulphate deficiency and cadmium stress. Plant Biotechnology Journal. 2010;8:887–899. - 92.
Huang SQ, Peng J, Qiu CX, Yang ZM (2009). Heavy metal-regulated new microRNAs from rice. Journal of Inorganic Biochemistry. 2009; 103 :282–287. - 93.
Zhou ZS, Song JB, Yang ZM. Genome-wide identification of Brassica napus microRNAs and their targets in response to cadmium. Journal of Experimental Botany. 2012;63 :4597–4613. - 94.
Fang X, Zhao Y, Ma Q, Huang Y, Wang P, Zhang J, Nian H, Yang C. Identification and comparative analysis of a cadmium tolerance-associated miRNAs and their targets in two soybean genotypes. PLoS ONE. 2013; 8 :e81471. doi:10.1371/journal.pone.0081471. - 95.
Franke R, Hemm MR, Denault JW, Ruegger MO, Humphreys JM, et al. Changes in secondary metabolism and deposition of an unusual lignin in the ref8mutant of Arabidopsis . The Plant Journal. 2002;30 :47–59. - 96.
Marmiroli M, Antonioli G, Maestri E, Marmiroli N. Evidence of the involvement of plant ligno-cellulosic structure in the sequestration of Pb: An X-ray spectroscopy-based analysis. Environmental Pollution. 2005; 134 :217–227. - 97.
Elobeid M, Gobel C, Feussner I, Polle A. Cadmium interferes with auxin physiology and lignification in poplar. Journal of Experimental Botany. 2012; 63 :1413–1421. - 98.
Finger-Teixeira A, Ferrarese Mde L, Soares AR, da Silva D, Ferrarese-Filho O. Cadmium-induced lignification restricts soybean root growth. Ecotoxicology and Environmental Safety. 2010; 73 :1959–1964. - 99.
Yang Y-J, Cheng L-M, Liu Z-H. Rapid effect of cadmium on lignin biosynthesis in soybean roots. Plant Science. 2007; 172 :632–639. - 100.
Akiyoshi DE, Klee H, Amasino RM, Nester EW, Gordon MP. T-DNA of Agrobacterium tumefaciens encodes an enzyme of cytokinin biosynthesis. Proceedings of the National Academy of Sciences USA. 1984;81 :5994–5998. - 101.
Barry GF, Rogers SG, Fraley RT, Brand L. Identification of a cloned cytokinin biosynthetic gene. Proceedings of the National Academy of Sciences USA. 1984; 81 :4776–4780. - 102.
Merewitz EB, Gianfagna T, Huang B. Photosynthesis, water use, and root viability under water stress as affected by expression of SAG12-ipt controlling cytokinin synthesis in Agrostis stolonifera . Journal of Experimental Botany. 2011;62 :383–395. - 103.
Kuderova A, Urbankova I, Valkova M, Malbeck J, Brzobohaty B, et al. Effects of conditional IPT-dependent cytokinin overproduction on root architecture of Arabidopsis seedlings. Plant and Cell Physiology. 2008;49 :570–582.