Open access peer-reviewed chapter

Application of Nucleic Acid Aptamers to Viral Detection and Inhibition

Written By

Ana Gabriela Leija-Montoya, María Luisa Benítez-Hess and Luis Marat Alvarez-Salas

Submitted: May 7th, 2015 Reviewed: October 19th, 2015 Published: March 16th, 2016

DOI: 10.5772/61773

Chapter metrics overview

2,030 Chapter Downloads

View Full Metrics

Abstract

Nucleic acid aptamers are small oligonucleotides that specifically bind to other molecules through noncovalent interactions that rely on complex tridimensional structural arrangements. Aptamers are generated through the iterative in vitro selection method called SELEX, resulting in specific binding against a wide variety of molecular targets including viruses. Because aptamers are obtained in vitro and can be synthetically produced, they have been envisioned as future diagnostic and therapeutic tools for human diseases including virus-borne pathologies. Aptamers have been isolated against a number of viruses including pandemic influenza virus, human papillomavirus and hepatitis C virus. Although aptamers have proven themselves as extremely sensitive detection tools triggering the development of affordable and highly diagnostic methods, their use as therapeutic moieties has been hampered by biostability, delivery and pharmacodynamical issues. Nevertheless, a new generation of chemically modified aptamers shows promise for the coming of age of protein-targeted noncatalytic oligonucleotides for the therapy of viral disease. The present review focuses on the most successful antiviral aptamers reported and includes a description of some of the novel methods developed for their use as diagnostic and therapeutic tools

Keywords

  • Aptamer
  • Oligonucleotides
  • Nucleic acids
  • RNA
  • DNA

1. Introduction

Nucleic acid aptamers are small single-stranded oligonucleotides capable of adopting complex tertiary structures that allow noncovalent interactions with other molecules. Because aptamers closely interact with their targets, their structural features are essential for highly specific binding. The term aptamerwas coined in 1990 from the Latin “aptus” meaning “fitting” and the Greek “meros” meaning “particle” [1]. Aptamers are generated through the iterative in vitroselection method called SELEX (systematic evolution of ligands by exponential enrichment) and are raised against a wide variety of molecular targets ranging from ions and macromolecules to whole organisms, including viruses, bacteria, yeast and mammalian cells [2]. Although many modifications to the SELEX method have been established to include new technologies and improve selection [3], the basic steps of SELEX remain immutable.

The SELEX method involves three well-defined steps [4]: the start point is the production of a synthetic oligonucleotide combinatorial library or oligonucleotide pool containing a central randomized region (15–70 nt) flanked by anchor sequences to allow polymerase chain reaction (PCR) amplification. The aleatory nature of the central region results in the production of an enormous pool of diverse oligonucleotides with diverse structures, thus providing the conformational variability necessary to produce moieties with binding capabilities for a desired target. The oligonucleotide pool can be directly used for SELEX to generate single-stranded DNA (ssDNA) aptamers, or as in vitrotranscription template to produce an RNA pool to isolate RNA aptamers. Next, a selection procedure is performed based on the interaction properties of the library with the intended target. Only a very small fraction of the oligonucleotide pool tends to interact with the target, satisfying the selection criteria. Oligonucleotides that bind the target (aptamers) are recovered while the nonbound are removed through different strategies according to the nature of the aptamer–ligand complex (size, affinity, electric charge, hydrophobicity, etc.). In the final step, the recovered aptamers are amplified by PCR in order to regenerate a library with less variability but more affinity to the target that will be used in the next selection cycle. RNA pools are amplified by reverse transcription-coupled PCR (RT-PCR) and subsequent in vitrotranscription before starting the next cycle.

The iterative selection cycles produce aptamers with high binding affinity to the target. Usually, a few cycles are required to isolate aptamers (4–20 cycles), but the precise number of cycles necessary for the isolation of highly specific aptamers depends on the selection criteria, the nature of the target and the type of library used. After the last selection cycle, aptamers are cloned and sequenced to obtain information on the individual oligonucleotides, which can be further characterized based on its ability to bind the target. It is common to observe conserved sequences or structures among the selected aptamers; these are indicative of efficient selection and may represent domains required for interaction.

Aptamer specificity is based on three-dimensional arrangements of a small number of contact points between the aptamer and its target, so the aptamer can achieve high selectivity to discriminate between two highly related molecules (i.e. enantiomers), or minimal structural differences such as the presence or absence of methyl or hydroxyl groups. The molecular recognition specificity and affinity level achieved by aptamers is comparable or even better than those of antibodies. These features place aptamers as an emerging class of molecules on their own with a huge range of diagnostic and therapeutic applications plus several advantages over antibodies including:

  • Isolation by an in vitroprocess not dependent on animal cells or in vivoconditions. Therefore, the properties of aptamers can change on demand, and isolation can be manipulated to obtain aptamers with desirable properties for diagnosis. In addition, it allows aptamer isolation against toxins or poorly immunogenic molecules.

  • Production by chemical synthesis with accuracy and reproducibility, thus insuring mass production with high quality control standards.

  • Aptamers can be reversibly denatured allowing conditional binding through simple temperature control.

Since the development of SELEX, aptamers have been isolated against a wide diversity of targets such as amino acids [5, 6], antibiotics [7], nucleotides [8], enzymes [9], growth factors [10], mammalian cells [11], bacteria [12] and parasites [13]. Nowadays, some aptamers have even reached therapeutic applications in the clinic [14]. Furthermore, the first RNA aptamer for therapeutic purposes in humans (pegaptanib sodium or Macugen®) was approved by United States Food and Drug Administration (FDA) in 2004, as treatment for age-related macular degeneration (AMD) [15].

Advertisement

2. Aptamers against viruses

Many aptamers have been isolated against whole viruses or viral proteins to detect or inhibit infection. Viruses such as human papillomavirus (HPV), human immunodeficiency virus-1 (HIV-1), hepatitis C virus (HCV), hepatitis B virus (HBV), severe acute respiratory syndrome coronavirus (SCoV), influenza virus, herpes simplex virus (HSV), Ebola virus, Rift Valley fever virus, dengue virus, human T cell leukemia virus type-1 (HTLV-1), Epstein–Barr virus and human cytomegalovirus (HCMV) have all been targeted with aptamers [16].

Aptamer isolation to inhibit viral infection can be performed by using purified molecules from the viral surface through canonical SELEX approaches, or by modified SELEX methods with the use of attenuated whole viral particles. The advantage of this last variant is the isolation of aptamers through binding to the native viral conformation. Moreover, a deep knowledge of the viral infection mechanisms or potential surface target molecules is not required to obtain antiviral or neutralizing aptamers that tightly bind infectious particles. On the other hand, this method does not disclose the sites that directly interact with the aptamers, so further studies are required to determine specific interactions useful for potential aptamer improvement.

Many efforts have been focused on the isolation of aptamers to detect and treat viral diseases relevant to public health such as AIDS, hepatitis, influenza and some cancers. Here, we summarize the successful application of aptamers selected against HIV-1, HPV, HCV, and influenza.

2.1. Aptamers against Rous Sarcoma Virus (RSV)

The first approach using whole viruses to isolate RNA aptamers without previous knowledge of the virion structural features was performed against Rous sarcoma virus (RSV), an avian retrovirus. Nineteen RNA aptamers were isolated from a canonical SELEX procedure and five of them were able to neutralize the virus infection [17]. These results immediately revealed the potential of aptamers isolated against viral surface epitopes leading to the development of nucleic acid aptamers as novel diagnostic or therapeutic tools, especially on human viral diseases requiring fast diagnostics (i.e. pandemic influenza or Ebola) or asymptomatic chronic viral-induced conditions such as acquired immunodeficiency syndrome (AIDS), hepatitis C or cervical cancer [18].

2.2. Aptamers against Human Immunodeficiency Virus type I (HIV-1)

HIV-1 is the etiologic agent of AIDS [19, 20]. Most anti-HIV-1 aptamers are directed to HIV-1 reverse transcriptase (RT), RNaseH, integrase, Tat, Gag, nucleocapsid, gp120 and the TAR-element RNA (Table 1). The HIV-1 RT is the enzyme responsible for transforming the viral genomic RNA into dsDNA and contains a domain with RNaseH activity. HIV-1 RT is also the main target of several therapies against AIDS. So far, about a dozen of ssDNA and RNA aptamers have been reported to inhibit the RT activity in cell cultures showing KD in the range of 25 pM to 30 nM [18, 21].

AptamerNatureSequenceRandomized regionTargetActionStructureRef
P5RNAGGGAGCUCAGAAUAAACGCUCAACGGCACAGGGGUUGUAUCCUCCGGGACGAAUUCGACAUGAGGCCCGGAUCCGGC30 ntIntegraseInhibit interaction between integrase and viral DNAAllen P, et al.1995
A54RNAGGGAGCUCAGAAUAAACGCUCAAGUCAAUCAUCGAUGUCCUGUGCCCUAGGGCUUCGACAUGAGGCCCGGAUCCGGC30 ntIntegraseInhibit interaction between integrase and viral DNAAllen P, et al.1995
93delDNAGGGGTGGGAGGAGGGT80 ntIntegraseBlock integrase actvity in vitroPhan AT, et al.2004, De Soultrait VR. Et. al. 2002
112delDNACGGGTGGGTGGGTGGT80 ntIntegraseInhibton of HV-1 integrase, De Soultrait VR. Et. al. 2002
RNA tatRNAACGAAGCUUGAUCCCGUUUGCCGGUCGAUCGCUUCGA120 ntTARInhibition of Tat dependent trasns-activation transcription. BiosensorYamamoto R, et al.2000
B40RNATAATACGACTCACTATAGGGAGACAAGACTAGACGCTCAaTGTGGGCCACGCCCGATTTTACGCTTTTACCCGCACGCGATTGGTTTGTTTTCGACATGGACTCACAACAGTTCCCTTTAGTGAGGGTTAATT40 ntGp120Neutralizaton of HIV-1 infectivityKhati M, et al. 2003.
Dey AK, et al. 2005.
B40t77RNATAATACGACTCACTATAGGGAGACAAGACTAGACGCTCAATGTGGCCACGCCCGATTTTACGCTTTTACCGCACGCGATTGGTTTGTTTCCC40 ntGp120Neutralizaton of HIV-1 infectivityDey AK, et al. 2005. Cohen C, et al, 2008.

Table 1.

Aptamers isolated against HIV proteins.

The HIV-1 integrase incorporates the viral DNA in the host genome [22]. RNA aptamers were isolated targeting HIV-1 integrase and classified into three groups according to their KD (10 nM, 80 nM and 800 nM) [23]. Furthermore, DNA aptamers were also isolated targeting HIV-1 integrase by two different research groups, all with G-quadruplex structures and showing in vitroinhibitory activity [24, 25]. The characteristic structure of aptamers binding the HIV-1 integrase interacts within a channel of the tetrameric protein blocking catalytic amino acid residues essential for integrase function in vitro[26].

HIV-1 Tat protein regulates viral gene expression by interaction with the trans-activation responsive (TAR) elements within the long-terminal repeats (LTRs) [27]. Unlike the natural target of Tat (TAR-1 RNA), the isolated RNA aptamer (RNATat) was highly specific to Tat and did not interact with other cellular factors. Moreover, RNATat binds Tat protein over 100-fold higher than TAR-1 RNA and inhibited Tat function in vitroand in vivo[28, 29]. Based on these results, RNATat was used in a preliminary study to develop a molecular beacon by flanking the 5′ and 3′ ends of the native aptamer stem-loop structure with a fluorophore and a quencher. In the absence of Tat, the quencher and fluorophore remain close to each other by the formation of the stem producing no signal. When the loop interacts with Tat, the complexed structure becomes more stable resulting in strand separation, thus holding apart the fluorophore and quencher allowing fluorescence [30].

Two other biosensors have been developed using RNA aptamers specific to HIV-1 Tat. These biosensors were created by immobilizing a biotinylated aptamer on a streptavidin layer over quartz crystals included in surface plasmon resonance (SPR) chips [31]. Another approach used a diamond field-effect transistor (FET) technique to detect Tat protein by RNA aptamers. Aptamer-FET is based on a gate potential shift generated by the presence of HIV-1 Tat bound to the RNA aptamer on a solid diamond surface. Efficient detection showed a potential use for aptamer-FET in clinical applications [32].

HIV-1 Rev is essential to regulate the splicing and shuttle the viral mRNA through their nuclear and export localization signals. Also, Rev interacts with viral mRNA through a cis-acting Rev-binding element (RBE) within a Rev-responsive element (RRE). RNA aptamers against Rev have been isolated using random libraries or by randomizing the RRE minimal binding sequence [3335]. Randomized RRE produced aptamers with up to 16-fold tighter binding than the minimal wild-type RBE (wtRBE). The RBE was then substituted by these RNA aptamers and tested in vivousing a reporter system [35]. The aptamer substitutions showed a better response than wtRBE [36]. Another technique used to isolate RNA aptamers against Rev protein was the cross-linking SELEX consisting of a 5′-iodo uracil (5-IU)–modified RNA library, which is reactive under long-wavelength UV irradiation producing cross-links between 5-IU oligonucleotides and the protein target. This method resulted in the selection of highly specific aptamers capable of forming covalent bonds with HIV-1 Rev [37]. Some other efforts have focused on the inhibition of HIV-1 replication in human T cells using RNA aptamers as decoys to sequester Rev [38]. Rev decoys and ribozymes have been combined to increase the anti-HIV effect relative to independent ribozyme or decoy effects [3941].

HIV-1 gp120 is a surface glycoprotein involved in the early stages of HIV-1 infection. The gp120 protein interacts with the human surface receptor CD4 producing conformational changes and further receptor interactions to allow HIV-1 entry into the host cell. Due to its importance on the onset of the viral infection, gp120 represents a potential target for the isolation of aptamers to block HIV-1 entry. Several RNA aptamers have been isolated to block gp120 and CD4 interaction neutralizing diverse subtypes of the virus [42]. Characterization of aptamer B40 showed high specificity to HIV-1 R5 strain and neutralization in human peripheral blood mononuclear cells [43, 44]. Additional analyses produced a shorter synthetic B40 derivative (UCLA1) able to inhibit entry of HIV-1 at the nanomolar range. Moreover, the aptamer showed synergistic effects with a gp41 fusion inhibitor (T20) and anti-CD4 binding site monoclonal antibody (IgG1b12), suggesting a potential use as adjuvant [45].

2′-Fluoride (2′-F) modified RNA aptamers selected to bind HIV-1Bal gp120 and specifically internalized by cells expressing HIV-1Bal gp120 were used to deliver anti-HIV siRNA into HIV-1–infected cells [46]. Two aptamer-siRNA chimeras were used: one covalent chimera presented a 2′-F-modified gp120 aptamer covalently attached to the sense strand of tat/revsiRNA and reduced the plasma viral load in a RAG-hu mouse model by suppressing HIV-1 replication and preventing CD4+ T cell decline. This effect was extended by several weeks beyond the last dose [47]. The second chimera consisted of a single aptamer with three different siRNAs targeting viral and cellular transcripts. The siRNA was linked to the aptamer by a bridge sequence of 16 nt that allowed complementary base pairing of one of the two siRNA strands to the aptamer. The aptamer–siRNA chimera showed a potent suppression of HIV-1 and protection from viral CD4+ T-cell depletion in vivo. In addition, the inhibitory effects were also extended several weeks after the last injection, providing an attractive therapeutic approach to HIV-1 therapy [48].

2.2.1. Aptamers against HPV

HPVs are small DNA viruses that infect squamous epithelia inducing proliferative lesions ranging from benign warts to cancer. High-grade papillomavirus, especially types 16 and 18 (HPV-16 and HPV-18) are associated with cervical carcinoma, the second most common cancer affecting women worldwide. HPVs have a circular double-stranded DNA genome of approximately 8 kb that is organized into three regions: the upstream regulatory region (URR), the early region (E) and the late region (L). The URR contains several transcription factor binding sites to control gene expression, the early region encodes six genes (E1, E2, E4, E5, E6 and E7) involved in viral replication, transcription and cell transformation and the late region encodes the L1 and L2 capsid proteins which self-assemble to produce the virion [49].

Because preventive vaccines for HPV infection are only protective for naiveindividuals [50], several research groups have been developing nucleic acid–based aptamers targeting HPV proteins in order to inhibit the oncoproteins activity, block viral infection or identify the absence/presence of viral proteins as biomarkers to determine cell transformation or cancer progression (Table 2).

AptamerNatureSequenceRandomized regionTargetFunctionStructureRef
F2RNAGGGAAUGGAUCCACAUACUACGAAUAUUCAACAUUCGAGGUGGAUGCUACGAAUCAACUUCACUGCAGACUUGACGAAGCUU30 ntE6Inhbition of E6-PDZ (Magil1) interaction and Induction of apoptosis in SiHa cellsNDBelyaeva TA, et al.2014
F4RNAGGGAAUGGAUCCACAUACUACGAAAACUCGUUUCGAGGUUCGAAACGUUGUAAAGCCGUUUCACUGCAGACUUGACGAAGCUU30 ntE6Inhbition of E6-PDZ (Magil1) interaction and Induction of apoptosis in SiHa cellsNDBelyaeva TA, et al.2014
A2RNAGGGAAUGGAUCCACAUCUACGAAUCCCUUCAUCAUUAACCCGUCCACGCGCUUCACUGCAGACUUGACGAAGCUU30 ntE7Inhibition of E7-pRb interaction and Induction of apoptosis in SiHA cellsNicol C. et al, 2013
G5a3N.4RNAGGGAGACCCAAGCCGAUUUAUUUUGUGCAGCUUUUGUUCCCUUUAGUGAGGGUUAAUU15 ntE7E7 high affinity binding on HPV-positive cervical carcinoma cellsToscano-Garibay JD, et al. 2011
Sc5-c3RNAGGGAACAAAAGCUGCACAGGUUACCCCCGCUUGGGUCUCCCUAUAGUGAGUCGUAUUA15 ntL1High affinity binding of HPV VLPs in murire biofluidsLeija-Montoya AG, et al. 2014
C5RNAGGGAGGACGAUGCGGAAGCATCAAGGGTGATCGTTTGACCCTCCCCAGACGACUCGCCCGA30 ntHPV-16 E6/E7-HTECsInternalization in HPV-16 E6/E7 HTEC as mechanism to deliver therapeutc agentsGourronc FA, et al. 2013
13DNAATACCAGCTTATTCAATTGGGCACAGACGGAAGATGAGAATTGTGGGGCTTAGTATAGTGAGGTGCGTGTAGATAGTAAGTGCAATCT52 ntHF cell lineDetection of biomarkers lost in HPV-mediated cell transformationGraham JC, et al. 2012
14DNAATACCAGCTTATTCAATTGGGCGGGGAGTAGGGAGAGGGGTTTCCATCGGCGACAGAGGAGTTATGTGTGTAGATAGTAAGTGCAATCT52 ntHF cell lineDetection of biomarkers lost in HPV-mediated cell transformationGraham JC, et al. 2012
20DNAATACCAGCTTATTCAATTGGGGAGGGAGACACAGTCATGGAGCAGTTATTAGGGTGTACCGGGTGTAGTAGATAGTAAGTGCAATCT52 ntHF cell lineDetection of biomarkers lost in HPV-mediated cell transformationGraham JC, et al.2012
28DNAATACCAGCTTATTCAATTGGGGGACACGGAGGTGGTGGAAAGGCTAAGATTTGATGATGAGTAGTGTGGTAGATAGTAAGTGCAATCT52 ntHF cell lineDetection of biomarkers lost in HPV-mediated cell transformationGraham JC, et al. 2012

Table 2.

Aptamers isolated against HPV proteins.

The oncoproteins E6 and E7 are involved in cell immortalization and malignant transformation. E6 promotes the degradation of the tumor suppressor p53 [51], and E7 binds and destabilizes the cell cycle control protein pRb [52]. E6 and E7 have an important role in cancer progression, situating these oncoproteins as the principal potential targets to bind aptamers to block their oncogenic activity and cancer progression.

Several RNA aptamers were isolated against the PDZ-binding motif of the HPV-16 E6 oncoprotein, two of them were able to inhibit the interaction between E6 and proteins with PDZ domain (Magi 1) resulting in apoptosis. The aptamer interaction with PDZ domain was very specific and the interaction between E6 and p53 was not affected [53]. The same research group also isolated RNA aptamers against E7 oncoprotein that were able to disturb the E7–pRb interaction by targeting E7 for degradation and showed that one of them (A2) was able to inhibit cellular proliferation by inducing apoptosis in SiHa cervical carcinoma cells [54]. This effect was specific to HPV-16 transformed cells because it was not observed in HPV-free or HPV-18 cell lines [55]. Specific apoptosis induction of RNA aptamers targeting E6 and E7 oncoproteins suggests that these aptamers could have further applications in the future as therapeutic moieties.

A deeply characterized RNA aptamer targeting HPV-16 E7 oncoprotein named G5α3N.4 interacts with E7 through two stem-loop motifs in a clamp-like manner, suggesting a change in aptamer structure due to protein contact. The complex formation was observed exclusively in HPV-positive cervical carcinoma cells, suggesting that G5α3N.4 could be used to detect HPV infection and cervical cancer [56, 57].

The L1 protein is the main component of the HPV capsid. It is arranged in 72 capsomers, each consisting of five 55-kDa L1 monomers and a single 74-kDa L2 unit (theoretical 5:1 ratio). The L1 protein can self-assemble, forming virus-like particles (VLPs) that are structurally and immunologically similar to the infectious virions. HPV-16 L1 VLPs have been broadly used in HPV virology research, as delivery agents for epitopes or genes and to successfully produce prophylactic vaccines against HPV infection. The first RNA aptamer, targeting the L1 protein (Sc5-c3), was obtained using HPV-16 VLPs as targets [58]. Sc5-c3 structure consists of a hairpin structure with a 16-nt loop that directly binds VLPs with very low KD (0.05 pM). This aptamer was able to specifically bind VLPs in complex protein mixtures (murine cervical washes), suggesting that Sc5-c3 may provide a potential diagnostic tool for active HPV infections and, with further refinement, could be used as a potential tool to inhibit viral infection [58].

Nucleic acid–based aptamers have been also isolated against whole HPV-infected cells. A cell-based SELEX protocol (cell-SELEX), was used to isolate RNA aptamers able to internalize into HPV-16 E6/E7 transformed human tonsillar epithelial cells (HTEC). This was the first report of aptamers that specifically internalize into HPV-16–transformed cells, providing a plausible mechanism to specifically deliver therapeutic agents into HPV-16–associated tumors [59]. Moreover, DNA aptamers have been isolated by a cell-SELEX modification for use with adherent cells (AC-SELEX). These aptamers recognize cell surface differences between HPV-transformed and nontumorigenic cell lines and one of them (Aptamer 14) was able to enter the cells independent of cell surface protein binding. These selected aptamers have potential to elucidate biomarkers for cellular changes associated to nontumorigenic phenotype in HPV-infected cells [60].

2.3. Aptamers against influenza virus

Influenza viruses are associated with most flu pandemics. They are enveloped RNA viruses of 80 to 120 nm diameter that infect the upper respiratory tract. The disease severity depends on the virus type: A, B or C. Influenza A virus infects birds and mammals, influenza B targets mainly humans and influenza C is less common than A or B but it also causes disease. Although the three virus types infect different hosts, it has been reported that all of them can infect humans and thus they have been the subject of several SELEX protocols.

2.3.1. Influenza A Virus (IAV)

The IAV genome comprises eight segments of linear RNA and two surface glycoproteins: hemagglutinin (HA) and neuraminidase (NA). These proteins are used to classify the IAV subtypes. Seventeen HA (H1–H17) and nine NA (N1–N9) variants have been identified and implicated on viral attachment, membrane fusion and viral entry to the host cell. Many aptamers have been isolated to bind HA and NA in order to inhibit and detect the viral infection, mainly H5N1, H9N2, H1N1 and H3N2 subtypes (Table 3).

AptamerNatureSequenceRandomized regionTargetFunctionStructureRef
H3N2
A22DNAAATTAACCCTCACTAAAGGGCTGAGTCTCAAAACCGCAATACACTGGTTGTATGGTCGAATAAGTTAA30 ntHA
(91-161)
Inhibition of viral infectionJeon SH, et al.2004
A21DNAAATTAACCCTCACTAAAGGGCGCTTATTTGTTCAGGTTGGGTCTTCCTATTATGGTCGAATAAGTTAA30 ntHA
(91-161)
Inhibition of viral infectionJeon SH, et al. 2000
P-30-10-16RNAGGGAGAAUUCCGACCAGAAGGGUUAGCAGUCGGCAUGCGGUACAGACAGACCUUUCCUCUCUCCUUCCUCUUCU30 ntA/Panama/ 2007/1999Inhibition of viral infection. Discriminate between related H3N2Gopinath SC, et al. 2006
H5N1
10DNAGATTCAGTCGGACAGCGGGGTTCCCATGCGGATGTTATAAAGCAGTCGCTTATAAGGGATGGACGAATATCGTCTCCC40 ntHAIn vitro Inhibition of viral infectionCheng C, et al.2008
2DNAGTGTGCATGGATAGCACGTAACGGTGTAGTAGATACGTGCGGGTAGGAAGAAAGGGAAATAGTTGTCCTGTTG74 ntHA and whole H5N1H5N1 detection (QCM aptasensor)Wang R,and Li Y. 2013
H9N2
A9DNAGCTGCAATACTCATGGACAGCCTCCTGGGGTCAGGCTCAGACATTGATAAAGCGACATCGGTCTGGAGTACGACCCTGAA40 ntHAInhibition of viral infectionYueweiZhang, et al. 2015
B4DNAGCTGCAATACTCATGGACAGGGGCCGCGCCTGGTCGGTTGGGTGGGTGGCGCCCGGGACGGTCTGGAGTACGACCCTGAA40 ntHAInhibition of viral infectionYueweiZhang, et al2015
H5N1 AND H7N7
8-3SRNAGGGCAACCGCUGGAACUUGAAGUCGGUAAUGCGAGCGGAAAGCCC70 ntHADiscriminate IVA subtypes, inhibition of receptor bindingSuenaga E and Kumar PK, 2014.
H5N1, HIN1 AND H3N2
RHA0006DNAGGGTTTGGGTTGGGTTGGGTTTTTGGGTTTGGGTTGGGTTGGGAAAAA30 ntrHAIVA detection (ELAA)Shiratori I, et al.2014
RHA0385DNATTGGGGTTATTTTGGGAGGGCGGGGGTT30 ntrHAIVA detection (ELAA)Shiratori I, et al.2014
RHA1635DNAGGGGCCCACCCTCTCGCTGGCGGCTCTGTTCTGTTCTCGTCTCCTTGATTTCTGTGGGCCCC30 ntrHAIVA detection (ELAA)Shiratori I, et al.2014

Table 3.

Aptamers against human IAV proteins.

Two DNA aptamers, A21 and A22, were isolated against an HA peptide containing amino acid positions 91–261. A22 was the most efficient aptamer to inhibit viral infection in vivoand in vitroby blocking the cellular receptor from binding HA. Moreover, A22 showed high binding activity against different IAV strains (H3N2 and H2N2) and reduced virus burden by 90%–99% in mice [61]. Further studies using the whole virus demonstrated the ability of RNA aptamers to distinguish between related strains within the H3N2 subtype of influenza type A viruses [62]. The selected aptamer P30-10-16 was able to discriminate between A/Panama/2007/1999 and A/Aichi/2/1968 H3N2 subtypes and its binding affinity to HA was even 15-fold higher compared with a monoclonal antibody specific to HA. A consensus aptamer sequence (5′-GUCGNCNU(N)23GUA-3′) was selected by surface plasmon resonance (SPR) using an RNA pool based on randomized P30-10-16 (doped RNA pool). The GNCNU sequence was identified as the minimal element required to bind HA [63], suggesting a potential use as tools for influenza virus genotyping.

An aptamer selected against H5N1 HA (A10), showed inhibition of receptor binding producing in vitroinhibition of viral infection [64]. To increase the specificity, some aptamers were isolated using recombinant HA in the initial selection cycles and then the whole inactivated H5N1 virus for further selection cycles. The selected aptamers were able to discriminate among H5N2, H5N3, H5N9, H9N2 and H7N2, showing better specificity than anti-H5N1 monoclonal antibodies [65]. These aptamers were used on quartz crystal microbalance (QCM) biosensors coated with hydrogel. The hydrogel consisted of cross-linked hybridized ssDNA and aptamer. In the presence of H5N1 the hybridization is disturbed producing hydrogel swelling which is detected by a QCM sensor [66].

Although some aptamers have been isolated to bind a specific IVA subtype, some others identify more than one virus subtype. A 113-nt-long RNA aptamer (8-3) was isolated against HAs from H5-N1 and H7N7. The full 8-3 and shortened version called 8-3S aptamer were able to bind HA with high affinity and interfere with the cell surface HA–glycan interaction, suggesting a potential application in diagnosis and interference of virus–host interactions [67]. Furthermore, DNA aptamers were selected against recombinant hemagglutinin (rHa) to detect different subtypes of IVA such as H5N1, H1N1 and H3N2. The selected DNA aptamers: RHA0006, RH0385 and RHA1635 were able to successfully bind the three mentioned IVA subtypes. RHA0006 and RH0385 were also used in a sandwich enzyme-linked aptamer assay (ELAA), developing a novel, rapid and cost-effective diagnostic tool to identify various IVA subtypes [68].

2.3.2. Influenza B Virus (IVB)

Some aptamers have been isolated against whole virus or purified proteins in order to discriminate IVB from IVA (Table 4). An RNA aptamer against HA B/Johannesburg/05/1999 virus was able to discriminate between the HA from different strains and prevented viral infection by membrane fusion inhibition [62]. Two aptamers have been selected against intact HA of influenza strains B/Tokyo/S3/99 and Jilin/20/2003. The sensitivity of Tokyo aptamer was approximately 250-fold higher than a commercial antibody, demonstrating its potential to detect influenza viruses [69].

AptamerNatureSequenceRandomized regionTargetFunctionStructureRef
Class A-20RNAGGGAGCUCAGCCUUCACUGCACUCCGGCUGGUGGACGCGGUACGAGCAAUUUGUACCGGAUGGAUGUUCGGGCAGCGGUGUGGCAGGGAUGAGCGGCACCACGGUCGGAUCCAC74 ntHADiscriminate between stran A and B. Membrane fusion inhibitionGopinath JC, et al. 2006
Tokio virus aptamer (clone D)RNAGGGAGAAUUCCGACCAGAAGUUUUUGUUUAUAUUGUUGUUUUAUUCCUUUCCUCUCCUUCCUCUUCU25 ntWhole virus (Tokio virus)Dscriminaton of influenza viruses and detectionLakshmipriya T, et al. 2013
Jilin-HA aptamerRNAGGGAGAAUUCCGACCAGAAGGGUCUACGCCCGAAGGGUUGCCGUGCCUUUCCUCUCUCCUUCCUCUUCU25 ntHA (Jilin HA)Dscriminaton of influenza viruses and detectionLakshmipriya T, et al. 2013

Table 4.

Aptamers against IBV.

2.4. Aptamers against HCV

HCV is one of the causes of chronic liver disease associated with end-stage cirrhosis and hepatocellular carcinoma. HCV are small enveloped viruses with a linear single-stranded RNA+ genome containing a single ORF encoding a polyprotein flanked by untranslated regions (UTR) and processed into three structural proteins (C, E1 and E2) and seven nonstructural proteins (p7, NS2, NS3, NS4A, NS4B, NS5A and NS5B). The 5′-UTR contains an internal ribosomal entry site (IRES) important for mediated translation by association with the host cell small ribosomal unit (40S). Due to its importance in viral infection, replication and proliferation, HCV aptamers have been mainly isolated against NS3, NS5 proteins and some IRES domains (Table 5).

AptamerNatureSequenceRandomized regionTargetFunctionStructureRef
10-G1RNAGGGAACUCGAUGAAGCGAAUUCUGUUGGCGAACUGUACGCAAGUACACUGGAUGACAGCCUAUCUAUCUAUCGGAUCCACG10-18 ntNS3Inhibition of in vitro activityUrvil PT, et al. 1997
G6-16RNAGGGAGAAUUCCGACCAGAAGGCUUGCUGUUGUUUCCCUGUUGUUUUGUCUCUCAACUUUAUUGUGGUAAAGAUCACUGGGUUGAUAAGGGCUAACUCUAAUUUGACUACAUGGUCGGACCAAUCAGUUCUUAUGGGAGAUGCAUAUGUGCGUCUACAUGGAUCCUCA120 ntNS3Inhibition of proteolytic activityKumar PK, et al. 1997
G6-19RNAGGGAGAAUUCCGACCAGAAGCUCUUAUACUAUUAACGCUACCGUGUCAUUGUACUUGGUAGUGUUGAUGGUUUGGGUCGCAUUUGGCUUGGCUUAUGGUUUUUUCACCCUACCUCUCAUUGACGCAGUAGGCUCUCAUAUGUGCGUCUACAUGGAUCCUCA120 ntNS3Inhibition of proteolytic activityKumar PK, et al. 1997
G9-IRNAGGGAGAAUUCCGACCAGAAGCUUCGGGAUUUGAGGGUAGAAUGGGACUACCUUUCCUCUCUCCUUCCUCUUCU30 nt∆NS3Inhibition of proteolytic activityFukuda K, et al. 2000
G9-IIRNAGGGAGAAUUCCGACCAGAAGUGCUCUUAGAAUGGGACUAAGACACGGGACCCUUUCCUCUCUCCUUCCUCUUCU30 nt∆NS3Inhibition of proteolytic activityFukuda K, et al. 2000
G9-IIIRNAGGGAGAAUUCCGACCAGAAGUACGACACGAUUGGGACGUGUCUAUGGGACCCUUUCCUCUCUCCUUCCUCUUCU30 nt∆NS3Inhibition of proteolytic activityFukuda K, et al. 2000
B-2RNAGGGAUGCUUCGGCAUCCC CGAAGCCGCUAUGGACCAGUGGCGCGGCUUCGGCCCGACGGAGUGGUACCGCUUCGGCGGUACGUAAGCUUGGG25 nt - 10 ntNS5BInhibition of RNA polimerase activity in vitroBiroccio A, et al. 2000
r10/43DNAGGGAGACAAGAATAAACGCTCAAGGGCGTGGTGGGTGGGGTACTAATAATGTGCGTTTGTTCGACAGGAGGCTCACAACAGGC36 ntNS5BInhibition of specific subtype 3a polymerase activityJones LA, et al.2006
r10/47DNAGGGAGACAAGAATAAACGCTCAATTGGGGTCTGCTCGGGATTGCGGAGAACGTGAATCTTTCGACAGGAGGCTCACAACAGGC36 ntNS5BInhibition of specific subtype 3a polymerase activityJones LA, et al.2006
NS2-2DNACAGGTACCACCTTCATGGGCGCGGAAGACGATGGTGTACTA40 ntNS2Distrup Ns2 - Ns5b interaction. Inhibition of NS2 activityNDGao Y, et al. 2014
NS2-3DNAACGGGGCAGGATTGTCCCCGCGCCTGGTTGAAGGTAGTCGC40 ntNS2Inhibithion of NS2 activityNDGao Y, et al. 2014
ZE2DNAGCGGAATTCTAATACGACTCACTATAGGGAACAGTCCGAGCCGAATGAGGAATAATCTAGCTCCTTCGCTGAGGGTCAATGCGTCATAGGATCCCGC30 ntE2Competitive inhibithion of E2 - CD81 binding . Block HCV infection.Chen F, et al. 2009
E1E2-6DNAACGCTCGGATGCCACTACAG(N40)CTCATGGACGTGCTGGTGAC40 ntE1E2Inhibition of aptamer binding to the host cellNDYang D, et al. 2013

Table 5.

Aptamers isolated against HCV proteins.

NS3 has a trypsin-like serine protease and NTPase/helicase activity [70, 71]. NS3 is required for proteolytic processing of nonstructural proteins [72]. The HCV protease domain disrupts the interferon (IFN) and toll-like receptor-3 (TLR3) signaling pathways by cleaving the caspase recruitment domain of mitochondrial antiviral signaling protein (MAVS) and the TIR domain containing an adapter-inducing interferon-β sequence (TRIF) [73]. As NS3 activity is crucial for viral replication, many aptamers have been isolated against NS3.

The 10G-1 RNA aptamer was selected against NS3 protease domain using a 12–18 nt randomized library and can reduce protease activity by 20% compared with serine protease inhibitors [74]. However, a new SELEX protocol was used to select anti-NS3 aptamers with improved binding and inhibition activities increasing the structural pool complexity by using larger randomized domains (120 nt) and competition against 10G-1. As a result, two new RNA aptamers were selected (G6–16 and G6–19) showing efficient NS3 binding. The G6–16 concentration needed to inhibit 50% of the NS3 activity was 3 µM, and although both aptamers inhibited the protease and helicase activity, they showed lower efficacy compared with known serine protease inhibitors [75]. To further improve aptamer efficacy and inhibit the NS3 RNA binding helicase, a truncated form (∆NS3) only including the protease domain was used as a target, and the random sequence of the RNA pool was reduced to 30 nt to ease the SELEX process. Three highly specific aptamers (G9-I, G9-II and G9-III) were obtained against ∆NS3 containing the conserved sequence GA(A/U)UGGGAC that was present inside an identical loop in all aptamer structures. These aptamers showed KD values of 11.6 nM, 6.3 nM and 8.9 nm, respectively. The G9 aptamers produced 90% of NS3 protease activity inhibition alone and 70% in the presence of NS4A used to simulate physiological conditions [76]. Structure analyses suggested that interaction of stem I and stem-loop II is essential to G9-I aptamer NS3 binding. To achieve in vivoapplications, the G9-II aptamer was conjugated with cis-acting genomic human hepatitis delta virus (HDV) ribozymes. The aptamer was inserted into the nonfunctional stem IV region of the HDV ribozyme promoting in vivostable structure that lasted up to 4 days after transfection. The HDV ribozyme–G9-II aptamer (HA) was attached to nuclear export signal CTEM45 (HAC) and ligated in tandem to increase the aptamers dosage in cells. These new constructs showed efficient NS3 protease inhibition in vivoand in vitro[77]. To also inhibit NS3 helicase activity, a poly U tail (14U) was added to the minimum functional sequence of the G9-I aptamer (∆NEOIII) to mask and inhibit the helicase substrate-binding region [78]. NEOIII-14U displayed dual functions by inhibiting NS3 protease activity in vivoand in vitroand inhibiting the NS3 unwinding helicase reaction (IC50 1 µM) [79].

More RNA aptamers were selected against NS3 helicase domain, including the conserved sequence GGA(U/C)GGAGCC at stem-loop regions. Further deletion and mutagenesis analyses demonstrated that the whole structure of the conserved stem-loop is needed for helicase inhibition. Aptamer #5 presented the best inhibition of helicase in vitroactivity with an IC50 of 50 nM [77]. Bifunctional aptamers constructed conjugating RNA aptamers ∆NEOIII and G9-II with aptamer #5 through an oligo U spacer. The spacer length was optimized by protease and helicase inhibition assays [80]. The resulting advanced dual-functional (ADD) aptamers (NEO-34-s41 and G925-s50) showed superior inhibitory activities of NS3 [81].

NS5B is an RNA-dependent RNA polymerase that synthesizes the HCV-negative strand RNA using genomic positive RNA strand as a template. NS5B has an essential role in the HCV’s life cycle and its variability has been associated with worse disease prognosis [82]. The highly specific B.2 RNA aptamer selected against a truncated NS5B target (NS5B∆C55) presented a conserved sequence that was folded on stem loop structure associated with a tight interaction to NS5B (KD = 1.5 ± 0.2 nM). Also, B.2 demonstrated inhibition of NS5B activity by a noncompetitive mechanism [9].

Two DNA aptamers selected against NS5B (27v and 127v) showed inhibition of polymerase activity in vitro. Although both aptamers were isolated from the same SELEX procedure and presented an 11-nt conserved sequence, they displayed different mechanisms to inhibit NS5B. The 27v aptamer competed with RNA template and inhibited both initiation and elongation of RNA synthesis, while 127v competed poorly and just inhibited initiation. Also, 27v was able to inhibit RNA synthesis and HCV particles production on Huh7 cells [83, 84]. The RNA aptamers r10/43 and r10/47 were isolated against NSB5 of HVC subtype 3a and resulted in the inhibition of polymerase activity with an estimated KD = 1.4 and 6.0 nM, respectively [85].

In a different approach, chemically modified RNA aptamers (2′-hydroxyl or 2′-fluoropyrimidine) were isolated against NS5B. The 2′-hydroxyl aptamer inhibited HCV replication on human liver cells without producing off-target effects or generation of escape mutants. The 2′-fluoropyrimidine aptamer showed increased affinity to NS5B and efficient inhibition of HCV replication in cultured cells. This last aptamer was further conjugated with cholesterol or galactose-polyethylene glycol ligand to increase its availability and specificity for the liver inhibiting replication of HCV genotype 1b and 2a [86].

Two other RNA aptamers targeting NS5A (NS5A-4 and NS5A-5) reduced the levels of intracellular infectious virions and viral RNAs by 3-fold and 1-fold, respectively, affecting virus assembly and release through prevention of the NS5A–core protein interaction. These NS5A aptamers were specific to HCV without affecting HBV replication and produced cytotoxicity in human hepatocytes [87].

NS2 contains a transmembrane segment in the N-terminal and a cytoplasmic region in the C-terminal domain. Although NS2 is essential for HCV RNA replication, its role in HCV’s life cycle is still unknown. Aptamers NS2-2 and NS2-3 were isolated against NS2 and demonstrated reduced infectious virus production without in vitrocytotoxicity. These aptamers were specific to HCV and did not trigger innate immunity responses. NS2-2 aptamer produces its antiviral effects through binding the NS2 N-terminus thus disrupting NS2–NS5 interaction [88].

E2 is an enveloped glycoprotein implicated on initial steps of viral infection by the direct interaction with CD81. Through cell surface SELEX (CS-SELEX), specific DNA aptamers were isolated against E2 expressed on CT26 cells. Aptamer ZE2 showed the highest affinity and specificity to E2 and was able to detect HCV particles and block HCV infection on human cultured hepatocytes by CD81 binding inhibition [89]. A similar inhibition mechanism was observed on the DNA aptamer E1E2-6, which inhibited viral infection by blocking host cell binding [90]. A new system developed to quantify immobilized infectious HCV particles in microplates (so-called enzyme linked apto-sorbent assay or ELASA) used aptamers against E2 instead of antibodies and resulted in an effective and easy-to-use tool to quantify infectious units of HCV and to monitor anti-HCV drug efficacies [91].

Advertisement

3. Aptamer structures

Nucleic acid aptamers have a diverse range of secondary structures such as stems, loops, symmetric or asymmetric internal loops, bulge, single-base bulges and junctions. Aptamer internal loops and bulges generally present different conformations in solution and adopt defined secondary and tertiary structures on ligand–aptamer complex [92]. This effect was observed on aptamer Sc5-c3 selected against HPV-16 VLPs. Sc5-c3 showed a hairpin structure with an internal loop, where the main loop (ML) presented two different structures in the absence of a target (Table 2). Sc5-c3 transition structure was demonstrated by ribonuclease mapping. Further experiments using Sc5-c3 mutants generated both stable stem and stable loop conformations, demonstrating that the loop structure binds better to the VLPs [58]. Thus, as observed in several aptamers, the binding region remains as a flexible single strand as bulges or loops stabilize conformation arrangements in the presence of a target, producing a very specific binding.

Although bulges and loops are quite common target-binding motifs in aptamer RNAs, they are not the only structures present in aptamer–target complexes. Pseudoknots and G-quadruplexes have also been reported as functional components of aptamers [93]. For example, some of the aptamers isolated against HIV integrase (93 del and 112 del) presented a G-rich nucleic acid sequence that was stabilized in the presence of K+ as G-tetrad, increasing their inhibitory effect [25]. Later reports showed that 93 del adopts an unusually stable dimeric quadruplex structure [94].

The binding properties of an aptamer are dictated by its sequence and subsequent folding into secondary and tertiary structures. Recently, functional RNA structures were classified as critical, connecting, neutral and forbidden structures regarding their particular roles within a structure [95]. This classification is also applicable to nucleic acid aptamers and is an important clue to design novel and functional variants for viral detection or therapy.

Advertisement

4. Challenges for aptamer technology

According to their molecular characteristics, RNA or DNA aptamers have some limitations in their use in animal models and humans. They have limited stability in biological fluids and are readily degraded by nucleases, unmodified aptamers in the bloodstream possess a half-life time of less than two minutes. However, many post-SELEX modifications have been developed to avoid nuclease attack and improve stability in biological fluids. Some modification examples include nucleotide substitutions by 2′-modified variants such as 2′-fluoro (2′-F), 2′-amino (2′-NH2) or 2′-O-alkyl. Because the most abundant nucleases in biological fluids are specific to pyrimidines, substitutions in pyrimidine positions appear to be sufficient to prevent degradation. Another method to stabilize RNA aptamers is the substitution of D-ribose by L-ribose. As a first step, the aptamers bind the mirror image of the target molecule to obtain a D-aptamer, then the selected aptamer sequence is synthesized in L-conformation. As a result of molecular symmetry, the L-ribose–containing aptamer can bind to the target molecule avoiding degradation by D-ribose–specific nucleases. Moreover, to efficiently overcome binding issues produced by the introduction of modified nucleotides on the aptamer sequence, the SELEX procedure can be carried out in the presence of modified libraries.

Therapeutic aptamers selected against intracellular or nuclear proteins represent bigger challenges as they need to go across physiological barriers (i.e. cell membrane) before they reach their targets. DNA and RNA aptamers are characterized by rapid renal clearance leading to short half-lives in the bloodstream. To address this issue, aptamers can be conjugated to synthetic polymers such as polyethylene glycol (PEG) to increase their in vivohalf-life and pharmacodynamics [96]. Additionally, PEG-conjugated aptamers show higher cellular uptake than the unconjugated form [96]. Alternatively, delivery systems such as viral and nonviral vectors may have improved aptamer cell uptake and nuclear distribution [97]. Vectors or aptamers alone can be delivered either ex vivoor in vivo. In vivoapproaches include intravenous injection or local implantation and ex vivorefer to the removal of cells followed by in vitrogenetic manipulation and the reintroduction of modified cells. These therapies are still under evaluation and further studies are necessary to demonstrate their clinical safety. Aptamers against extracellular or surface viral targets have obvious advantages over aptamers targeting viral proteins intracellularly expressed, as they can reach exposed areas of infection, such as the respiratory tract or reproductive organs. This availability makes it possible to develop new antiviral drugs administrated by noninvasive methods, such as aerosols in case of respiratory tract infection or topical creams/lotions in case of reproductive organ infections. Many aptamers are undergoing clinical trials, some of them administrated by noninvasive methods but, so far, no antiviral aptamer has been approved for human use [18, 98].

Advertisement

5. Conclusion

In the last few years, aptamers have become successful tools for specific viral diagnosis and genotyping, resulting in the development of many methods based on aptamer–target detection with very high sensibility and accuracy. On the other hand, aptamer’s role as an antiviral drug has demonstrated the inhibition of viral infection through in vitroassays and in vivoexperiments using cell lines or animal models. Nevertheless, most aptamers failed to produce results in clinical trials mostly due to nuclease-associated degradation. Therefore, further development of aptamer’s stability in biofluids and improved pharmacodynamics and delivery methods are required to overcome clinical issues that would allow its successful therapeutic application.

References

  1. 1. Ellington AD, Szostak JW. In vitro selection of RNA molecules that bind specific ligands. Nature. 1990;346:818–822.
  2. 2. Tuerk C, Gold L. Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science. 1990;249:505–510.
  3. 3. Aquino-Jarquin G, Toscano-Garibay JD. RNA aptamer evolution: two decades of SELEction. Int. J. Mol. Sci. 2011;12:9155–9171.
  4. 4. Fitzwater T, Polisky B. A SELEX primer. Methods Enzymol. 1996;267:275–301.
  5. 5. Bock LC, Griffin LC, Latham JA, Vermaas EH, Toole JJ. Selection of single-stranded DNA molecules that bind and inhibit human thrombin. Nature. 1992;355:564–566.
  6. 6. Harada K, Frankel AD. Identification of two novel arginine binding DNAs. EMBO J. 1995;14:5798–5811.
  7. 7. Wang Y, Killian J, Hamasaki K, Rando RR. RNA molecules that specifically and stoichiometrically bind aminoglycoside antibiotics with high affinities. Biochemistry. 1996;35:12338–12346.
  8. 8. Sassanfar M, Szostak JW. An RNA motif that binds ATP. Nature. 1993;364:550–553.
  9. 9. Biroccio A, Hamm J, Incitti I, De Francesco R, Tomei L. Selection of RNA aptamers that are specific and high-affinity ligands of the hepatitis C virus RNA-dependent RNA polymerase. J. Virol. 2002;76:3688–3696.
  10. 10. Green LS, Jellinek D, Bell C, Beebe LA, Feistner BD, Gill SC, Jucker FM, Janjic N. Nuclease-resistant nucleic acid ligands to vascular permeability factor/vascular endothelial growth factor. Chem. Biol. 1995;2:683–695.
  11. 11. Jellinek D, Green LS, Bell C, Lynott CK, Gill N, Vargeese C, Kirschenheuter G, McGee DP, Abesinghe P, Pieken WA. Potent 2′-amino-2′-deoxypyrimidine RNA inhibitors of basic fibroblast growth factor. Biochemistry. 1995;34:11363–11372.
  12. 12. Bruno JG, Kiel JL. In vitro selection of DNA aptamers to anthrax spores with electrochemiluminescence detection. Biosens. Bioelectron. 1999;14:457–464.
  13. 13. Ulrich H, Magdesian MH, Alves MJ, Colli W. In vitro selection of RNA aptamers that bind to cell adhesion receptors ofTrypanosoma cruziand inhibit cell invasion. J. Biol. Chem. 2002;277:20756–20762.
  14. 14. Sundaram P, Kurniawan H, Byrne ME, Wower J. Therapeutic RNA aptamers in clinical trials. Eur. J. Pharm. Sci. 2013;48:259–271.
  15. 15. Vinores SA. Pegaptanib in the treatment of wet, age-related macular degeneration. Int. J. Nanomedicine. 2006;1:263–268.
  16. 16. Shum KT, Zhou J, Rossi JJ. Aptamer-based therapeutics: new approaches to combat human viral diseases. Pharmaceuticals (Basel). 2013;6:1507–1542.
  17. 17. Pan W, Craven RC, Qiu Q, Wilson CB, Wills JW, Golovine S, Wang JF. Isolation of virus-neutralizing RNAs from a large pool of random sequences. Proc. Natl. Acad. Sci. U. S. A. 1995;92:11509–11513.
  18. 18. Wandtke T, Wozniak J, Kopinski P. Aptamers in diagnostics and treatment of viral infections. Viruses. 2015;7:751–780.
  19. 19. Barre-Sinoussi F, Chermann JC, Rey F, Nugeyre MT, Chamaret S, Gruest J, Dauguet C, Axler-Blin C, Vezinet-Brun F, Rouzioux C, Rozenbaum W, Montagnier L. Isolation of a T-lymphotropic retrovirus from a patient at risk for acquired immune deficiency syndrome (AIDS). Science. 1983;220:868–871.
  20. 20. Gallo RC, Sarin PS, Gelmann EP, Robert-Guroff M, Richardson E, Kalyanaraman VS, Mann D, Sidhu GD, Stahl RE, Zolla-Pazner S, Leibowitch J, Popovic M. Isolation of human T-cell leukemia virus in acquired immune deficiency syndrome (AIDS). Science. 1983;220:865–867.
  21. 21. Gopinath SC. Antiviral aptamers. Arch. Virol. 2007;152:2137–2157.
  22. 22. Whitcomb JM, Hughes SH. Retroviral reverse transcription and integration: progress and problems. Annu. Rev. Cell Biol. 1992;8:275–306.
  23. 23. Allen P, Worland S, Gold L. Isolation of high-affinity RNA ligands to HIV-1 integrase from a random pool. Virology. 1995;209:327–336.
  24. 24. Phan AT, Modi YS, Patel DJ. Propeller-type parallel-stranded G-quadruplexes in the human c-myc promoter. J. Am. Chem. Soc. 2004;126:8710–8716.
  25. 25. De Soultrait VR, Lozach PY, Altmeyer R, Tarrago-Litvak L, Litvak S, Andreola ML. DNA aptamers derived from HIV-1 RNase H inhibitors are strong anti-integrase agents. J. Mol. Biol. 2002;324:195–203.
  26. 26. Chou SH, Chin KH, Wang AH. DNA aptamers as potential anti-HIV agents. Trends. Biochem. Sci. 2005;30:231–234.
  27. 27. Berkhout B, Silverman RH, Jeang KT. Tat trans-activates the human immunodeficiency virus through a nascent RNA target. Cell. 1989;59:273–282.
  28. 28. Yamamoto R, Toyoda S, Viljanen P, Machida K, Nishikawa S, Murakami K, Taira K, Kumar PK. In vitro selection of RNA aptamers that can bind specifically to Tat protein of HIV-1. Nucleic. Acids. Symp. Ser. 1995;145–146.
  29. 29. Yamamoto R, Katahira M, Nishikawa S, Baba T, Taira K, Kumar PK. A novel RNA motif that binds efficiently and specifically to the Ttat protein of HIV and inhibits the trans-activation by Tat of transcription in vitro and in vivo. Genes Cells. 2000;5:371–388.
  30. 30. Yamamoto R, Baba T, Kumar PK. Molecular beacon aptamer fluoresces in the presence of Tat protein of HIV-1. Genes Cells. 2000;5:389–396.
  31. 31. Tombelli S, Minunni M, Luzi E, Mascini M. Aptamer-based biosensors for the detection of HIV-1 Tat protein. Bioelectrochemistry. 2005;67:135–141.
  32. 32. Rahim RA, Tanabe K, Ibori S, Wang X, Kawarada H. Effects of diamond-FET-based RNA aptamer sensing for detection of real sample of HIV-1 Tat protein. Biosens. Bioelectron. 2013;40:277–282.
  33. 33. Tuerk C, MacDougal-Waugh S. In vitro evolution of functional nucleic acids: high-affinity RNA ligands of HIV-1 proteins. Gene. 1993;137:33–39.
  34. 34. Jensen KB, Green L, MacDougal-Waugh S, Tuerk C. Characterization of an in vitro-selected RNA ligand to the HIV-1 Rev protein. J. Mol. Biol. 1994;235:237–247.
  35. 35. Giver L, Bartel DP, Zapp ML, Green MR, Ellington AD. Selection and design of high-affinity RNA ligands for HIV-1 Rev. Gene. 1993;137:19–24.
  36. 36. Symensma TL, Giver L, Zapp M, Takle GB, Ellington AD. RNA aptamers selected to bind human immunodeficiency virus type 1 Rev in vitro are Rev responsive in vivo. J. Virol. 1996;70:179–187.
  37. 37. Jensen KB, Atkinson BL, Willis MC, Koch TH, Gold L. Using in vitro selection to direct the covalent attachment of human immunodeficiency virus type 1 Rev protein to high-affinity RNA ligands. Proc. Natl. Acad. Sci. U. S. A. 1995;92:12220–12224.
  38. 38. Lee SW, Gallardo HF, Gilboa E, Smith C. Inhibition of human immunodeficiency virus type 1 in human T cells by a potent Rev response element decoy consisting of the 13-nucleotide minimal Rev-binding domain. J. Virol. 1994;68:8254–8264.
  39. 39. Yamada O, Kraus G, Luznik L, Yu M, Wong-Staal F. A chimeric human immunodeficiency virus type 1 (HIV-1) minimal Rev response element-ribozyme molecule exhibits dual antiviral function and inhibits cell-cell transmission of HIV-1. J. Virol. 1996;70:1596–1601.
  40. 40. Gervaix A, Li X, Kraus G, Wong-Staal F. Multigene antiviral vectors inhibit diverse human immunodeficiency virus type 1 clades. J. Virol. 1997;71:3048–3053.
  41. 41. Konopka K, Lee NS, Rossi J, Duzgunes N. Rev-binding aptamer and CMV promoter act as decoys to inhibit HIV replication. Gene. 2000;255:235–244.
  42. 42. Khati M, Schuman M, Ibrahim J, Sattentau Q, Gordon S, James W. Neutralization of infectivity of diverse R5 clinical isolates of human immunodeficiency virus type 1 by gp120-binding 2′F-RNA aptamers. J. Virol. 2003;77:12692–12698.
  43. 43. Dey AK, Khati M, Tang M, Wyatt R, Lea SM, James W. An aptamer that neutralizes R5 strains of human immunodeficiency virus type 1 blocks gp120-CCR5 interaction. J. Virol. 2005;79:13806–13810.
  44. 44. Cohen C, Forzan M, Sproat B, Pantophlet R, McGowan I, Burton D, James W. An aptamer that neutralizes R5 strains of HIV-1 binds to core residues of gp120 in the CCR5 binding site. Virology. 2008;381:46–54.
  45. 45. Mufhandu HT, Gray ES, Madiga MC, Tumba N, Alexandre KB, Khoza T, Wibmer CK, Moore PL, Morris L, Khati M. UCLA1, a synthetic derivative of a gp120 RNA aptamer, inhibits entry of human immunodeficiency virus type 1 subtype C. J. Virol. 2012;86:4989–4999.
  46. 46. Zhou J, Swiderski P, Li H, Zhang J, Neff CP, Akkina R, Rossi JJ. Selection, characterization and application of new RNA HIV gp 120 aptamers for facile delivery of Dicer substrate siRNAs into HIV infected cells. Nucleic Acids Res. 2009;37:3094–3109.
  47. 47. Neff CP, Zhou J, Remling L, Kuruvilla J, Zhang J, Li H, Smith DD, Swiderski P, Rossi JJ, Akkina R. An aptamer-siRNA chimera suppresses HIV-1 viral loads and protects from helper CD4(+) T cell decline in humanized mice. Sci. Transl. Med. 2011;3:1–10.
  48. 48. Zhou J, Neff CP, Swiderski P, Li H, Smith DD, Aboellail T, Remling-Mulder L, Akkina R, Rossi JJ. Functional in vivo delivery of multiplexed anti-HIV-1 siRNAs via a chemically synthesized aptamer with a sticky bridge. Mol. Ther. 2013;21:192–200.
  49. 49. DiPaolo JA, Popescu NC, Alvarez-Salas LM, Woodworth CD. Cellular and molecular alterations in human epithelial cells transformed by recombinant human papillomavirus DNA. Crit. Rev. Oncog. 1993;4:337–360.
  50. 50. Hildesheim A, Herrero R, Wacholder S, Rodriguez AC, Solomon D, Bratti MC, Schiller JT, Gonzalez P, Dubin G, Porras C, Jimenez SE, Lowy DR. Effect of human papillomavirus 16/18 L1 viruslike particle vaccine among young women with preexisting infection: a randomized trial. JAMA. 2007;298:743–753.
  51. 51. Werness BA, Levine AJ, Howley PM. Association of human papillomavirus types 16 and 18 E6 proteins with p53. Science. 1990;248:76–79.
  52. 52. Dyson N, Howley PM, Munger K, Harlow E. The human papilloma virus-16 E7 oncoprotein is able to bind to the retinoblastoma gene product. Science. 1989;243:934–937.
  53. 53. Belyaeva TA, Nicol C, Cesur O, Trave G, Blair GE, Stonehouse NJ. An RNA aptamer targets the PDZ-binding motif of the HPV16 E6 oncoprotein. Cancers (Basel). 2014;6:1553–1569.
  54. 54. Nicol C, Bunka DH, Blair GE, Stonehouse NJ. Effects of single nucleotide changes on the binding and activity of RNA aptamers to human papillomavirus 16 E7 oncoprotein. Biochem. Biophys. Res. Commun. 2011;405:417–421.
  55. 55. Nicol C, Cesur O, Forrest S, Belyaeva TA, Bunka DH, Blair GE, Stonehouse NJ. An RNA aptamer provides a novel approach for the induction of apoptosis by targeting the HPV16 E7 oncoprotein. PLoS ONE. 2013;8:e64781–e64791.
  56. 56. Toscano-Garibay JD, Benitez-Hess ML, Alvarez-Salas LM. Isolation and characterization of an RNA aptamer for the HPV-16 E7 oncoprotein. Arch. Med. Res. 2011;42:88–96.
  57. 57. Toscano-Garibay JD, Benitez-Hess ML, Alvarez-Salas LM. Targeting of the HPV-16 E7 protein by RNA aptamers. Methods Mol. Biol. 2015;1249:221–239.
  58. 58. Leija-Montoya AG, Benitez-Hess ML, Toscano-Garibay JD, Alvarez-Salas LM. Characterization of an RNA aptamer against HPV-16 L1 virus-like particles. Nucleic Acid Ther. 2014;24:344–355.
  59. 59. Gourronc FA, Rockey WM, Thiel WH, Giangrande PH, Klingelhutz AJ. Identification of RNA aptamers that internalize into HPV-16 E6/E7 transformed tonsillar epithelial cells. Virology. 2013;446:325–333.
  60. 60. Graham JC, Zarbl H. Use of cell-SELEX to generate DNA aptamers as molecular probes of HPV-associated cervical cancer cells. PLoS ONE. 2012;7:e36103–e36111.
  61. 61. Jeon SH, Kayhan B, Ben-Yedidia T, Arnon R. A DNA aptamer prevents influenza infection by blocking the receptor binding region of the viral hemagglutinin. J. Biol. Chem. 2004;279:48410–48419.
  62. 62. Gopinath SC, Misono TS, Kawasaki K, Mizuno T, Imai M, Odagiri T, Kumar PK. An RNA aptamer that distinguishes between closely related human influenza viruses and inhibits haemagglutinin-mediated membrane fusion. J. Gen. Virol. 2006;87:479–487.
  63. 63. Misono TS, Kumar PK. Selection of RNA aptamers against human influenza virus hemagglutinin using surface plasmon resonance. Anal. Biochem. 2005;342:312–317.
  64. 64. Cheng C, Dong J, Yao L, Chen A, Jia R, Huan L, Guo J, Shu Y, Zhang Z. Potent inhibition of human influenza H5N1 virus by oligonucleotides derived by SELEX. Biochem. Biophys. Res. Commun. 2008;366:670–674.
  65. 65. Wang R, Zhao J, Jiang T, Kwon YM, Lu H, Jiao P, Liao M, Li Y. Selection and characterization of DNA aptamers for use in detection of avian influenza virus H5N1. J. Virol. Methods. 2013;189:362–369.
  66. 66. Wang R, Li Y. Hydrogel based QCM aptasensor for detection of avian influenza virus. Biosens. Bioelectron. 2013;42:148–155.
  67. 67. Suenaga E, Kumar PK. An aptamer that binds efficiently to the hemagglutinins of highly pathogenic avian influenza viruses (H5N1 and H7N7) and inhibits hemagglutinin-glycan interactions. Acta Biomater. 2014;10:1314–1323.
  68. 68. Shiratori I, Akitomi J, Boltz DA, Horii K, Furuichi M, Waga I. Selection of DNA aptamers that bind to influenza A viruses with high affinity and broad subtype specificity. Biochem. Biophys. Res. Commun. 2014;443:37–41.
  69. 69. Lakshmipriya T, Fujimaki M, Gopinath SC, Awazu K. Generation of anti-influenza aptamers using the systematic evolution of ligands by exponential enrichment for sensing applications. Langmuir. 2013;29:15107–15115.
  70. 70. Gallinari P, Brennan D, Nardi C, Brunetti M, Tomei L, Steinkuhler C, De FR. Multiple enzymatic activities associated with recombinant NS3 protein of hepatitis C virus. J. Virol. 1998;72:6758–6769.
  71. 71. Stapleford KA, Lindenbach BD. Hepatitis C virus NS2 coordinates virus particle assembly through physical interactions with the E1–E2 glycoprotein and NS3–NS4A enzyme complexes. J. Virol. 2011;85:1706–1717.
  72. 72. Failla C, Tomei L, De FR. Both NS3 and NS4A are required for proteolytic processing of hepatitis C virus nonstructural proteins. J. Virol. 1994;68:3753–3760.
  73. 73. Preciado MV, Valva P, Escobar-Gutierrez A, Rahal P, Ruiz-Tovar K, Yamasaki L, Vazquez-Chacon C, Martinez-Guarneros A, Carpio-Pedroza JC, Fonseca-Coronado S, Cruz-Rivera M. Hepatitis C virus molecular evolution: transmission, disease progression and antiviral therapy. World J. Gastroenterol. 2014;20:15992–16013.
  74. 74. Urvil PT, Kakiuchi N, Zhou DM, Shimotohno K, Kumar PK, Nishikawa S. Selection of RNA aptamers that bind specifically to the NS3 protease of hepatitis C virus. Eur. J. Biochem. 1997;248:130–138.
  75. 75. Kumar PK, Machida K, Urvil PT, Kakiuchi N, Vishnuvardhan D, Shimotohno K, Taira K, Nishikawa S. Isolation of RNA aptamers specific to the NS3 protein of hepatitis C virus from a pool of completely random RNA. Virology. 1997;237:270–282.
  76. 76. Fukuda K, Vishnuvardhan D, Sekiya S, Hwang J, Kakiuchi N, Taira K, Shimotohno K, Kumar PK, Nishikawa S. Isolation and characterization of RNA aptamers specific for the hepatitis C virus nonstructural protein 3 protease. Eur. J. Biochem. 2000;267:3685–3694.
  77. 77. Nishikawa F, Kakiuchi N, Funaji K, Fukuda K, Sekiya S, Nishikawa S. Inhibition of HCV NS3 protease by RNA aptamers in cells. Nucleic Acids. Res. 2003;31:1935–1943.
  78. 78. Sekiya S, Nishikawa F, Fukuda K, Nishikawa S. Structure/function analysis of an RNA aptamer for hepatitis C virus NS3 protease. J. Biochem. (Tokyo.). 2003;133:351–359.
  79. 79. Fukuda K, Umehara T, Sekiya S, Kunio K, Hasegawa T, Nishikawa S. An RNA ligand inhibits hepatitis C virus NS3 protease and helicase activities. Biochem. Biophys. Res. Commun. 2004;325:670–675.
  80. 80. Umehara T, Fukuda K, Nishikawa F, Sekiya S, Kohara M, Hasegawa T, Nishikawa S. Designing and analysis of a potent bi-functional aptamers that inhibit protease and helicase activities of HCV NS3. Nucleic Acids Symp. Ser. (Oxf). 2004;195–196.
  81. 81. Umehara T, Fukuda K, Nishikawa F, Kohara M, Hasegawa T, Nishikawa S. Rational design of dual-functional aptamers that inhibit the protease and helicase activities of HCV NS3. J. Biochem. (Tokyo). 2005;137:339–347.
  82. 82. Marascio N, Torti C, Liberto M, Foca A. Update on different aspects of HCV variability: focus on NS5B polymerase. BMC Infect. Dis. 2014;14:S1–14.
  83. 83. Bellecave P, Andreola ML, Ventura M, Tarrago-Litvak L, Litvak S, Astier-Gin T. Selection of DNA aptamers that bind the RNA-dependent RNA polymerase of hepatitis C virus and inhibit viral RNA synthesis in vitro. Oligonucleotides. 2003;13:455–463.
  84. 84. Bellecave P, Cazenave C, Rumi J, Staedel C, Cosnefroy O, Andreola ML, Ventura M, Tarrago-Litvak L, Astier-Gin T. Inhibition of hepatitis C virus (HCV) RNA polymerase by DNA aptamers: mechanism of inhibition of in vitro RNA synthesis and effect on HCV-infected cells. Antimicrob. Agents Chemother. 2008;52:2097–2110.
  85. 85. Jones LA, Clancy LE, Rawlinson WD, White PA. High-affinity aptamers to subtype 3a hepatitis C virus polymerase display genotypic specificity. Antimicrob. Agents Chemother. 2006;50:3019–3027.
  86. 86. Lee CH, Lee YJ, Kim JH, Lim JH, Kim JH, Han W, Lee SH, Noh GJ, Lee SW. Inhibition of hepatitis C virus (HCV) replication by specific RNA aptamers against HCV NS5B RNA replicase. J. Virol. 2013;87:7064–7074.
  87. 87. Yu X, Gao Y, Xue B, Wang X, Yang D, Qin Y, Yu R, Liu N, Xu L, Fang X, Zhu H. Inhibition of hepatitis C virus infection by NS5A-specific aptamer. Antiviral Res. 2014;106:116–124.
  88. 88. Gao Y, Yu X, Xue B, Zhou F, Wang X, Yang D, Liu N, Xu L, Fang X, Zhu H. Inhibition of hepatitis C virus infection by DNA aptamer against NS2 protein. PLoS ONE. 2014;9:e90333–e90343.
  89. 89. Chen F, Hu Y, Li D, Chen H, Zhang XL. CS-SELEX generates high-affinity ssDNA aptamers as molecular probes for hepatitis C virus envelope glycoprotein E2. PLoS ONE. 2009;4:e8142.
  90. 90. Yang D, Meng X, Yu Q, Xu L, Long Y, Liu B, Fang X, Zhu H. Inhibition of Hepatitis C virus infection by DNA aptamer against envelope protein. Antimicrob. Agents Chemother. 2013;57:4937–4944.
  91. 91. Park JH, Jee MH, Kwon OS, Keum SJ, Jang SK. Infectivity of hepatitis C virus correlates with the amount of envelope protein E2: development of a new aptamer-based assay system suitable for measuring the infectious titer of HCV. Virology. 2013;439:13–22.
  92. 92. Patel DJ. Structural analysis of nucleic acid aptamers. Curr. Opin. Chem. Biol. 1997;1:32–46.
  93. 93. Zhang Y, Yu Z, Jiang F, Fu P, Shen J, Wu W, Li J. Two DNA aptamers against avian influenza H9N2 virus prevent viral infection in cells. PLoS ONE. 2015;10:e0123060.
  94. 94. Phan AT, Kuryavyi V, Ma JB, Faure A, Andreola ML, Patel DJ. An interlocked dimeric parallel-stranded DNA quadruplex: a potent inhibitor of HIV-1 integrase. Proc. Natl. Acad. Sci. U. S. A. 2005;102:634–639.
  95. 95. Kun A, Szathmary E. Fitness landscapes of functional RNAs. Life (Basel). 2015;5:1497–1517.
  96. 96. Da PC, Blackshaw E, Missailidis S, Perkins AC. PEGylation and biodistribution of an anti-MUC1 aptamer in MCF-7 tumor-bearing mice. Bioconjug. Chem. 2012;23:1377–1381.
  97. 97. Silva AC, Lopes CM, Sousa Lobo JM, Amaral MH. Nucleic acids delivery systems: a challenge for pharmaceutical technologists. Curr. Drug Metab. 2015;16:3–16.
  98. 98. Gopinath SC. Methods developed for SELEX. Anal. Bioanal. Chem. 2007;387:171–182.

Written By

Ana Gabriela Leija-Montoya, María Luisa Benítez-Hess and Luis Marat Alvarez-Salas

Submitted: May 7th, 2015 Reviewed: October 19th, 2015 Published: March 16th, 2016