Open access

Transcriptional Regulation of the Human Genes that Encode DNA Repair- and Mitochondrial Function-Associated Proteins

Written By

Fumiaki Uchiumi, Steven Larsen and Sei-ichi Tanuma

Submitted: June 16th, 2014 Published: November 18th, 2015

DOI: 10.5772/59588

Chapter metrics overview

1,769 Chapter Downloads

View Full Metrics

1. Introduction

Mitochondria are thought to be evolved from primeval prokaryotes after symbiosis in anearobic cells, and they have their own circular DNAs (mtDNAs) and transcription/translation systems [1-3]. However, most of the genes (99%) that encode mitochondrial proteins and components of protein complexes are contained in nuclear genomes [3]. Previous researches revealed that mitochondria play important roles in the regulation of vital biological events, namely production of energy [4]. More importantly, recent studies showed that mitochondria exert signals to affect cell death [5], cellular senescence [6], and DNA repair systems [7]. These observations imply that mitochondria and nuclei are communicating each other to protect nuclear DNAs that encode 99% of mitochondrial proteins [8]. Furthermore, mitochondria also play roles in the responses to various stresses, including immunological reaction [9, 10].

Previously, we surveyed the human genomic DNA data-base and found that promoter regions of several DNA-repair-associated genes, including ATM, BRCA1, FANCD2, PARG, and TP53, which encode proteins that regulate mitochondrial functions, contain duplicated GGAA-motifs [11]. Moreover, numbers of DNA repair and mitochondrial function-associated genes are linked with partner genes by bidirectional promoter regions containing duplicated GGAA motifs [12]. These observations suggest that expression of the DNA repair and mitochondrial function associated factor-encoding genes are commonly regulated by GGAA-motif binding transcription factors (TFs).

In this chapter, we will focus on and discuss transcriptional mechanisms that regulate both DNA repair and mitochondrial functions. Not only DNA repair systems, but also several metabolic enzyme reactions that depend on an inner cellular NAD+/NADH ratio, including TCA (Citrate/Krebs) cycle and poly (ADP-ribosyl)ation, are thought to be dys-regulated in cancer or tumor cells. We therefore, propose a novel cancer therapy by introducing GGAA-motif binding TFs or their expression vectors, activating both DNA repair and mitochondrial functions.

Advertisement

2. Relationships between DNA-repair, mitochondrial functions and Immune responses

Telomeres are the specific region of chromosomes that regulate cellular senescence and chromosomal integrity [13]. It has also been indicated that mitochondrial function is regulated by telomeres [6]. Several nuclear DNA-repair factors are suggested to play roles in the maintenance of mitochondrial DNAs (mtDNAs), and damaged mtDNAs in turn exert signals to regulate nuclear transcription [7]. Some of the DNA repair factors have been shown to localize in mitochondria. Furthermore, immune system has been suggested to be under the regulation of DNA repair [14]. Therefore, understanding the co-operation of the telomere-mitochondria-DNA repair-immune response might contribute to reveal molecular mechanism of cellular senescence, cancer and immunological diseases.

2.1. Characterization of the promoter regions of genes encoding enzymes that regulate human poly(ADP-ribose) metabolism

We have found duplicated GGAA-motifs in the bidirectional promoter of the human PARG and TIM23B genes that encode a poly(ADP-ribose) degrading enzyme and a mitochondrial inner membrane translocase 23B, respectively [11, 15, 16]. Isoforms of the PARG protein localize in the mitochondria [17]. PARP1 enzyme synthesizes poly(ADP-ribose)s on various target proteins, including p53 [18, 19] and PARP1 itself to regulate DNA-repair synthesis [20]. Interestingly, duplicated GGAA motifs are also contained in the promoter region of the human PARP1 gene [21, 22]. PARP1 and PARP2 enzymes influence mitochondrial function and oxidative metabolism [23]. It has been shown that PARP1 protein localizes in mitochondria to maintain mitochondrial DNA integrity [24]. These observations imply that several DNA-repair factors localize in mitochondria, and that their gene expression may be partly controlled by the GGAA-motif binding protein factors.

2.2. DNA-repair factors and mitochondrial functions

It is widely known that damage on DNAs activates p53, which is transcribed from the TP53 gene, allowing it to bind to 5’-regulatory elements and activate genes encoding cell cycle regulators, apoptosis- and autophagy-inducers [25, 26]. The p53 protein does not only act as a “guardian of the genome”, but also serves as a metabolism regulator [27, 28]. Moreover, p53 has been reported to accumulate in mitochondria in response to stress [26]. One recent study revealed that mitochondrial disulfide relay causes translocation of p53 into mitochondria to facilitate its function for repairing oxidative damage to mitochondrial DNA [29]. However, overexpression of p53 in mitochondria would lead to depleted mitochondrial DNA abundance and a reduction in oxidative stress [30]. Oncogenic RAS-induced mitochondrial dysfunction, which causes oncogene induced senescence, is dependent on either p53 or RB [31]. As a tumor suppressor protein, RB plays a role in linking cell cycle exit with mitochondrial biogenesis [32]. RB is widely known to control cell cycle progression, maintenance of genome stability and apoptosis by interacting with the E2F family of TFs [33]. Recently, it was reported that mutation of E2F1 leads to mitochondrial defects in human cells [34].

Besides p53 and Rb, various DNA repair factors have been reported to localize in mitochondria or regulate their biological functions. For example, mutations of the BRCA1 gene have become one of the hallmarks for diagnosis of breast cancer [35, 36]. BRCA1 protein, which plays a part in the repair synthesis of double-strand DNA breaks [37], is also involved in the mitochondrial genome maintenance to be trans-located into mitochondria especially when it is phosphorylated [38]. Deficiency of BRCA1, which interacts with FANCD2 protein, leads to phenotypes that resemble to Fanconi amaemia (FA) [39]. A number of additional DNA repair factors associate with FA proteins [40]. Recent study of transcripts from bone marrow cells revealed that FA patients have deficiencies in mitochondrial, redox and DNA repair pathways [41, 42]. Another DNA-repair deficient disease is Ataxia Telangiectasia (AT) that is caused by mutations on the ATM gene [43]. Recently, it was reported that lack of ATM causes reduced mitochondrial DNA integrity and mitochondrial dysfunction [44]. Moreover, it was suggested that mitochondria are required for the oxidative activation of ATM [45]. The duplicated GGAA-motifs are present in the 5’-upstream regions of the BRCA1, FANCD2, and ATM, which have bi-directional partner genes NBR2, CIDECP, and NPAT, respectively [11]. Although BRCA2, which encodes a tumor suppressor to repair double-strand DNA breaks [46, 47], has no bi-directional partner gene, the duplication of the GGAA-motif is present near its transcription start site (TSS) [11].

2.3. Apoptosis is executed by signals from mitochondria

Execution of apoptosis or programmed cell death is mediated by mitochondria in response to various stresses including DNA-damage and immunological stress signals [48, 49]. Previously, we reviewed the roles of the ETS family proteins on apoptosis, and found the GGAA-duplications in the 5’-regulatory regions of the human PDCD1, DFFA, BCL2, FAS, and FASL genes [50]. The findings imply that expression of the apoptosis regulating factor-encoding genes is under the control of the duplicated GGAA-motifs. Previous studies revealed that mitochondrial functions closely associate with apoptosis [5, 48, 51]. For instance, it is one of its characteristics that cytochrome c is released from mitochondria during induction of DNA-damage signals, and that apoptosis regulator proteins BAX and BCL2 localize in mitochondria [48]. Our in silico surveillance of the human genomic data base retrieved several interesting examples of duplicated GGAA-containing bidirectional promoters, including ATG12/AP3S1, APOPT1/BAG5, and HTRA2/AUP1 gene pairs [12]. The ATG12 and HTRA2 genes encode an autophagy protein that takes a part in the quality control after mitochondrial damage [52, 53] and a serine protease that is localized in mitochondria [54], respectively. Importantly, with assistance of tumor suppressors, such as p53, RB1 and BRCA1, ATG12 and HTRA2 may contribute to determine cell fate between DNA-repair and cell death after excess cellular stresses.

2.4. Identification of duplicated GGAA (TTCC) motifs in the 5’-upstream of the human genes encoding DNA repair factors and apoptosis regulators

We have reported that duplications of the GGAA-motif are found in the 5’-regulatory regions of the human TP53 and RB1 genes [11]. Moreover, we have found the DNA sequence 5’-CAATAGGAACCGCCGCCGTTGTTCCCGTC-3’ near the TSS of the human E2F1 gene. These lines of evidences imply that tumors could be generated from mitochondrial dysfunctions when p53 and RB proteins lose their intrinsic biological functions as tumor suppressors, and that expression of their encoding genes are under the control of GGAA-motif binding TFs.

We have also identified GGAA-motif duplications in the 5’-upstream of the APEX1 gene, which has a bidirectional partner gene OSGEP [11]. The APEX1 encodes apurinic/apyrimidinic endonuclease 1 (APE1) that regulates both base excision repair and mitochondrial DNA-repair systems [7, 55]. It is noteworthy that APE1 interacts with XRCC1, which is recruited to the poly(ADP-ribosyl)ated site [56]. APE1 does not only function as a regulator of the base excision repair system, but also as a redox regulator [57]. The GGAA-duplication is contained in the regulatory region of the head-head configured ACO2/PHF5A genes [12]. The ACO2 encodes aconitase that functions in the TCA cycle to produce citrate and isocitrate and also serves as a mitochondrial redox-sensor [58]. More importantly, a recent study revealed that aconitase and mitochondrial base excision repair enzyme OGG1 (8-oxoguanine DNA glycosylase) cooperatively preserve mitochondrial DNA integrity [59]. Additionally, it has been shown that Cockayne syndrome (CS) proteins CSA and CSB, which play roles in nucleotide excision repair, accumulate in mitochondria upon oxidative stress [60]. A putative ETS1 binding motif is located, though no obvious duplication of the GGAA-motif is present near TSS of the ERCC8 (CSA) gene. Interestingly, it has a bidirectional partner NDUFAF2 that encodes one of the components of the NADH dehydrogenase (ubiquinone) [12]. The observation implies that not only GGAA-motif-duplication, but also another cis-element may take part in supporting transcription from a bi-directional promoter.

Collectively, our in silico analysis of the 5’-upstream regions of human genes suggested that transcription of a large numbers of DNA-repair/apoptosis/mitochondrial function associated genes could be regulated by duplicated GGAA-motif-containing promoters.

2.5. DNA-repair and immune responses

It should be noted that duplicated GGAA (TTCC) motifs are frequently contained in numbers of 5’-upstream region of the human interferon (IFN) stimulated genes (ISGs) [61]. BRCA1 has been reported to regulate IFN-gamma signaling by inducing IRF7 gene expression [62]. MRE11, which is a double-stranded DNA break sensor with Rad50, is required for activation of stimulator of IFN genes, STING [63]. These lines of evidences imply that response to IFN should be co-regulated in accordance with DNA repair system when damage was introduced in chromosomal DNAs. Conversely, IFN signaling affects expression of genes encoding DNA repair factors. Recent studies revealed that immune system is closely associated with DNA-repair system. It has been reported that transcription of the FANCF gene is up-regulated by IRF8 during differentiation of myeloid cells [64]. Moreover, IRF1 has been shown to regulate BRIP1 (FANCJ) gene expression [65]. IL-4 decreases DNA damage in murine and human glioblastoma cells when PARP-dependent DNA-repair is required [66]. Over expression of the IFN-related genes are caused by treatment with DNA-damaging agents and following ionizing radiation [67]. Interestingly, this over expression is enhanced in the BRCA2 knockout cells.

Integration of viruses into chromosomes might be damage on DNAs because exogenous DNAs will cause disruption of genes or enhancer insertions. Therefore, DNA repair system should be immediately evoked upon viral infection. Hence, immune sensing is primarily required to anti-viral immunity. It was indicated that oxidized base 8-hydroxyguanosine (8-OHG) potentiates cytosolic immune recognition by decreasing its susceptibility to TREX1-mediated degradation [68]. TREX1, which is also known as DNase III, is a 3’ exonuclease that is thought to play an important role in HIV-1 DNA sensing and viral immune evasion [69]. Interestingly, TP53 gene expression is induced by type-I IFN signaling in CD4+ T cells upon infection of HIV-1 [70]. Importantly, the concept has been postulated that DNA damage response affects innate immune sensors that drive metabolism, apoptosis, cancer, and aging [14].

Overall, the DNA repair system, including DNA damage sensing, and IFN response are thought to depend on and regulate each other. Previously, we identified duplicated GGAA (TTCC) motifs in a number of DNA repair associated genes, including TP53, RB1, and BRCA1 [11]. In order to examine if GGAA (TTCC) duplication is a common feature of the 5’-upstream region of the DNA repair associated genes, we proceeded to re-survey of the data base of the human genomic DNA.

Advertisement

3. Comprehensive analysis of the DNA repair-associated gene promoter regions

First, we retrieved 568 gene IDs from NCBI_GENE data base (http://www.ncbi.nlm.nih.gov/gene/) with a key word “DNA repair” on July 20, 2014. Then, we accessed to their individual sequence data and searched GGAA or TTCC motifs within a region between approximately 540 nucleotides upstream and 90 nucleotides downstream from the putative TSSs. At least one duplicated GGAA (TTCC) motif is contained in the 630 nucleotide region of 358 different genes (Table 1). Our defined GGAA (TTCC) duplications, with no more than ten nucleotide distance between GGAA (TTCC) sequence pairs, are not found in the remaining 210 genes (not shown). These genes, whose putative promoter regions contain duplicated GGAA motifs, could be classified into several groups according to the biological functions of the encoded proteins.

Gene-Partner gene Sequence
ABL1 CGGCAGGAAATTTGTTGGAAGATGA, GTGACTTCCACAGGAAAAGTT
ACTL6A CTACCTTCCCCTACCCGGGTTCCCGCCG, GCTTCTTCCAGCCTTCCTCCTT, TCGCTTTCCTCTTTCCCGCCC
ADH5-LOC100506113 TGAAATTCCCGTTCCCTCACC, CACGGGGAAGCCCTTTCCCGACA
ADPRHL2(ARH3)-TEKT2 GATGGGGAACACTATTCCTCCGA, CGGACGGAAGTAGGGAAACTGT
AKAP9 GAGTGGGAACCAGTGGAGGGAAGAGGG, CCACCGGAACTTTTCCGTTGG
ALKBH1-SLIRP GCCCCGGAAAAAATTTCCGGATCCGGAACACGA, CTTTCGGAAACTTTTCCGCTTC
ALKBH4-LRWD1 CGACCGGAAGGAAGCGGAACCCAG
ALKBH6-LOC101927572 AGACGGGAAAGGAAGTGCTTCCTTCAG
ALPK2 AGTTTTTCCTTTCCTAAGG, TCTTCTTCCAGAACTTCCCCGGGCATGGAATTTCCCCTCTTAGGAAGAGAT
ANKRD26 GACATGGAAGGGGAATAAAC, AGATTGGAAACCGCGGAGTTTCCTTTGG
APC AGGATTTCCCGGAAGAGGT
APEX1-OSGEP CAGCTTTCCGGAGCGCAGAGGAAGCTGG, CACTGGGAAAGACACCGCGGAACTCCC, CCGTTTTCCTATCTCTTTCCCGTGG
APITD1 CGCAGTTCCTGTTCCACTCG
APOBEC3B CACACTTCCTTCCCCACT, GGAGGTTCCTCTGCCAGCGGGAAGGGTCCGGGGAAAACCA
APOBEC3G AAGCAGGAAGGAAAGAGC
AR AGGTATTCCTATCGTCCTTTTCCTCCCTC, GGGAGGGAAAAGGAGGTGGGAAGGCAAG
ASCC3 TAATAGGAATTATTTCCTCCAC
ASF1A AAAGTTTCCGAGTCCATTCCGGGAG
ASTE1-NEK11 ATCACGGAACTGTACTTCCCAGAG, GAGACTTCCGATTCCCGCTC
ATF2 TGCTGGGAAGTGACGGAAACGGA
ATF3 TACTAGGAAAGGAATCTGT
ATF4 TCGCCGGAAAACGACCTTTCCCCGCC
ATM-NPAT AAAGCTTCCCTACCAAGGGAAAACCT, CAGCAGGAACCACAATAAGGAACAAGA, CCTTCGGAACTGTCGTCACTTCCGTCCT
ATR CGGTGGGAACGTGAGGAACTTTT, ACGGCTTCCCGGCTTCCCCCGG
ATRIP CATCATTCCTCCTTGGACTTTCCTCCTC
ATRX TTGGTTTCCTCATCTGGAAAATGT
AURKB CTGGGGGAATTTGGGGAAACTTTCCTAAACTGGAAGCCAA, TCTCATTCCGCCTCTTCCATTGGGTTCCCATGA
BACH2 TGCCCTTCCGGGAAAACGC
BARD1-LOC101928103 GCAGCTTCCCTGTGGTTTCCCGAGGCTTCCTTGCTTCCCGCTC
BCCIP-UROS CTACGGGAAGGGGAGGGGAAGCTTT, GAGGGTGGAAAGCGGAAGAAAA, GCCGTGGAAAGTGGGGTTCCGCAGC, GACGAGGAAGAGGAAAAAGA
BCL2 TTTTAGGAAAAGAGGGAAAAAAT
BCR-BCRP8 AAGTGTTCCTGTTCCAGGAC
BLM CCGGGTTCCAGCTGCCTACTTCCTTTAA, TCGGCTTCCCCAGGAAGCAGCCAATCGGAATAGGCAAGCTTCCGGCGGGAAGTGAG
BRCA1-NBR2 ATGCTGGAAATAATTATTTCCCTCCA, AATTCTTCCTCTTCCGTCTCTTTCCTTTTA, TTGGTTTCCGTGGCAACGGAAAAGCGCGGGAATTACA
BRCA2(FANCD1) GACAAGGAATTTCCTTTCG
BRE-RBKS TCTTCTTCCTGGAATAGTC, GCTGAGGAAGGAACTGTC
BRIP1 (FANCJ) GATACTTCCTTTCCGCTGG, GAGACTTCCAGTTTCCAAGGAATTTGC
BTG2-LINC01136 CCACGGGAAGGGAACCGAC
C17orf70 CCCGCTTCCCCACCCTGGGGAACCCGT
C19orf60 CTTGGTTCCCCTTTCTTCCTTCTG
CAGE1-RIOK1 GCGATGGAAAGGAACGGCT
CCNF GCGGCGGAAGGGAAGGCCG
CCNO CTGGCGGAAGGAAGGGCA
CDC20 CAAGCTTCCCAATTCCGTCCC, TCTCCTTCCCCTTCTAGGAACGGCT, AGACTTTCCCCGGAAGGCCC
CDC25 GCCTCTTCCCACTAGGTTCCATCAT, GGAGGGGAAAGAGGGAAGGAGG
CDK1 TTTTTGGAATCTGGAATATTAGGAATCAAC
CDK2-PMEL CGAGATTCCCGGCTTCCTGGTTTCCAAAGG, GCCAGGGAAACGCGGGAAGCAGG
CDK5-SLC4A2 CCCATTTCCGCTGCATTCTGGAACGCGT, AAACTGGAAAAGATTGGGGAAGGTAATGGAATCTCG
CDK5RAP2 GGTTAGGAACTTTGAGGATTCCTGAGT, CTCGTTTCCGTAGGAAGAAGCGCCGGGAAAGATG
CDK6-LOC101927497 TGTGTTTCCTTGGAATCGGC
CDKN1A(p21) CATTGTTCCCAGCACTTCCTCTCCCTTCCTAGGC, CCTGCTTCCCAGGAACATGC
CDKN2A(p16)-CDKN2AAS1 AGCCAGGAATAAAATAAGGGGAATAGGG
CEP63-ANAPC13 AAGCGGGAAAGCCTTGTTCCTTGCT, CGATGGGAATAGGGGGAAGTCCG, TCGCTTTCCTCGGATTCCCGGAT
CFL1 GAGATTTCCTTGTACCTTTCCCCTGTGCCTTTTCCTCCTA, AGCGGTTCCTGGGAAATTGG
CHAF1A TGGGAGGAATGGAAGTCAC
CHAF1B ATAAATTCCGGCCGGGATTCCGACCC
CHD1L-PRKAB2 GTGGGTTCCTTATAGGGAATAAGA
CHEK1 TTTTTTTCCTACGGAATCATG, TCGCCTTCCCAAAGTGCTGGAATTACA, CTTATTTCCATTTTTCCTATTT
CINP-TECPR2 ATCGG
TTCCTTTCCCGGGG
CLOCK CGGCAGGAAGCTCTTCTTCCTCCTC
CLSPN CCACGGGAACCTTGGAATTCCTCTAA, GCCCAGGAACCGTTTCCCAGCTCACTTCCCCCCG
CLU CTGATTTCCTAACTGGGAAGGCTC, GGCTCTTCCCTACTGGAAGCGCC
COCH AAGTAGGAACTCTTTCCACGAG
COL6A6 GTCCGTTCCACGGTTCCGAGGT, TGCATGGAAGTTTCCCCAAG
COPS5 CCTTCTTCCGGTGCGGAAGACTA
CPT2 GAGTTGGAAGGAATCTTG, TGACAGGAAGCCTCTTCCAATAG, AACACGGAAGACTTCCTAGAG, GGGGATTCCGCTCGGAAGGGGC, CAGCGGGAAACTCCAGGTTTCCAACTC
CRY1 AAAAATTCCAGGAAGTCCAGGAATGCCT, CTGAAGGAAACCGGACAATTTCCAGGCC
CSNK1D CGCGAGGAACTCACCTGGCTTCCTCGAC
CSNK1E TCCCAGGAACTGTGCTTCCGGGAT
CUL4A ATCCATTCCCTATATTTCCTATCC
DCK ACTCCGGAACCTCTTCCCGCGC
DCLRE1A-NHLRC2 CAGCGGGAACTTGTTCCCGCCA
DCLRE1B TCCAGTTCCAGCCTTAATTCCCCCTC
DCLRE1C-MEIG1 TAAACGGAAGAGGGAATTAATAGTTCCTGAAT, AAGCAGGAAGCGGAACGAAG, TCGATTTCCCTTCCCGCGA
DDB1-DAK AGTCCTTCCCGTTCCCAAAGGAGGAACAGCCC
DDX1 GAGGATTCCTCATTTACTTTCCCCATC
DDX11-DDX11AS1 GAGCGGGAAAACATTCCGGAAGTGGA
DEK ATCTTTTCCAGGAAGCGACCGTGGAAACAAT, CGTCCTTCCGTTCCGCGCT, CCGCATTCCCGCTCTCCTTCCCGAAC
DHFR-MSH3 GGCTCTTCCCACCTTCCCCTTC
DNTT GATCTGGAAAACATAGTTCCAAGTG, GATGCTTCCCTACCTTCCTCACG
EGF GGGATTTCCCTTTGATTTGGAAAGAAT, CCTGCTTTCCTGTGTGGAGGAATTGCC, TAGCTGGAACTTTCCATCAGTTCTTCCTTTCTTTTTCCTCTCT
EGFR AGAAGGGAAAGGGGGAAGGGGA, TGCTGGGAACGCCCCTCTCGGAAATTAA
EGR1 AGGGCTTCCTGCTTCCCATAT
EIF2AK3 TTGTAGGAAAGGTATTCCGGGAACTGAT, CACCAGGGAAAGTCCACCTTCCCCAAC
EIF3A GCTCCTTCCTTTCCGTCTC
EME2-MRPL34 CGGCCGGAAGTCACCGGAAGAGGC, CGGCCGGAAGCGAGGAAGAGGT
ENDOV-LOC100294362 GGGTGGGAAGTGCGGCCCGGGAAAGCGC, GTCGCTTCCGGAAGTGACGTGCGGAAGGGGT, CCAGTTTCCGGCGCGGAAGCGGA
ENG TCTAAGGAAGCGCATTTCCTGCCT
EPC1 TTTTTTTCCCAAGGAATTAAA
EPC2 GGAGGGGAAGGGAGAGGAAGGAGG
ERBB2-PGAP3 GAAGCTTCCACTTCCGGAGTAACCGGAAGTTCCTGTGT
ERCC1 AATTCGGAATTTTCCGAGAA
ERCC2(XPD) GCTCTTTCCCTTCCATGTT
ERCC3(XPB) GGAGCTTCCGGATTGAGCCGGAAGTCCC
ERCC4(FANCQ) CTTACTTCCCCTTCCCTTGC
ERCC6L2-LINC00476 CAGAGGGAAGAGACATCGGGAAGATTG
ERN1 GTTCATTCCAAGCGGAAGTGAT, TGAGGGGAATTCCTGAGGGCAAGGAAAAGGAAGAAAG
EWSR1-RHBDD3 CGGACGGAACCATTCCAAACA
EYA1 CTTTTGGAAGAACCGGTTCCTCAGC
EYA3 ATGTCTTCCAAAACTTCCCACTC, CTTACTTCCGGTTCCTAGCG
EYA4 GAGAGTTCCAG
GCAATTCCGGGGG, GGCCGTTCCCGGCTTCCGCGCAA
AACTTCCATCCT, GAGGGGGAAAGAGCTGCGGGAAAAGCC
FANCA AGTCTGGAATTCCTGGGC, AGTCATTCCCGGCAGGAACCACG
FANCB-MOSPD2 GAGTCTTCCCTTCCCAGGA, GAGAGGGAAGGAAGCGGG
FANCC TCGTCGGAATTTTCCCGCGA, CCGCGGGAAAATTCCAAAAA
FANCD2-CIDECP CGGCCTTCCACTTCCGGCGCGGAAGTTGG
FANCE CCTCCTTCCCTTTCCGACAGCGCGGGAACGGCT
FANCF GATATTTCCAAAGCGAAAGGAAGCGCG, CGTGGTTCCGGAAATTCT
FANCG TCGGTGGAAGCGGGAACCCAG
FANCI CTGCCTTCCAGGCTTTTCCAGTGC
FANCL TTCATTTCCGCCCGCGGAATCCTC
FANCM TCATTGGAAACGGAACTTAA, AATCATTCCCAACGGAAACTCA
FBXO6 CATAAGGAAGGAACTAGT
FEN1-TMEM258 GGGGCTTCCCCCTTCCCCACC, CAACCGGAAAAG
GAAGTGCC
FGF10 AATTCGGAAAGCGGGAAGATAC
FNDC4 GAGGTGGAATTCCTCTTCCCAACT, GGCTCTTCCACGCGGGGAGGAAGGGGA
FOXM1 ACGATTTCCCCCAGTGAGGAAATCAA
FOXO3 CTCGTGGAAGGGAGGAGGAGGAATGTGGAAGGTGG
FUS CCACAGGAATCTCGGTTCCACCCC
GLB1 TGCAGTTCCAAAGGGTCCCTTCCCAGGGAAGACGC
GSTP1 GCAATTTCCTTTCCTCTAA, CTTAGGGAATTTCCCCCCG, ACCTGGGAAAGAGGGAAAGGCTTCCCCGGC
GTF2H1-HPS5 TCGCGTTCCTCCCCTTCCTTGCT, GGGAGGGAACTAGCGGAAGGTGT
GTF2H2 GTGAATTCCAGCTGGAACACCGTCCCTTTCCGCGCC, GCGGCGGAATGACTTCCGGGGC
GTF2H3-EIF2B1 CCCACTTCCGGCGCACTTCCGTACCCCTCTTCCGGCGC
GZMA AGTGGGGAAGGAAAATCC
H2AFX TGGTCTTCCGCTTCTGGTTTCCGATTG
HERC2 GGTGTTTCCTTCTTCGATTCCCTGCA, GTGGCGGAAATCCCGCCTTCCGGCGC
HELQ-MRPS18C CATGGTTCCGCGTTTCTTCCACTTCCTTTCGTTCCAAATCGTTCCGAAAGGCCCCTTCCGCTGCTCTTCCCCTGT
HINFP CACTGTTCCCGCCCCTTCCGTGTT
HLTF-HLTFAS1 ATAAAGGAAGGTCGTTTCCCTCCG
HMGB2 GGGCTTTCCTTCCCGAGC
HNRNPC CAATAGGAAGATTCTCAGGAATGGGG
HSPA1A-HSPA1L ACCCTGGAATATTCCCGACC
HSD17B6-PRIM1 CCACAGGAATTGGCGGGAACAGCA, CGCCGGGAATTGTAGTTCCCACTT, GTCCATTCCAGGAAGAGGA
HTATIP2 AGAAAGGAATCAAAGGAATCCTG, GTGAGGGAAAACGCGGGAAGAGGG, GCAGATTCCAAACTTAGGAAGGGTC
HUS1B GGAGTGGAAACGGAAGCATT
HUWE1 TCATGTTCCCTTCCGCGGCTTCCACCGT
IER3 TCGTCGGAATTTCCAGCCC
IGF1 AAATGTTCCCCCAGCTGTTTCCTGTCT
IGF1R TGAGCGGAAAAAAAAAGGGAAAAAAC
IGFBP3 GCCGCTTCCTGCCTGGATTCCACAGC
IGHMBP2-MRPL21 CGGCCGGAAACGGAAACGAC
IL18 TGGGAGGAAGGGGAAGTCCT, TCGACTTCCATTGCCCTAGGAAAGAGC
INO80B GGACCGGAACGTTCGTTGGAAGGATC, AGTTTTTCCGCGGGGCGGAAAAGGC
INO80C ACCTTTTCCGCGTGGGAAGGCAG
INO80E-HIRIP3 AGTCAGGAACGGCGCTTTCCAGCGT, ATACCGGAATCTGAAGCGGAAGCTCAAGTTCCTCATC
IPO4 GGGCATTCCTTCCCCAGA, GCCCTTTCCTCCGGAAGTGGG
IPPK AGGCCGGAAGCTTCTCTTCCGGCTC, CCGCGTTCCGGAAATGAG
IRS1 TAAATTTCCTGGGGGAAACAGC
JMY GGGCTTTCCTCAGACACCTTCCTTTCA, CTCAGTTCCTCCGCCTTAGTTCCTCTTTTCCCGGGT, TGCGCGGAAGGAAGGAGA
KAT5 AGCTAGGAATCTTCCCTGAG
KDM4A GCAGCTTCCCTTCCCTGTT
KIAA0101-TRIP4 CCATCTTCCCCAGCCGGAACCAGC,
KIF2C GAAGTTTCCCAGTTTTCGGGAACCCCG, GCGTAGGAAGATGGTTGGGAACTGCG
KIF13B TGGCAGGAAATGAGCAGGAAGAGGT
KIF22 GACTGGGAACCGGAACCGTG
KIN-ATP5C1 CCCGGTTCCGTTTCCGGCTG
KLF8 CTCCGTTCCTTTTAGCTTCCTCCCT
KRAS CCCTCTTCCCTCTTCCCACAC
LCT ACATTTTCCGGGTTCCTCTGC
LMNA-MEX3A TTTCTTTCCATTATTCCAGATA, GTGGTGGAAGGGAAAAGAG
LIG1-C19orf68 GGCGCTTCCACCGATTCCTCCTCTTTCCCTGCC
LRRCC1 AATGTTTCCAGGAACAAGA, TTTTCTTCCTCATACAGGGAAGTGAC, AGGCGGGAAAGTTCCCGGCT
MAD2L1 TCTCGGGAAAAGCTGCGTTCCCACAC
MAD2L2-DRAXIN GGACTGGAAGGAAGGGGG
MCM8-TRMT6 GCCGCTTCCGCTTTCCGGCCC, ACCGCTTCCGGAAGCCTCTCGGCTTCCGTCTG, CTTCTGGAAGCTGCGGTGGGGAAACTGAGTTTCCCGAGC
MCRS1 TCGTGGGAATTTGGAAGTCGA, AACTAGGAAAGCCTTTACTTTCCGCTAT
MDC1 ACGTATTCCCAGGAAGAAAG, CAAAAGGAAATGAAATTCCAATGC
MGRN1 CGCTTGGAACGCAGAGGGAAGGACC, GTTGGTTCCTTCCCTCTG, TCCTGGGAAAGATAGTTCCCAGACGGGCTTCCCGCGCTGCTTCCCGGCG
MIR96 ACGTCGGAAACAGGCTGCTTCCAAGGG
MMS22L GTGCTTTCCAAGTTTTCCATATC
MNAT1 TCATGGGAATGTTTCCAGACA, AAGATGGAATTTATCTTCCTAATT, CCGGGGGAACTGACTGCCGGAACGTTT
MORF4L2 ATTTTTTCCTAGGAATGAAC
MPG GGCTGTTCCCACAGGAAGGAGA
MPLKIP-SUGCT GTAGCGGAAGCAGCTTCCGGGGAACCCCG
MRE11A-ANKRD49 GCAGGTTCCCAGGCGGAAGCCCA
MSH3-DHFR GATTCTTCCAGTCTACGGGAAGCCTG
MSH6 CGCTGTTCCCGCTTCCGCTCC
MSL1 CCGCTTTCCCCTTCTTCCCGCGG
MYB GTGCGGGAATTTCCCCCCA
MYO5A CCCTAGGAATGCTTGGAAGGACG
NABP2-RNF41 TCCCGGGAAGGGAAGGGAAAGGGGAAGGAGGGGAAAGAAG
NBN(NBS1) GGTTGGGAAGCTACTGGAATTAGG, CAGGTGGAAGTGGAAAGGAAGGGTA, CTAGATTCCAAAGGAATACCT, TGCTGTTCCTTTTCCAACCA
NCOR2 GGCGCTTCCCCCCTCCTTCCTCCTC
NDNL2 TGCACGGAAAACGCTGTTCCTTTTGG
NEIL1 GGCGGTTCCTTCCGCCGG
NEIL2 CCACTTTCCAGGGAATGAGC
NES CCTGGGGAAGCAGGAACAGAG
NFRKB(INO80G) GGACGGGAAGGAGGAATGAAGGAACTCGGAAGCACA
NIPBL-LOC646719 GTGGCGGAAGTGGAGTGGGGAAGAGGG
NLRP11-NLRP4 CGGCTGGAAGCGGGAAGAAAA, GGAGGTTCCTATTGAGAATTCCCAGGG
NONO TCCCCTTCCTCTCCCTCTTTCCACTTTCCTCTCC
NPAS2 GCAGATTCCTTGTTCCCCCCG
NPM1 CATCTTTCCTTCCTAACA
NR2C2 CGCTGGGAAGAGGAAGAAGA
NSMCE1 CTCAGTTCCACAGATGGGGAAACTGA, CAAGTGGAAGCCCCTTCCCATTA
NSMCE4A CGAACTTCCGCCGTTCCGAAGT
NUDT1-FTSJ2 CCCGGGGAACTGCGACCCGGAATCCTG
NUPR1 ATCCCTTCCCCCTCCTTCCTCACG
OFD1 TAAATGGAATCACTAATGAGGAAAGGCA
OTUB2 TACCCTTCCTGGATTCCAGAAA
PALB2(FANCN)-DCTN5 AGAGATTCCGGCTACTTCCGGCCG
PARG-TIMM23B GCCGCTTCCCCCGCCTCCTTCCATGGT, TGACATTCCGGGCGCCGGTTCCCGTTA, GCCCCGGAAGCCGGAAGCGCC, CAGCTTTCCGGTGGTGGGAAAGTGA
PARP1 GCGGGTTCCGTGGGCGTTCCCGCGG
PARP2-RPPH1 CCCCCTTCCCCTTCCAGCTC
PARP4 CCTGTTTCCACGAACTTTCCCGAAA, CCCGATTCCGGGCGCGTTCCGGCTA
PARPBP-NUP37 AAGTGGGAAGGAAGAACTCCTGGGAATAGAG
PDE4DIP TCAAGGGAAAATTGAAAGGAAAAGATTTTAGGAAAGAGA,
PIWIL2-LOC100507071 CACAGGGAACCTGCTGGAAAGGAC
PMS2-AIMP2 TGGAGGGAACTTTCCCAGTC, CGGCATTCCAACCTCCCTGGAAATGGGGGGAACATGG
PNKP AGATGGGAAAAAAATCTTCCTCCCT, GTCATTTCCGTCCGCCGAGGAACCGAC
POLA1 TCGCTTTCCCGGCTCTGGGGAAAACGA, CTCCTTTCCGGGAAAATGG, TGGCCTTCCGGCCGGAAGTCCG
POLB CCCGTTTCCCCTTCTAGGGAAAGGATTCCAGATA, AGGTCTTCCCATAGGAAGGCCC
POLD1 GGCGGGGAACAGCGGAAGTGAG
POLD3 CCTCTGGAAAAACCTTCCCTAAT
POLD4 GCCTAGGAAGGGAAAACGGGAAGTGAG
POLG CTTCGTTCCTGAGGGAGGAATAAAC
POLH-XPO5 AGCCCTTCCATTTTCCTTCCAGTAG
POLI CAGGCGGAAGCGGCCGGAAGTAGC
POLL AACCGTTCCAGAGGGTCACTTCCGGCTGACTCGGAAGCTAT
POLM GGGGCTTCCTTCCGTCTC
POLQ CCCAATTCCTCATTACATATTCCTCACA
POLR2A-ZBTB4 GGGCGGGAAAGGAAGGGGC, ACCTTTTCCTTTTCCCTTCT, AAAATTTCCGGTAAGGGAAAGAAG, CTTATTTCCCCGCCTCCTTCCCTCCCCCACCTTCCCCTCC
POLR2B TTCTGGGAACGTCGGAGACGGAAGTTAC
POLR2F-C22orf23 CTCCCGGAAGTGATTTCCTCTGG, GCCGAGGAAGGGAAGGGCG
POLR2G AGTGTTTCCGGTGGATTCCCAGGG
POLR2I CCCCCTTCCGGGAACCCCC, GTCCCTTCCCCACCGCCAGGAAGAGGG
PPM1D CCTTTGGAAGGGAGGTTTCCCGCCA
PPP1R15A CTTACTTCCACTTCCCACCC
PPP5C AGAGAGGAAGGGAAGATTT
PRKDC(DNA-PKCS)-MCM4 ATCGAGGAACAAACTTGGAACTCTT, CGTTTTTCCTTAGGTTTCCATGTT, CCCCGGGAAAGTTCCTGCCG
PRMT8 GGCATGGAAAACCAGGAAGTTTC
PRPF19 TTCTGGGAAAGGGCAATTTCCGTTAG
RAD1-BRIX1 TTCACTTCCTCCGCGGTTCCTCGGA
RAD9B-VPS29 GTTTATTCCCTTTCCCTAGA, TTGCGGGAAACGAGTAGGAACCGTCTGGAAACGGA, CTCCCTTCCTTCCCTAGA, GGGATTTCCCAATTCCTCGCC
RAD17 CCAACGGAATTAACGTTCCGCGTC
RAD23A AACCCGGAAGGCGGAAGCTGC
RAD23B CGACATTCCAGGACCGCCTTCCGCCCC
RAD51AP1-C12orf4 TGGGAGGAAAACTAAGGGAAAAGAC
RAD51B AAAATTTCCAAACAGGGTGTTCCCTTGT, GCGTTTTCCGCGGGGAAACTGT
RAD51C(FANCO)-TEX14 TTTGGGGAATCAAAACGGAATGGTG
RAD51D ATCCGTTCCGTTTGGAACGGAAGCTGG, AGCCTGGAACCCGGAAGCGGC
RAD52-ERC1 GGTGAGGAACTGGGAAGCGGG, CCGTAGGAAGTGGACGCTGGAAGCCCG
RAD54L AAATCTTCCCTTCCATAGC, CACTATTCCCGCCTCTTCCTTGGG
RAF1 ATGGGGGAAAAATGAACTCGGAATTTAC
RASSF CACTGGGAAAAGCATGGAAAGACT, AGGAGGGAAGGAAGGGCAA
RB1-LINC00441 CAGGTTTCCCAGTTTAATTCCTCATG, CGGGCGGAAGTGACGTTTTCCCGCGG
RBBP8 TTTGATTCCATGTTCCACAGA
RBP14 CCCAGGGAATGTTTCCAAAGA
RECQL-GOLT1B ACGTCTTCCGGAAACACG
RECQL5-SAP30BP CCCGATTCCCCCTTCCAGCTT, CCGACTTCCGGGCGGAAAGGCA, AACAGTTCCGGAACCAGC
REV3L-TRAF3IP2 GTTCGGGAAGGGGGAACGCCA
REXO2 ACTCAGGAAATAACTCCTGGAAGCAAA
RFC2 GGGGTGGAATTCCCATCT
RFC5 AGGGAGGAAGTCGGAAACTGG
RHBDL2 GCCCAGGAAGCCTGGAACGCAA
RIF1 GGCAGGGAAGGGATGGGAAGGGATGGGAAGGGAG
RMI2 CCCATTTCCTCCGTTCATTCCTAACT
RNF2 AGAGTGGAAGGTCATTTTCCCAGGA
RNF4 CGGCTGGAAATCTAGGAATGGGAAGGTTC
RNF44 GTAAGGGAAGGCCCTCACTTTCCCCATC, CTTAGTTCCCAGTTTCCCTGGC, ACCTGTTCCCCGCCTCTCTTCCTCCAC
RNF113A GCTCCGGAAGAAGCGACGGAATCTGC
ROCK1 GCTTCGGAACTTTCCCAGTG, GCTGGTTCCCCTTCCGAGCG
RPA2 TTTGAGGAAGGAACTGAC
RPA3 TTTTCTTCCTCTTTGGAATTAAA
RPS3 CCCCTTTCCTGTTCCTGCCT, GCCACTTCCTTTCCTTTCA
RPM1 TTTTCTTCCAGTTCCAGAGT
RRM2B CCAGCGGAAGCAGGGAGATTTCCTTAGG
RTEL1 AAGCTGGAACGCAGGAGAGGAAGGAGA
RUNX1 ATTCTTTCCCTTTCCCAGGC, TGGAGGGAAGGAAGGGCA, GCTGTGGAAAGGGGAACAGTT
RUVBL1-EEFSEC ACCCGTTCCGGCCCGGAAGCTTCCGCCCT
SAMHD1 CCACTTTCCTTCCTCTGGGAATGCAG, AATCATTCCGGGTTCTTCCAGTTC, CTGTTTTCCTCTTCACTGGGAAGGTGC, GCTCTTTCCTCCCCCTTTCCACCAG
SAT1 CCTCTGGAAAATTCCATTGT
SERPINE1 CTGGGGGAAAACTTCCACGTT
SETMAR GTCAAGGAAGGGAAGCGCCTTCCAGGCC
SETX GGCCTTTCCCGCAGTGTTCCCCTGG
SF3B3-COG4 CGTGTGGAAGCAAGACGGAAGCATT
SFPQ CTGTATTCCTATGAGGTTCCATAAT
SFR1 CGAGAGGAAACTGGATTTCCAGTTT, CTCTCTTCCCCTTTGTAAATTCCTTGGG
SIRT1 CTTCAGGAAGACGTGGAAATTCCCAGGG
SLC30A9 CATCCTTCCCATCTTTCCTCCCATTTCCGAAAC, CCCCGGGAAGGAAGGCCT
SLX1A-BOLA2B GCCACTTCCGCTGGAAAACTCACTTCCGCCCT, GCGGCGGAACTCAGGGAAGGAGC
SLX4 (FANCP) GCAGAGGAAGACCGGAAGCGAG
SMAD3 CGTGTTTCCCAGGACTTCCTCCCC, GGACTTTCCTTCCCGGAG
SMARCB1 AGAGAGGAATGGAGAAGGTGGAAGGTGT
SMC1A-RIBC1 GGTCCTTCCAATTCCCGACC
SMC2 TCAAAGGAATAAATAGTTCCGGCGC
SMC3 CAGCATTCCATGTGTTCCAAGGC, GGCGCGGAACCTTTCCCCCTT
SMC4-IFT80 TCAAGTTCCAGGAAAGCGG, CTCCCTTCCTCTTCCCGCGA
SMC5-SMC5AS1 CGGTGGGAACGGAAGTCGC
SMG1 CTCCCTTCCCTTCCATCGT, GTGCTTTCCGGGAAGCGTT
SMO ACGATTTCCACTCATCTCTTTCCCCCGG
SMUG1 AGCATTTCCGGCGGAAGTGGC, GTGGGGGAAAGGAACCGGAAACGGG
SOX4 TCGGGTTCCAAGCCAATGGGAAGCCCG
SP1 CTGGTTTCCTTCCAAGCC
SPATA22 GATTCTTCCAGGAACAACA, GTCGAGGAATTCCCGGAAACCTC
SPIDR CCCGGGGAAGGAAGCTCG
SPTAN1 CCTCGGGAAAGTGAGCAGGAAGAGAC
SSRP1 ACGCGGGAAAAGCTTCCCCGGT
STAT3 GGACATTCCGGTCATCTTCCCTCCCT
STRA13 CCGGCTTCCGGAAGGTGA
STUB1 AACTCTTCCCGATACCTGAGGAAGGGCG
SUMO1 CCCATTTCCCGCCTTGTCTTTCCTCTCT
SUPT16H TTGTGGGAAGGAACTAAA, GCTCTTTCCGCTCCCCCTTCCTTTGC
SUZ12 TTTTTTTCCTCCCTCCTTCCCTCCT
SWI5 TCAGTTTCCCAAGACCTGTTCCACAGA, TCCCCTTCCAGCTGGAAATTTA, CTACATTCCACTCCTAGGGGGAACATCA
SYNE2 CAAGGGGAAGGAGGAACCCAG, CCTACTTCCAAGACCCAGGAATCTAC
TCEA1 ACGGGTTCCATTTTTCCCCGTA, CAAAGTTCCATGCTCGGAATCTGC
TDP1-EFCAB11 GGCAAGGAACGTGGGGCGAGTTCCTTTTC (11 nucleotide distance)
TDP2-ACOT13 ACTTCGGAAGAGCTGGAAAGTCC
TDRD3 TTTTGGGAAGACCAAACGGAATACCC, TCCCCTTCCTTCCGTAAC, TACCCTTCCGCCTGTTCCTCTCT
TERT TCCCCTTCCTTTCCGCGGC
TICRR AAGTTTTCCTCGGTCTTGGGAAACGTG, GCTGTTTCCCTGAAGGAAGGGAC
TIRAP CCTTTGGAAAAGTTCCATCTC
TK1 TAAGCTTCCTTCTTGGAATTCCAATCT, TCTTCTTCCAAGGAACCTTGCTTGGGAAACCCA
TONSL CGTACTTCCCGGAATGCCC
TOP2A TCAGTTTCCTCAGGAAAACGA, ACCCCTTCCCGCTTCCAAAGC, ATCTCTTCCAAGCTTTCCGCACG
TOPBP2 ATTGAGGAAATCCTTTCTTTCCCTGGC, GTCACTTCCACCGGAAAAGGC
TP53-WRAP53 TCCATTTCCTTTGCTTCCTCCGG
TP63 ATCAAGGAATTTCCCTGTC
TREX1 GCTTCTTCCAGAGGTTCCCCAAC, GCCGCGGAAAC
CGATGTGGAAGACCC
TREX2 CTCCCTTCCTTCCCCAGC
TRIM56 CTCCAGGAAGCCTGTGCTGTTCCCTCAG
TRIP12-FBXO36 GAGGGGGAATTAGTTCCTGCTA
TTC5 TTTGTTTCCAGGATCTGGGAAAGAAA
TYMS CCGCAGGAAAACGTGGGAACTGTG, CCAGGTTCCCGGGTTTCCTAAGA, CCGCGGGAAAAGGCGCGCGGAAGGGGT
UBA1 CCCAAGGAAGAATTTCCAGCAC, ACACGTTCCGTTTCCTCTTCCCACCC
UBA2 CGCCCTTCCCCCACCCGCTTCCGGCCG
UBB TGCAAGGAAGTTTCCAGAGC, ATATTTTCCTAAAGAAGGAAGAGAA
UBC-MIR5188 GTACAGGAAGGTGGAAGAACA, GGGGTTTCCGCCTCTTTTTTCCAAATT
UBE2B-CDKL3 CTTCAGGAAGCCCAGGGGGAACCGCG
UBE2T CTAACTTCCACTTGAACATTTCCAGTGATGAAGGAATTCAC, ACGATTTCCAGCTCCTTCCTTGGT
UBE2V1 GCGCCGGAAGGAATCCTG
UBE2V2 ACAAGGGAATTGCGGAAACAGC
UBE2W TGGTTGGAAACGAAATAGGAAAAAAA
UBR5 ATAATTTCCTTACTTTTCCAATAA
UHRF1 AGGCGGGAAAACGAGGCGGGAAAAGAC
UNG GGGCAGGAACTTTTCTTCCCAGCC
UPF1 GATGGGGAAACTGAGTTCCAAGCA
USF1 GAATGGGAATCAAGATTCCTGTCA, CTTCTTTCCTGGAATGAAA
USP1 GCGCGGGAACCCTGGGAAGCTCC
USP3 CACCCTTCCCGGGGCCGGGGAAGCGGC, GACTAGGAAAGTCACTTCGGAACACAG, GGCCTGGAAAGGCGGAAGCCTC
USP28 TGATGGGAAATCCTTTATTCCACGGT, GCAGTTTCCCACGGCGGGGGAACAGTT
USP47-LOC102724878 GAGAAGGAAGTTCCCTGGAAGAGGG
UVSSA AGACCGGAACTTCCTTTCG
VCP GAGAATTCCAATCCGTCGAGGAAGCGTA
VWA2 AAAAAGGAAATGGAAAACCT
WRN AGGTGGGAAGATGGGAATGAGG
WRNIP1-MYLK4 GGGCCGGAAGACGACCCCTTCCTTTCG
XIAP CATCCTTCCCTTCTTGGAAACAGA, CTTTCTTCCACTATTCCTCAAC
XPC-LSM3 CATTTTTCCTGAGTCTGGAAAAAGC, GCTCTTTCCTGCTTCCCGCAG
XRCC1 GCTAAGGAACGCAGCGCTCTTCCCGCTC
XRCC3-ZFYVE21 CGGCGGGAAGAGGAGTGCGGAACCCGC
XRCC4-TMEM167A GTTTTGGAAGATACCGGAAGTAGA
YBX1 CTCGTGGAAGTCACGTTCCTTCTG
ZC3HAV1(PARP13) GCTCTTTCCGGGAATGGGT
ZNF143-LOC644656 CCAATGGAAAACCGGAAGCGTC, ACGAAGGAATTGTTGGAAAATTT
ZNF668-ZNF646 GGGAGGGAAGGGAAAGAGGGAAAGGAG, AGGGGGGAAGAGGAAGGAGG, TACTAGGAAACAGGAAGTGTC, AAAGCTTCCCCGCGAAACTTCCGCTTC, TTAAAGGAAATGTTGTGGAATATAA
ZNRD1-ZNRD1AS1 TGGTGGGAAAATTTGCTGGAAGCGCAG, CCCCTGGAAAGGGTTCCAAGTC, GTCTGGGAATTCCGGGCG

Table 1.

GGAA motifs located in the 5’-upstream regions of human genes encoding DNA-repair associated factors. Duplicated GGAA (TTCC) motifs (bold) that are located between 540-bp upstream and 90-bp downstream of the putative transcription start sites (TSSs) of DNA repair-associated protein encoding genes are shown. Several of them have bidirectional partner genes. In that case, extra sequences containing both of the most upstream were surveyed. Nucleotide sequences contained in the 5’-upstream of the partner cDNAs are also included.

3.1. Classification of DNA repair genes whose upstream regions contain duplicated GGAA motifs

Numbers of genes (Table 1) encode proteins with multiple functions. However, they could be categorized into several groups as follows:

  1. Nucleotide excision repair (NER); ATR, CDKN1A, ERCC1, ERCC2(XPD), ERCC3(XPB), ERCC4 (XPF), GTF2H1, GTF2H2, GTF2H3, H2AFX, LIG1, PARP1, POLD1, POLD3, POLD4, RAD23A, RAD23B, RFC2, RFC5, RPA2, RPA3, UVSSA, XPC, XRCC1... NER is a DNA repair system that is executed with several functional proteins, which recognize a lesion to form TFIIH complex to excise the lesion introduced DNA chain and the gap is filled by DNA polymerases [71].

  2. Transcription coupled repair (TCR); APEX1, BRCA1, CDK1, CDK2, CDKN1A, CDKN2A, ERCC1, ERCC2, ERCC3, ERCC4, GSTP1, GTF2H1, GTF2H2, GTF2H3, LIG1, MRE11A, NBN, PARP1, POLD1, POLD3, POLD4, POLH, POLR2A, POLR2B, POLR2F, POLR2G, POLR2I, PRKDC, RFC2, RFC5, RPA2, RPA3, SP1, STAT3, TERT, TP53...TCR is thought to regulate genomic integrity. This process begins with unwinding the double stranded DNA by TFIIH, the next step is that the damaged strand is incised apart by XPF, XPG and endonucleases, then gap is filled and finally the nick is ligated [72].

  3. Fanconi anemia proteins; ATM, ATR, BRCA2 (FANCD1), BRIP (FANCJ), CHEK1, ERCC4(FANCQ), FANCA, FANCB, FANCC, FANCD2, FANCE, FANCF, FANCG, FANCI, FANCL, FANCM, NBN, PALB2 (FANCN), LMNA, RAD51C (FANCO), SLX4(FANCP)...Encoded proteins are involved in Fanconi anemia pathway that plays a part in the repair of inter strand cross links [73]. Notably, all genes that encode protein components in the Fanconi anemia core complex are listed in Table 1.

  4. Double strand break (DSB) repair, Non homologous end joining (NHEJ); APC, APEX1, ATM, ATR, BLM, BRCA1, BRCA2, CHEK1, DCLRE1A, DCLRE1B, DCLRE1C, DDX1, ERCC1, ERCC4, FEN1, LIG1, LMNA, MCM8, MRE11A, NBN, PARP1, RBBP8, POLA1, POLB, POLH, POLL, POLM, POLR2A, RAD51AP1, RAD51B, RAD51C, RAD51D, RAD52, RECQL, RECQL5, SP1, TERT, TP53, TREX2, XRCC4... DSBs are caused by stresses on chromosomal DNAs, such as irradiation of ultra violet or X-ray, and alkylating agents. Unrepaired DSBs will lead to collapse of stalled replication forks and in response to uncapped telomeres [74]. Some of the genes that encode protein components in the MRE11 complex are listed in Table 1. Not only serving as regulator of the mammalian DNA damage response, the MRE11 complex plays an important role in the maintenance of telomeres [75].

  5. Base excision repair (BER); APC, APEX1, BRCA1, BRCA2, CDKN1A, CHEK1, ERCC1, ERCC2, FEN1, LIG1, NBN, NEIL1, NEIL2, PARP1, PARP2, POLA1, POLB, POLD1, POLD3, POLD4, POLG, POLH, POLI, POLL, POLL, POLQ, RAD23B, RECQL5, RPA2, RPA3, RPS3, TP53, TREX1, UNG, WRN, XPC, XRCC... BER is a fundamental repair system to eliminate nucleotide-bases from mutated nucleotides that is recognized by AP endonucleases. FEN1 and Ligases fill the gap to ligate DNA ends [76, 77].

  6. Apoptosis; ABL1, APC, BARD1, BCL2, BCR, BLM, BRCA1, CNKN1A, CDKN2A, CHEK1, ERCC1, ERCC2, ERCC3, ERCC4, HMGB2, KRAS, LMNA, MRE11A, PARG, PARP1, PARP4, RAD23A, RAD23B, RAD51B, SIRT1, SUMO1, TERT, TOP2A, TP53, TP63, XIAP... Apoptosis or programmed cell death is executed by a number of proteins, including mitochondrial protein BCL2 and tumor suppressor p53 [48, 51]. It is thought to be an important process to eliminate cells with unrepairable DNA damage.

  7. Mitochondrial functions; ADPRHL2 (ARH3), APEX1, ATM, BARD1, BCL2, BRCA1, BTG2, CDKN1A, CDKN2A, ERBB2, FEN1, FOXO3, LMNA, PARG, POLG, SIRT1, STAT3, SUMO1, TERT, TP53, TP63, XIAP... Mitochondria and nuclei are communicating to regulate each other [6-9]. Several of the DNA repair factors, including p53 and BRCA1, have been shown to localize in mitochondria [78, 79]. It has been shown that mitochondrial matrix-associated proteins are poly(ADP-ribosyl)ated [80]. Poly(ADP-ribosyl)ation, which is catalyzed by PARP enzymes, is a modification of proteins utilizing NAD+ molecule as a substrate [81]. The NAD+/NADH ratio is thought to regulate mitochondrial metabolism. A recent study showed that decrease in NAD+/NADH ratio, which is thought to occur by an aberrances in mitochondria, does not only enhance cancer progression but also metastasis [82].

  8. Response to IFN; ABL1, BCL2, BCR, FOXO3, IL18, PARP1, PRKDC, RUNX1, RUVBL1, SAMHD1, SP1, STAT3, TERT, TP53, TREX1... Duplicated GGAA (TTCC) motifs are found in number of the 5’-upstream regions of the human Interferon Stimulated genes (ISGs) [61]. The observation suggests that expression of some of the DNA repair factor-encoding genes might be up-regulated by IFN-induced signals.

3.2. The GGAA (TTCC) motifs are often present in the 5’-flanking regions of the genes that encode protein modification factors

PARP enzymes and p53, which have multiple functions in DNA repair process, are thought to affect mitochondrial metabolism [29, 83]. We previously reported that 5’-upstream regions of many of the mitochondrial function associated genes contain duplicated GGAA (TTCC) motifs [12]. Therefore, mitochondrial function could be up-regulated when cells encounter with various stresses, including DNA damage, viral infections, or tumorigenesis. It is noteworthy that PARP enzymes consume NAD+ to synthesize poly(ADP-ribose)s on various target proteins, including p53 [18, 19]. Given that NAD+ is an essential molecule for energy metabolism, the ratio of inner cellular NAD+/NADH may keep balance of mitochondria/DNA repair system. SIRT1, which is known as a NAD+ dependent de-acetylating enzyme, is not only involved in controlling life spans of organisms but also DNA repair system with PARPs [84]. Besides affecting transcription by its de-acetylating activity, SIRT1 may indirectly contribute to regulate inner cellular acetyl-CoA level [85]. SIRT3, which localizes in mitochondria, catalyzes de-acetylation of acyl-CoA dehydrogenase and acetyl CoA synthase 2 [86-88]. It should be noted that SIRT3 gene is head-head configured with PSMD13 gene [89], and that the bidirectional promoter contains a sequence, 5’-ACTAGGGAACTTCCTCTAC-3’ [12]. It is important to remind that both the NAD+ and the acetyl-CoA are essential molecules in energy metabolism. Thus, GGAA-mediated transcription might be a biologically constitutional response to nutrition stress.

Not only the ubiquitin encoding genes, UBB and UBC, ubiquitin metabolism factor encoding genes, including UBE2B, UBE2T, UBE2V1, UBE2V2, UBE2W, UBR5, UHRF1, USP1, USP3, USP28, and USP47, are included in Table 1. Protein ubiquitination has been suggested to regulate DNA repair [90]. Notably, SUMOylation, which is a modification of proteins with Small Ubiquitin-like Modifier [91], plays an important role in DNA repair [92, 93]. The duplicated GGAA motif is also present in the SUMO1 promoter [50]. Furthermore, UBA1, whose encoding gene is listed in Table 1, is a SUMO1 activating enzyme [94].

3.3. Possible roles of the duplicated GGAA motif in the 5’-upstream regions of DNA-repair genes

Genome wide analysis of the human promoters revealed that c-ETS binding element is frequently found with another c-ETS binding element [95, 96]. Redundant occupation of the duplicated GGAA motifs by Ets family proteins seems to be a complicated system, but this would enable finely tuned regulation of each promoter through altering composition of Ets family or GGAA-binding proteins, including GABP and STATs, in the nucleus in response to cellular signals [95].

Advertisement

4. Bidirectional promoters that regulate DNA repair factor-encoding genes

From the surveillance of the human DNA data base, not only mitochondrial function associated genes but also DNA repair factor encoding genes have head-head oriented partner genes [12]. Recent studies on RNA sequencing revealed a wide variety of transcripts, and the human DNA data base is continuously updated. Therefore, numbers of known bidirectional promoters are increasing day by day. As the reason why so many genes have bidirectional partners has not yet been elucidated, there is great value in investigating the role of bidirectional promoters driving transcription of DNA-repair factor encoding genes.

4.1. Surveillance of the bidirectional promoters from human genomic database

We have reported that a lot of human mitochondrial function associated genes have a bidirectional partner [12]. Moreover, several DNA repair associated genes are head-head configured with another gene [11]. Re-surveillance of DNA repair factor-encoding genes revealed that a number of the genes have opposite direction transcribed partner genes, utilizing the same regulatory region as their common promoter (Table 1). Although the number of the bidirectional gene pair is increasing according to recent findings of transcripts with next generation sequencing, at least 95 gene pairs were identified from the surveillance of the 358 DNA repair associated genes whose promoter contains GGAA (TTCC) motifs. The observation suggests that duplicated GGAA (TTCC) motifs and the binding factors may play a part in the bidirectional transcription of both mitochondrial function- and DNA repair-associated genes. However, these genes are not always simply controlled by GGAA-motif alone. For example, Sp1 binding element or GC-box is co-localized with ETS binding motifs in human promoters with 28.4% occurrence [95]. Co-operation of the GABP binding motif with Sp1/3 and YY1 binding sites is required for murine Gabpa-Atp5j bidirectional promoter [97]. These observations suggest that another cis-element, such as GC-box, may play a role in the co-operative transcription.

4.2. Biological relevance of bidirectional transcription

It has been reported that many cancer or DNA repair associated genes have bidirectional partner genes, and that tandem repeated ETS binding sites are frequently found in the 5’-upstream regions of both genes [98-101]. Therefore, expression of many DNA repair factor encoding genes is thought to be regulated by TFs that bind to GGAA motifs.

Surveillance of the human genomic sequence database revealed that several ISGs have bidirectional partner genes [61]. Similar to the bidirectional promoters involved with DNA repair factor encoding genes, bidirectional ISG promoters contain duplicated GGAA motifs. They are BAG1-CHMP5, BLZF1-NME7, EIF3L-ANKRP54, CCDC75-HEART5B, IFI27L1-DDX24, PARP10-PLEC, PSMA2-MRPL32, RPL22-RNF207, and TRADD-FBXL8 [61]. It is noteworthy that the bidirectional gene pair HSPD1-HSPE1, which encodes the mitochondrial chaperon proteins HSP60 and HSP10, respectively, has been reported to be regulated by IFN gamma [102]. These findings suggest that promoters of the DNA-repair and mitochondrial function associated genes that carry duplicated GGAA-motifs could be simultaneously regulated by IFN-induced signals.

Advertisement

5. Cellular senescence and cancer generation might be simultaneously regulated at transcriptional level

Introduction of several transcription factors (OSKM or Yamanaka factors) into somatic cells could reprogram and generate induced pluripotent stem (iPS) cells [103]. Recently, it was demonstrated that three transcription factors, Blimp1, Prdm14, and Tfap2c, direct epiblast-like cells into primordial germ cells [104]. Moreover, transcription factor C/EBPα enhances effects of the OSKM factors to reprogram B cells [105]. These lines of evidences imply that the transcriptional profile determines cell fate towards proliferation, cell cycle arrest, differentiation, senescence or programmed cell death. Furthermore, it has been postulated that nutrient or metabolite state may contribute to affecting the balance between quiescence and proliferation of stem cells [106]. In this article, we would propose a hypothesis that DNA-repair and mitochondrial functions are regulated by the same or similar mechanisms that affect transcription of various genes via common duplicated GGAA motifs. The scenario is that transcriptional dysregulation should proceed to characteristics of cancer, including mitochondrial dysfunction and genomic instabilities. Conversely, cancer and malignant tumors could be reprogrammed to benign state if transcriptional state in the cells were altered.

5.1. Effect of caloric restriction (CR) mimetic drugs on telomere associated protein-encoding gene promoters

Loss of function mutations on the WRN gene, which encodes telomere regulating RecQ helicase, can lead to cancer or premature aging syndrome [107, 108]. On the other hand, caloric restriction (CR) can extend life spans of various organisms [109], and thus CR mimetic drugs may have an anti-aging effect. We therefore hypothesized that CR mimetic drugs activates transcription of telomere-associated genes and demonstrated that promoter activities of the human shelterin encoding genes are up-regulated by 2-deoxy-D-glucose (2DG) and Resveratrol (Rsv) in HeLa S3 cells [110].

2DG and Rsv, which are known as a potent inhibitors of glucose metabolism [109], and an activator of sirtuin-mediated de-acetylation [111], respectively, are often referred as CR mimetic drugs. We observed moderate activation of telomerase activity in HeLa S3 cells with 2DG and Rsv treatment [110, 112], suggesting that CR mimetic drugs have protective effects on telomeres by inducing telomerase activity along with up-regulating expression of the telomere maintenance factor-encoding genes. The human TERT (hTERT) promoter has been well characterized with c-Ets, GC-box, E-box and other TF-binding elements that are located in its 5’-flanking region [113, 114]. GC-boxes and Sp1-binding sites are frequently found in the human TERT, WRN and shelterin protein-encoding gene promoters with duplicated GGAA elements that present adjacent to TSSs [110, 115].

Interestingly, both duplicated GGAA-motif and GC-boxes are contained within 500-bp upstream of the TSS of the human SIRT1 gene [116]. SIRT1, which plays a role in NAD+ dependent de-acetylation of various proteins including histones, PGC-1α, FOXO1, p53 and HIF1α, is proposed to regulate aging and the healthspan of organisms [117]. Human SIRT1 gene expression is regulated by PPARβ/γ through Sp1 binding elements [118]. Therefore, signals evoked by CR or CR mimetic drugs might induce Sp1 or GC-box binding TFs, thus simultaneously up-regulating expression of TERT, WRN, SIRT1, and the shelterin-encoding genes. Given that the CR imposes a stress on cells due to the lack of nutrients or energy to survive, cells need to stop growth but need to keep the integrity of chromosomes and telomeres without replication of their genome. Under these circumstances, cells may require full commitment of mitochondria to drive TCA cycle and OXPHOS generating more ATP molecules than glycolysis does. Therefore, CR mimetic compounds with ability to induce telomere maintenance factor encoding genes might be anti-aging drugs simultaneously up-regulating expression of mitochondrial function associated genes.

5.2. Mechanisms that regulate aging or lifespan via mitochondria and metabolic state

Genetic studies of C. elegans implied that the insulin/IGF-1 signaling pathway regulates the lifespan of animals [119]. Insulin/IGF-1 signaling and glucose metabolism are thought to be associated with several diabetes/obesity controlling factors, including AKT, FOXO, mTOR and AMPK [120]. The mTOR is a component of mTORC1 and mTORC2 that play key roles in signal transduction in response to changes in energy balance [120]. Recently, it was reported that mTORC1 in the Paneth cell niche plays a role in calorie intake by modulating cADPR release from cells [121]. AMPK is known to be a sensor for energy stress and DNA damage to induce phosphorylation of various TFs, such as FOXO, PGC-1α, CREB and HDAC5 [120, 122]. Moreover, AMPK regulates SIRT1 activity by modulating NAD+ metabolism [122].

Mitochondrial functions are known to affect lifespan of organisms [123]. Furthermore, a cross talk between telomeres and mitochondria is suggested to regulate aging [124]. This concept was implied from a Tert knock down experiment that indicates telomere dysfunction causes suppression of PGC-1α in a p53-mediated manner [6]. The tumor suppressor p53 has been suggested to affect aging of organisms as a pro-aging factor [125]. It does not only affect cell cycle arrest and apoptosis, but also play a role in mitochondrial respiration and glycolysis [126, 127]. These lines of evidences strongly suggest that p53-mediated signaling is transferred to both telomeres and mitochondria to control cellular senescence. Although no canonical GC-boxes are found, duplicated GGAA-motifs are located near the TSS of the human TP53 promoter (Table 1). Detailed analysis of the TP53-WRAP53 bidirectional promoter region revealed that both the duplicated GGAA motif and a putative E2F binding sequence are involved in the response to Rsv [128]. Therefore, various stresses from DNA damage, viral infection, or lack of nutrients, will activate expression of genes encoding DNA repair/mitochondrial/telomere maintenance-associated factors via duplicated GGAA-motif with help from other cis-elements, including GC-box and E2F elements.

5.3. Implication of transcriptional control on genes that encode TCA cycle enzymes

It has long been argued how and why cancers are generated. Recently, diagnosis of cancer and diseases that are thought to occur from genomic alterations could be analyzed by second-generation sequencing [129]. In general, it has been thought that cancer is a genetic disease with several mutations on driver genes, including PIK3CA, IDH1 and RB1 [130]. Another aspect of cancer is that it is a metabolic disease [79]. It is widely known that cancer consumes more glucose to produce ATP by glycolysis or fermentation. The metabolic state of the cells could be referred to as the “Warburg effect” [131]. Importantly, TCA-cycle enzymes, FH (Fumarate hydratase) and SDH (succinate dehydrogenage) have been suggested as tumor suppressors [132]. We have confirmed that duplicated GGAA motifs are present near TSSs of the CS, ACO2, IDH1, IDH3A, IDH3B, SUCLG1, SDHAF2, SDHB, SDHD, FH, and ACLY genes that encode enzymes in the TCA-cycle [12]. In this chapter, it was shown that a number of the 5’-upstream regions of DNA repair factor- and IFN responding factor-encoding genes contain duplicated GGAA (TTCC) motifs near their TSSs. The observation suggests that expression of genes encoding TCA cycle enzymes is mediated by GGAA-motifs in a similar manner to that of DNA repair factor encoding genes.

Figure 1.

Dysfunction of tricarboxylic acid (TCA) cycle, which could be caused by alteration of GGAA-dependent transcription, may enforce the “Warburg effect”. Duplicated GGAA-motifs are contained in the 5’-upstream regions of the ACO2, GLUD2, IDH1, IDH3A, IDH3B, MDH2, ME2, SUCLG1, SDHAF2/SDHB/SDHD, FH, ACLY, CS, and PDHX genes (red). The activity of the IDH3 complex, OGDH, and MDH1B will be reduced when NAD+/NADH ratio was attenuated according to the poly(ADP-ribosyl)ation when cells encountered DNA-damage. Compounds highlighted in yellow indicate metabolites that are produced when dysfunction of mitochondria and PARP activation has occurred, which push the cycle in the counter clockwise direction (reductive carboxylation). When FH and SDHs do not work sufficiently, glutamate will be used as a source to process TCA-cycle. Various cellular stresses, including chemicals, X-ray and UV irradiation, virus infection, and aging, may alter the quality and/or quantity profile of the GGAA-binding factors in a normal cell (upper panel). That will lead to disruption of the mitochondrial- and DNA repair function-associated gene expression. Repeated DNA-damage will enforce PARP activity to consume and deplete NAD+ molecule from cytoplasm and mitochondria. When NAD+/NADH ratio decreased to cause dysfunction of the TCA-cycle, cells would synthesize ATP by glycolysis or fermentation (lower panel). The consequence could be referred to as the “Warburg effect”.

5.4. Regulation of rate limitting factors in the DNA repair system

As noted in 3.2., PARP, which localizes in mitochondria, may play a key role as one of the rate limitting factors in the DNA repair system. Poly(ADP-ribosyl)ation is essential for DNA repair, especially in cells that have deficiencies in BRCA, which is also known to localize in mitochondria [78, 79]. Therefore, highly potent inhibitors for PARP1 have been tested in different clinical trials [47]. Inhibition of the PARP enzyme will not only prevent over consumption of the NAD+ molecule, but it also blocks DNA repair systems in cancer cells. This balance in metabolism/DNA repair should be taken into account for treatment of cancer patients. The other key factor in mitochondria is the p53, which is frequently referred as a “gurdian of the genome“ [27, 28]. Although it has not been elucidated which TFs play essential roles in the regulation of those rate limitting factors in DNA repair, cells have some systems to monitor metabolites. For instance, C terminal-binding protein (CtBP), which is a transcriptional repressor of tumor suppressors [133], regulates BRCA1 gene expression in a NAD+/NADH ratio-dependent manner [134]. This implies that a metabolic swich mediated by CtBP plays a role in the regulation of the genes encoding DNA repair factors.

5.5. Alteration in transcriptional profile may cause cancerous state

It has been postulated that epigenetic and/or transcriptional changes play a role to determine chromatin states in tumor cells [135]. Recent genomic studies indicated alterations of gene expression in many human diseases [136, 137]. The transcriptome indicating cis- quantitative trait loci (QTLs) has been reported as value to reveal gene expression and transcription state in cells from patients of specific disease [138]. Cancer incidence in humans increase exponentially with age, suggesting that aging is the strongest demographic risk factor for most human malignancies [139, 140]. This has been mainly explained by reactive oxygen species (ROS) generation and accumulation of DNA damage on chromosomes or increased genomic stability, including telomere shortening [140]. Moreover, hypoxia, which will attenuate DNA damage response causing an increased mutation rate and chromosomal instability, has been suggested to modulate senescence [141, 142]. Importantly, aging is accompanied with epigenetic change and alteration of gene expression profile [143, 144]. Numerous GGAA motif-binding TFs acting as positive and negative transcriptional regulators, could drive mitochondrial- and DNA repair factor-encoding genes. The redundancy of the binding factors to the related sequences may help to control expression of a specific gene with accuracy, and subtle changes in the profile of the TFs would not cause severe abnormalities in normal cells. However, repeated cell division and extracellular signals will gradually disturb the balance of TFs that bind to GGAA (TTCC) motifs, and finally lead to dysregulation of mitochondrial functions, DNA-repair system, and IFN-response simultaneously. At this stage, abnormalities in metabolism, mutations on DNAs, and aberrant IFN response would be observed in the cells. These features could be referred to as characteristics of cancer and malignant tumors. Moreover, DNA damage-inducing signals will activate poly(ADP-ribosyl)ation to lead to over consumption of NAD+ molecule for poly (ADP-ribose) synthesis. The reduction of NAD+/NADH ratio in mitochondria may in turn reverse the direction of the TCA cycle. If the TCA cycle cannot meet demand for ATP levels, cells will abandon dependence on the normal respiratory system in favour of up-regulating glycolysis or fermentation (Fig. 1).

Advertisement

6. Concluding remarks

It remains unclear how the GGAA motif has been duplicated and incorporated into specific regulatory regions of various genes. However, the duplication of TF binding site might have been advantageous for organisms in the course of evolution. The crystal structure of mouse Elf3 with type II TGF-β receptor promoter was reported [145], representing an association model of the ets motif binding protein with the duplicated GGAA motifs. Very recently, it was shown that binding sites for MYC and its partner MIZ correlate with Pol II binding and transcription start site [146], implying that two adjacent TF-binding sites play significant roles in the regulation of transcription of multiple genes. At least twenty seven ETS family proteins and other TFs, including GABP, NF-κB/c-Rel, and STAT proteins, recognize the sequence. Therefore, the transcriptional efficiency could be determined only by the distance between GGAA (TTCC) sequences, variation of the flanking sequences and the combination of binding factors, which might have acquired variations as a consequence of evolution.

It has been shown that a lot of head-head configured gene pairs are contained in human genomes [99]. In this chapter, we proposed a mechanism that alterations in the transcriptional state in the cells lead to insufficient mitochondrial function accompanied with impaired DNA repair system. In this regard, cancer could be referred to as a “transcriptional disease“. Given that introduction of the four OSKM (Yamanaka) factors enables reprogramming of cell, enforced expression of some TFs could reprogramm metabolic state in cancerous cells [103]. In order to assess the possibility, elucidation of how human genes, especially those that encode mitochondrial function- and DNA repair-associated factors, are regulated by GGAA motif-dependent transcription system, should be done [128]. If the mechanism were revealed, scientists could establish gene therapy to let pre-cancerous cells regain normal TCA cycle/respiration from unhealthy ATP-synthesis, or get rid of “Warburg effect”. In addition, this therapy will up-regulate DNA repair system. We believe that the concept is valuable, though not yet fully cultivated, to find a way to next generation cancer treatment with much lower side effects.

Advertisement

Acknowledgments

The authors are grateful to Kaori Inoue and Sayaka Ishibashi for discussion and outstanding technical assistance. This work was supported in part by JSPS KAKENHI Grant Number 24510270 and a Research Fellowship from the Research Center for RNA Science, RIST, Tokyo University of Science.

References

  1. 1. Yang D, Oyaizu Y, Oyaizu H, Olsen GJ, Woese CR. Mitochondrial origins. Proc. Natl. Acad. Sci. USA 1985; 82 (13): 4443-4447.
  2. 2. Viale AM, Arakaki AK. The chaperone connection to the origins of the eukaryotic organelles, FEBS Lett. 1994; 341 (2-3):146-151.
  3. 3. Vafai SB, Mootha VK. Mitochondrial disorders as windows into an ancient organelle. Nature 2012; 491 (7424): 374-383.
  4. 4. Michal G, Schomburg D. 3.1.8. Citrate Cycle. In: Michal G, Schomburg D. (eds.) Biochemical Pathways: An ATLAS of Biochemistry and Molecular Biology, 2nd ed. Hoboken, NJ: A John Wiley & Sons; 2012. p55-57.
  5. 5. Tait SW, Green DR. Mitochondria and cell death: outer membrane permeabilization and beyond Nat. Rev. Mol. Cell Biol. 2010; 11 (9): 621-632.
  6. 6. Sahin E, Colla S, Liesa M, Moslehi J, Müller FL, Guo M, Cooper M, Kotton D, Fabian AJ, Walkey C, Maser RS, Tonon G, Foerster F, Xiong R, Wang YA, Shukla SA, Jaskelioff M, Martin ES, Heffernan TP, Protopopov A, Ivanova E, Mahoney JE, Kost-Alimova M, Perry SR, Bronson R, Liao R, Mulligan R, Shirihai OS, Chin L, DePinho RA. Telomere dysfunction induces metabolic and mitochondrial compromise. Nature 2011; 470 (7334): 359–365.
  7. 7. Kazak L, Reyes A, Holt IJ. Minimizing the damage: repair pathways keep mitochondrial DNA intact. Nat. Rev. Mol. Cell Biol. 2012; 13 (10): 659-671.
  8. 8. Wolff S, Dillin A. Beneficial miscommunication. Nature 2013; 497 (7450): 442-443.
  9. 9. Galluzzi L, Kepp O, Kroemer G. Mitochondria: master regulators of danger signaling. Nat. Rev. Mol. Cell Biol. 2012; 13 (12): 780-788.
  10. 10. Koshiba T. Mitochondrial-mediated antiviral immunity. Biochim. Biophys. Acta 2013; 1833 (1): 225-232.
  11. 11. Uchiumi F, Larsen S, Tanuma S. Chapter 12, Biological systems that control transcription of DNA repair-and telomere maintenance-associated genes. In: Chen C. (ed.) New Research Directions in DNA Repair. Rijeka, Croatia: InTech; 2013. p309-325.
  12. 12. Uchiumi F, Fujikawa M, Miyazaki S, Tanuma S. Implication of bidirectional promoters containing duplicated GGAA motifs of mitochondrial function-associated genes. AIMS Mol. Sci. 2013; 1 (1): 1-26.
  13. 13. Blackburn EH. A history of telomere biology. In: de Lange T, Lundblad V, Blackburn E. (eds.) Telomeres, second ed. Plainview, NY: Cold Spring Harbor Laboratory Press; 2006. p1-19.
  14. 14. Chatzinkolaou G, Karakasilioti I, Garinis GA. DNA damage and innate immunity: links and trade-offs. Trends Immunol. 2014; 35 (9): 429-435.
  15. 15. Meyer RG, Meyer-Ficca ML, Jacobson EL, Jacobson MK Human poly(ADP-ribose) glycohydrolase (PARG) gene and the common promoter sequence it shares with inner mitochondrial membrane translocase 23 (TIM23). Gene 2003; 314: 181-190.
  16. 16. Uchiumi F, Sakakibara G, Sato J, Tanuma S. Characterization of the promoter region of the human PARG gene and its response to PU.1 during differentiation of HL-60 cells. Genes Cells 2008; 13 (12): 1229-1247.
  17. 17. Whatcott CJ, Meyer-Ficca ML, Meyer RG, Jacobson MK. A specific isoform of poly(ADP-ribose) glycohydrolase is targeted to the mitochondrial matrix by a N-terminal mitochondrial targeting sequence. Exp. Cell Res. 2009; 315 (20): 3477-3485.
  18. 18. Mendoza-Alvarez H, Alvarez-Gonzalez R. Regulation of p53 sequence-specific DNA-binding by covalent poly(ADP-ribosyl)ation. J. Biol. Chem. 2001; 276 (39): 36425-36430.
  19. 19. Lee MH, Na H, Kim EJ, Lee HW, Lee MO. Poly(ADP-ribosyl)ation of p53 induces gene-specific transcriptional repression of MTA1. Oncogene 2012; 31 (49): 5099-5107.
  20. 20. Gibson BA, Kraus WL. New insights into the molecular and cellular functions of poly(ADP-ribose) and PARPs. Nat. Rev. Mol. Cell Biol. 2012; 13 (7): 411-424.
  21. 21. Yokoyama Y, Kawamoto T, Mitsuuchi Y, Kurosaki T, Toda K, Ushiro H, Terashima M, Sumimoto H, Kuribayashi I, Yamamoto Y, Maeda T, Ikeda H, Sagara Y, Shizuta Y. Human poly(ADP-ribose) polymerase gene. Cloning of the promoter region. Eur. J. Biochem. 1990; 194 (2): 521-526.
  22. 22. Uchiumi F, Watanabe T, Ohta R, Abe H, Tanuma S. PARP1 gene expression is downregulated by knockdown of PARG gene. Oncol. Rep. 2013; 29 (5): 1683-1688.
  23. 23. Bai P, Cantó C. The role of PARP-1 and PARP-2 enzymes in metabolic regulation and disease. Cell Metab. 2012; 16 (3): 290-295.
  24. 24. Rossi MN, Carbone M, Mostocotto C, Mancone C, Tripodi M, Maione R, Amati P. Mitochondrial localization of PARP-1 requires interaction with mitofilin and is involved in the maintenance of mitochondrial DNA integrity. J. Biol. Chem. 2009; 284 (46): 31616-31624.
  25. 25. Menendez D, Inga A, Resnick MA. The expanding universe of p53 targets. Nat. Rev. Cancer 2009; 9 (10): 724-737.
  26. 26. Green DR, Kroemer G. Cytoplasmic functions of the tumor suppressor p53. Nature 2009; 458 (7242): 1127-1130.
  27. 27. Vousden KH, Lane DP. p53 in health and disease. Nat. Rev. Mol. Cell Biol. 2007; 8 (4): 275-283.
  28. 28. Vousden KH, Ryan KM. p53 and metabolism. Nat. Rev. Cancer 2009; 9 (10): 691-700.
  29. 29. Zhuang J, Wang PY, Huang X, Chen X, Kang JG, Hwang PM. Mitochondrial disulfide relay mediates translocation of p53 and partitions its subcellular activity. Proc. Natl. Acad. Sci. USA 2013; 110 (43): 17356-17361.
  30. 30. Koczor CA, White RC, Zhao P, Zhu L, Fields E, Lewis W. p53 and mitochondrial DNA. Am. J. Pathol. 2012; 180 (6): 2276-2283.
  31. 31. Moiseeva O, Bourdeau V, Roux A, Deschênes-Simard X, Ferbeyre G. Mitochondrial dysfunction contributes to oncogene-induced senescence. Mol. Cell. Biol. 2009; 29 (16): 4495-4507.
  32. 32. Sankaran VG, Orkin SH, Walkley CR. Rb intrinsically promotes erythropoiesis by coupling cell cycle exit with mitochondrial biogenesis. Genes Dev. 2008; 22 (4): 463-475.
  33. 33. Dick FA, Rubin SM. Molecular mechanisms underlying RB protein function. Nat. Rev. Mol. Cell Biol. 2013; 14 (5): 297-306.
  34. 34. Ambrus AM, Islam ABMMK, Holmes KB, Moon NS, Lopez-Bigas N, Benevolenskaya EV, Frolov MV. Loss of dE2F compromises mitochondrial function. Dev. Cell 2013; 27 (4): 438-451.
  35. 35. Miki Y, Swensen J, Shattuck-Eidens D, Futreal PA, Harshman K, Tavtigian S, Liu Q, Cochran C, Bennett LM, Ding W, Bell R, Rosenthal J, Husse, C, Tran T, McClure M, Frye C, Hattier T, Phelps R, Haugen-Strano A, Katcher H, Yakumo K, Gholami Z, Shaffer D, Stone S, Bayer S, Wray C, Bogden R, Dayananth P, Ward J, Tonin P, Narod S, Bristow PK, Norris FH, Helvering L, Morrison P, Rosteck P, Lai M, Barrett JC, Lewis C, Neuhausen S, Cannon-Albright L, Goldgar D, Wiseman R, Kamb A, Skolnick MH. A strong candidate for the breast and ovarian cancer susceptibility gene BRCA1. Science 1994; 266 (5182): 66-71.
  36. 36. King MC. “The race” to clone BRCA1. Science 2014; 343 (6178): 1462-1465.
  37. 37. Huen MS, Sy SM, Chen J. BRCA1 and its toolbox for the maintenance of genome integrity. Nat. Rev. Mol. Cell Biol. 2010; 11 (2): 138-148.
  38. 38. Coene ED, Hollinshead MS, Waeytens AAT, Schelfhout VRJ, Eechaute WP, Shaw MK, Van Oostveldt PMV, Vaux DJ. Phosphorylated BRCA1 is predominantly located in the nucleus and mitochondria. Mol. Biol. Cell 2005; 16 (2): 997-1010.
  39. 39. Garcia-Higuera I, Taniguchi T, Ganesan S, Meyn MS, Timmers C, Hejna J, Grompe M, D’Andrea AD. Interaction of the Fanconi anaemia proteins and BRCA1 in a common pathway. Mol. Cell 2001; 7 (2): 249-262.
  40. 40. Banerjee T, Bharti SK, Brosh Jr RM. Fanconi anemia, interstrand cross-link repair, and cancer. In: Madhusudan S, Wilson III DM. (eds.) DNA Repair and Cancer-From Bench to Clinic. Boca Raton, FL: CRC Press, Taylor & Francis Group; 2013. p310-324.
  41. 41. Pagano G, Talamanca AA, Castello G, d’ischia M, Pallardó FV, Petrović S, Porto B, Tiano L, Zatterale A. Bone marrow cell transcripts from Fanconi anaemia patients reveal in vivo alterations in mitochondrial, redox and DNA repair pathaways. Eur. J. Haematol. 2013; 91 (2): 141-151.
  42. 42. Cappelli E, Ravera S, Vaccaro D, Cuccarolo P, Bartolucci M, Panfoli I, Dufour C, Degan P. Mitochondrial respiratory complex I defects in Fanconi anaemia. Trends Mol. Med. 2013; 19 (9): 513-514.
  43. 43. Negrini S, Gorgoulis VG, Halazonetis TD. Genomic instability—an evolving hallmark of cancer. Nat. Rev. Mol. Cell Biol. 2010; 11 (3): 220-228.
  44. 44. Sharma NK, Lebedeva M, Thomas T, Kovalenko OA, Stumpf JD, Shadel GS, Santos JH. Intrinsic mitochondrial DNA repair defects in Ataxia Telangiectasia. DNA Repair (Amst) 2014; 13: 22-31.
  45. 45. Morita A, Tanimoto K, Murakami T, Morinaga T, Hosoi Y. Mitochondria are required for ATM activation by extranuclear oxidative stress in cultured human hepatoblastoma cell line Hep G2 cells. Biochem. Biophys. Res. Commun. 2014; 443 (4): 1286-1290.
  46. 46. Yuan SS, Lee SY, Chen G, Song M, Tomlinson GE, Lee EY. BRCA2 is required for ionizing radiation-induced assembly of Rad51 complex in vivo. Cancer Res. 1999; 59 (15): 3547-3551.
  47. 47. Venkitaraman AR. Cancer suppression by the chromosome custodians, BRCA1 and BRCA2. Science 2014; 343 (6178): 1470-1475.
  48. 48. Estaquier J, Vallette F, Vayssiere JL, Mignotte B. The mitochondrial pathways of apoptosis. In: Scatena R, Bottoni P, Giardina B. (eds.) Advances in Mitochondrial Medicine. Dordrecht, Germany: Springer Science+Business Media BV; 2012. p157-183.
  49. 49. Galluzzi L, Kepp O, Kroemer G. Mitochondria: master regulators of danger signaling. Nat. Rev. Mol. Cell Biol. 2012; 13 (12): 780-788.
  50. 50. Uchiumi F, Miyazaki S, Tanuma S. The possible functions of duplicated ets (GGAA) motifs located near transcription start sites of various human genes. Cell. Mol. Life Sci. 2011; 68 (12): 2039-2051.
  51. 51. Kroemer G. Mitochondrial implication in apoptosis. Towards an endosymbiont hypothesis of apoptosis evolution. Cell Death Differ. 1997; 4 (6): 443-546.
  52. 52. Rubinstein AD, Eisenstein M, Ber Y, Bialik S, Kimchi A. The autophagy protein Atg12 associates with antiapoptotic Bcl-2 family members to promote mitochondrial apoptosis. Mol. Cell 2011; 44 (5): 698-709.
  53. 53. Mai S, Muster B, Bereiter-Hahn J, Jendrach M. Autophagy proteins LC3B, ATG5 and ATG12 participate in quality control after mitochondrial damage and influence life span. Autophagy 2012; 8 (1): 47-62.
  54. 54. Goo HG, Jung MK, Han SS, Rhim H, Kang S. HtrA2/Omi deficiency causes damage and mutation of mitochondrial DNA. Biophim. Biophys. Acta 2013; 1833 (8): 1866-1875.
  55. 55. Mohan V, Madhusuden S. DNA base excision repair: evolving biomarkers for personalized therapies in cancer. In: Chen C. (ed.) New Research Directions in DNA Repair. Rijeka, Croatia: InTech; 2013. p529-557.
  56. 56. Fishel ML, Vascotto C, Kelley MR. DNA base excision repair therapeutics: Summary of targets with a focus on APE1. In: Madhusudan S, Wilson III DM (eds.) DNA Repair and Cancer-From Bench to Clinic. Boca Raton, FL: CRC Press, Taylor & Francis Group; 2013. p233-287.
  57. 57. Tell G, Quadrifoglio F, Tiribelli C, Kelley MR. The many functions of APE1/Ref-1: Not only a DNA repair enzyme. Antioxid Redox Signal 2009; 11 (3): 601-620.
  58. 58. Liu G, Kamp DW. Mitochondrial DNA damage: role of Ogg1 and aconitase. In: Kruman I. (ed.) DNA Repair. Rijeka, Croatia: InTech; 2011. p85-102.
  59. 59. Kim SJ, Cheresh P, Williams D, Cheng Y, Ridge K, Schumacker PT, Weitzman S, Bohr VA, Kamp DW. Mitochondria-targeted Ogg1 and aconitase-2 prevent oxidant-induced mitochondrial DNA damage in Alveolar Epithelial cells. J. Biol. Chem. 2014; 289 (9): 6165-6176.
  60. 60. Kamenisch Y, Fousteri M, Knoch J, von Thaler AK, Fehrenbacher B, Kato H, Becker T, Dollé MET, Kuiper R, Majora M, Schaller M, van der Horst GTJ, van Steeg H, Röcken M, Rapaport D, Krutmann J, Mullenders LH, Berneburg M. Proteins of nucleotide and base excision repair pathways interact in mitochondria to protect from loss of subcutaneous fat, a hallmark of aging. J. Exp. Med. 2010; 207 (2): 379-390.
  61. 61. Uchiumi F, Larsen S, Masumi A, Tanuma S. The putative implications of duplicated GGAA-motifs located in the human interferon regulated genes (ISGs). In: iConcept (ed.) Genomics I-Humans, Animals and Plants. Hong Kong: iConcept; 2013. pp. 87-105.
  62. 62. Buckley NE, Hosey AM, Gorski JJ, Purcell JW, Mulligan JM, Harkin DP, Mullan PB. BRCA1 regulates IFN-γ signaling through a mechanism involving the type I IFNs. Mol. Cancer Res. 2007; 5 (3): 261-270.
  63. 63. Kondo T, Kobayashi J, Saitoh T, Maruyama K, Ishii KJ, Barber GN, Komatsu K, Akira S, Kawai T. DNA damage sensor MRE11 recognizes cytosolic double-stranded DNA and induces type I interferon by regulating STING trafficking. Proc. Natl. Acad. Sci. USA 2013; 110 (8): 2969-2974.
  64. 64. Saberwal G, Horvath E, Hu L, Zhu C, Hjort E, Eklund EA. The interferon consensus sequence binding protein (ICSBP/IRF8) activates transcription of the FANCF gene during myeloid differentiation. J. Biol. Chem. 2009; 284 (48): 33242-33254.
  65. 65. Frontini M, Vijayakumar M, Garvin A, Clarke N. A ChIP-chip approach reveals a novel role for transcription factor IRF1 in the DNA damage response. Nucleic Acids Res. 2009; 37 (4): 1073-1085.
  66. 66. Ciszewski WM, Wagner W, Kania KD, Dastych J. Interleukin-4 enhances PARP-dependent DNA repair activity in vitro. J. Interferon Cytokine Res. 2014; 34 (9): 734-740.
  67. 67. Xu H, Xian J, Vire E, McKinney S, Wei V, Wong J, Tong R, Kouzarides T, Caldas C, Aparicio S. Up-regulation of the interferon-related genes in BRCA2 knockout epithelial cells. J. Pathol. 2014; in press (doi: 10.1002/path.4404)
  68. 68. Gehrke N, Mertens C, Zilinger T, Wenzel J, Bald T, Tüting T, Hartmann G, Barchet W. Oxidative damage of DNA confers resistance to cytosolic nuclease TREX1 degradation and potentiates STING-dependent immune sensing. Immunity 2013; 39 (3): 482-495.
  69. 69. Hasan M, Yan N. Safeguard against DNA sensing: the role of TREX1 in HIV-1 infection and autoimmune diseases. Front. Microbiol. 2014; 5: 193.
  70. 70. Imbeault M, Ouellet M, Tremblay MJ. Microarray study reveales that HIV-I induces rapid type-I interferon-dependent p53 mRNA up-regulation in human primary CD4+ T cells. Retrovirol. 2009; 6: 5.
  71. 71. Marteijn JA, Lans H, Vermeulen W, Hoeijmakers JHJ. Understanding nucleotide excision repair and its roles in cancer and ageing. Nat. Rev. Mol. Cell Biol. 2014; 15 (7): 465-481.
  72. 72. Wolters S, Schumacher B. Genome maintenance and transcription integrity in aging and disease. Front. Genet. 2013; 4: 19.
  73. 73. Ulrich HD, Walden H. Ubiquitin signaling in DNA replication and repair. Nat. Rev. Mol. Cell Biol. 2010; 11 (7): 479-489.
  74. 74. Shiloh Y, Ziv Y. The ATM protein kinase: regulating the cellular response to genotoxic stress, and more. Nat. Rev. Mol. Cell Biol. 2013; 14 (4): 197-210.
  75. 75. Stracker TH, Petrini JHJ. The MRE11 complex: starting from the ends. Nat. Rev. Mol. Cell Biol. 2011; 12 (2): 90-103.
  76. 76. Baute J, Depicker A. Base excision repair and its role in maintaining genome stability. Critic.Rev. Biochem. Mol. Biol. 2008; 43: 239-276.
  77. 77. Lindahl T. My journey to DNA repair. Genomics Proteomics Bioinformatics 2013; 11 (1): 2-7.
  78. 78. Maniccia AW, Lewis C, Begum N, Xu J, Cui J, Chipitsyna G, Aysola K, Reddy V, Bhat G, Fujimura Y, Henderson B, Reddy ES, Rao VN. Mitochondrial localization, ELK-1 transcriptional regulation and growth inhibitory functions of BRCA1, BRCA1a, and BRCA1b proteins. J. Cell Physiol. 2009; 219 (3): 634-641.
  79. 79. Seyfried TN, Flores RE, Poff AM, D’Agostino DP. Cancer as a metabolic disease: implications for novel therapeutics. Carcinogenesis 2014; 35 (3): 515-527.
  80. 80. Niere M, Kernstock S, Koch-Nolte F, Ziegler M. Functional localization of two poly(ADP-ribose)-degrading enzymes to the mitochondrial matrix. Mol. Cell Biol. 2008; 28 (2): 814-824.
  81. 81. Dölle C, Rack JG, Ziegler M. NAD and ADP-ribose metabolism in mitochondria. FEBS J. 2013; 280 (15): 3530-3541.
  82. 82. Santidrian AF, Matsuno-Yagi A, Ritland M, Seo BB, LeBoeuf SE, Gay LJ, Yagi T, Felding-Habermann B. Mitochondrial complex I activity and NAD+/NADH balance regulate breast cancer progression. J. Clin. Invest. 2013; 123 (3): 1068-1081.
  83. 83. Bai P, Cantó C. The role of PARP-1 and PARP-2 enzymes in metabolic regulation and disease. Cell Metab. 2012; 16 (3): 290-295.
  84. 84. Cantó C, Sauve AA, Bai P. Crosstalk between poly(ADP-ribose) polymerase and sirtuin enzymes. Mol. Aspects Med. 2013; 34 (6): 1168-1201.
  85. 85. Sahar S, Masubuchi S, Eckel-Mahan K, Vollmer S, Galla L, Ceglia N, Masri S, Barth TK, Grimaldi B, Oluyemi O, Astarita G, Hallows WC, Piomelli D, Imhof A, Baldi P, Denu JM, Sassone-Corsi P. Circadian control of fatty acid elongation by SIRT1 protein-mediated deacetylation of acetyl-coenzyme A synthetase 1. J. Biol. Chem. 2014; 289 (9): 6091-6097.
  86. 86. Hirschey MD, Shimazu T, Goetzman E, Jing E, Schwer B, Lombard DB, Grueter CA, Harris C, Biddinger S, Ilkayeva OR, Stevens RD, Li Y, Saha AK, Ruderman NB, Bain JR, Newgard CB, Farese RV, Alt FW, Kahn CR, Verdin E. SIRT3 regulates mitochondrial fatty-acid oxidation by reversible enzyme deacetylation. Nature 2010; 464 (7285): 121-125.
  87. 87. Schwer B, Bunkenborg J, Verdin RO, Andersen JS, Verdin E. Reversible lysine acetylation controls the activity of the mitochondrial enzyme acetyl-CoA synthetase 2. Proc. Natl. Acad. Sci. USA 2006; 103 (27): 10224-10229.
  88. 88. Hallows WC, Lee S, Denu JM. Sirtuins deacetylate and activate mammalian acetyl-CoA synthetases. Proc. Natl. Acad. Sci. USA 2006; 103 (27): 10230-10235.
  89. 89. Bellizzi D, Dato S, Cavalcante P, Covello G, Di Cianni F, Passarino G, Rose G, De Benedictis G. Characterization of a bidirectional promoter shared between two human genes related to aging: SIRT3 and PSMD13. Genomics 2005; 89 (1): 143-150.
  90. 90. Jackson SP, Durocher D. Regulation of DNA damage responses by ubiquitin and SUMO. Mol. Cell 2013; 49 (5): 795-807.
  91. 91. Deyrieux AF, Wilson VG. Sumoylation in development and differentiation. In: Wilson VG. (ed.) Sumo regulation of cellular processes. Dordrecht: Springer Science+Business Media BV; 2009. p187-199.
  92. 92. Dou H, Huang C, Van Nguyen T, Lu LS, Yeh ET. Sumoylation and de-SUMOylation in response to DNA damage. FEBS Lett. 2011; 585 (18): 2891-2896.
  93. 93. Bekker-Jensen S, Mailand N. The ubiquitin- and SUMO-dependent signaling response to DNA double-strand breaks. FEBS Lett. 2011; 585 (18): 2914-2919.
  94. 94. Moudry P, Lukas C, Macurek L, Hanzlikova H, Hodny Z, Lukas J, Bartek J. Ubiquitin-activating enzyme UBA1 is required for cellular response to DNA damage. Cell Cycle 2012; 11 (8): 1573-1582.
  95. 95. FitzGerald PC, Shlyakhtenko A, Mir AA, Vinson C. Clustering of DNA sequences in human promoters. Genome Res. 2004; 14 (8):1562-1574.
  96. 96. Wei GH, Badis G, Berger MF, Kivioja T, Palin K, Enge M, Bonke M, Jolma A, Varjosalo M, Gehrke AR, Yan J, Talukder S, Turunen M, Taipale M, Stunnenberg HG, Ukkonen E, Hughes TR, Bulyk ML, Taipale J. Genome-wide analysis of ETS-family DNA-binding in vitro and in vivo. EMBO J. 2010; 29 (13): 2147-2160.
  97. 97. Patton J, Block S, Coombs C, Martin ME. Identification of functional elements in the murine Gabp alpha/ATP synthase coupling factor 6 bi-directional promoter. Gene 2005; 369: 35-44.
  98. 98. Adachi N, Lieber MR. Bidirectional gene organization: a common architectural feature of the human genome. Cell 2002; 109 (7): 807-809.
  99. 99. Wakano C, Byun JS, Di LJ, Gardner K. The dual lives of bidirectional promoters. Biochim. Biophys. Acta 2012; 1819 (7): 688-693.
  100. 100. Xu C, Chen J, Shen B. The preservation of bidirectional promoter architecture in eukaryotes: what is the driving force? BMC Systems Biol. 2012; 6 (Suppl. 1): S21.
  101. 101. Yang MQ, Koehly LM, Elinitski LL. Comprehensive annotation of bidirectional promoters identifies co-regulation among breast and ovarian cancer genes. PLoS Comput. Biol. 2007; 3: e72.
  102. 102. Kim SW, Kim JB, Kim JH, Lee JK. Interferon-gamma-induced expressions of heat shock protein 60 and heat shock protein 10 in C6 astroglioma cells: identification of the signal transducers and activators of transcription 3-binding site in bidirectional promoter. Neuroreport 2007; 18 (4): 385-389.
  103. 103. Takahashi K, Yamanaka S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 2006; 126 (4): 663-676.
  104. 104. Nakaki F, Hayashi K, Ohta H, Kurimoto K, Yabuta Y, Saitou M. Induction of mouse germ-cell fate by transcription factors in vitro. Nature 2013; 501 (7466): 222-226.
  105. 105. Di Stefano B, Sardina JL, van Oevelen C, Collombet S, Kallin EM, Vincent GP, Lu J, Thieffry D, Beato M, Graf T. C/EBPα poises B cells for rapid reprogramming into induced pluripotent stem cells. Nature 2014; 506 (7487): 235-239.
  106. 106. Ito K, Suda T. Metabolic requirements for the maintenance of self-renewing stem cells. Nat. Rev. Mol. Cell Biol. 2014; 15 (4): 243-256.
  107. 107. Yu C, Oshima J, Fu YH, Wijsman EM, Hisama F, Alisch R, Matthews S, Nakura J, Miki T, Ouais S, Martin GM, Mulligan J, Schellenberg GD. Positional cloning of the Werner’s syndrome gene. Science 1996; 272 (5259): 258–262.
  108. 108. Crabbe L, Verdun RE, Haggblom CI, Karlseder J. Defective telomere lagging strand synthesis in cells lacking WRN helicase activity. Science 2004; 306 (5703): 1951-1953.
  109. 109. Roth GS, Ingram DK, Lane MA. Caloric restriction in primates and relevance to humans. Ann. NY Acad. Sci. 2001; 928: 305-315.
  110. 110. Stefani M, Markus MA, Lin RCY. Pinese M, Dawes IW, Morris BJ. The effect of resveratrol on a cell model of human aging. Ann. NY Acad. Sci. 2007; 1114: 407-418.
  111. 111. Zhou B, Ikejima T, WatanabeT, Iwakoshi K, Idei Y, Tanuma S, Uchiumi F. The effect of 2-deoxy-D-glucose on Werner syndrome RecQ helicase gene. FEBS Lett. 2009; 583 (8): 1331-1336.
  112. 112. Uchiumi F, Watanabe T, Hasegawa S, Hoshi T, Higami Y, Tanuma S. The effect of resveratrol on the werner syndrome RecQ helicase gene and telomerase activity. Curr. Aging Sci. 2011; 4 (1): 1-7.
  113. 113. Dwyer J, Li H, Xu D, Liu JP. Transcriptional regulation of telomerase activity. Ann. NY Acad. Sci. 2007; 1114: 36-47.
  114. 114. Nicholls C, Li H, Wang JQ, Liu JP. Molecular regulation of telomerase activity in aging. Protein Cell 2011; 2 (9): 726-738.
  115. 115. Uchiumi F, Higami Y, Tanuma S. Regulations of telomerase activity and WRN gene expression. In: Gagnon AN. (ed.) Telomerase: Composition, Functions and Clinical Implications. Hauppauge, NY: Nova Science Publishers; 2010. p95-103.
  116. 116. Uchiumi F, Tachibana H, Larsen S, Tanuma S. Effect of lignin glycosides extracted from pine cones on the human SIRT1 promoter. Pharm. Anal. Acta 2013; 4: 8.
  117. 117. Houtkooper RH, Pirinen E, Auwerx J. Sirtuins as regulators of metabolism and healthspan. Nat. Rev. Mol. Cell Biol. 2012; 13 (4): 225-238.
  118. 118. Okazaki M, Iwasaki Y, Nishiyama M, Taguchi T, Tsugita M, Nakayama S, Kambayashi M, Hashimoto K, Terada Y. PPARβ/γ regulates the human SIRT1 gene transcription via Sp1. Endoc. J. 2010; 57 (5): 403-413.
  119. 119. Kenyon CJ. The genetics of aging. Nature 2010; 464 (7288): 504-512.
  120. 120. Zoncu R, Efeyan A, Sabatini DM. mTOR: from growth signal integration to cancer, diabetes and aging. Nat. Rev. Mol. Cell Biol. 2011; 12 (1): 21–35.
  121. 121. Yilmaz ÖH, Katajisto P, Lamming DW, Gültekin Y, Bauer-Rowe KE, Sengupta S, Birsoy K, Dursun A, Yilmaz VO, Selig M, Nielsen GP, Mino-Kenudson M, Zukerberg LR, Bhan AK, Deshpande V, Sabatini DM. mTORC1 in the Paneth cell niche couples intestinal stem-cell function to calorie intake. Nature 2012; 486 (7404): 490-495.
  122. 122. Cantó C, Auwerx J. AMP-activated protein kinase and its downstream transcriptional pathways. Cell. Mol. Life Sci. 2010; 67 (20): 3407-3423.
  123. 123. Robb EL, Page MM, Stuart JA. Mitochondria, cellular stress resistance, somatic cell depletion and lifespan. Curr. Aging Sci. 2009; 2 (1): 12-27.
  124. 124. Sahin E, DePinho RA. Axis of aging: telomerase, p53 and mitochondria. Nat. Rev. Mol. Cell. Biol. 2012; 13 (6): 397-404.
  125. 125. Vijg J. Genome instability and accelerated aging. In: Vijg J. (ed.) Aging of the Genome. New York: Oxford University Press; 2007. p151-180.
  126. 126. Matoba S, Kang JG, Patino WD, Wragg A, Boehm M, Gavrilova O, Hurley PJ, Bunz F, Hwang PM. p53 regulates mitochondrial respiration. Science 2006; 312 (5780): 1650-1653.
  127. 127. Bensaad K, Tsuruta A, Selak MA, Vidal MNC, Nakano K, Bartrons R, Gottlieb E, Vousden KH. TIGAR, a p53-inducible regulator of glycolysis and apoptosis. Cell 2006; 126 (1): 107-120.
  128. 128. Uchiumi F, Shoji K, Sasaki Y, Sasaki M, Sasaki Y, Oyama T, Sugisawa K, Tanuma S. Characterization of the 5’-flanking region of the human TP53 gene and its response to the natural compound, Resveratrol. 2014; in press.
  129. 129. Meyerson M, Gabriel S, Getz G. Advances in understanding cancer genomes through second-generation sequencing. Nat. Rev. Genet. 2010; 11 (10): 685-696.
  130. 130. Vogelstein B, Papadopoulos N, Velculescu VE, Zhou S, Diaz Jr LA, Kinzler KW. Cancer genome landscapes. Science 2013; 339 (6127): 1546-1558.
  131. 131. Seyfried TN. Chapter 2, Confusion surrounds the origin of cancer. In: Cancer as a metabolic disease. Hoboken, NJ: A John Wiley & Sons; 2012. p15-29.
  132. 132. Pollard PJ, Brière JJ, Alam NA, Barwell J, Barclay E, Wortham NC, Hunt T, Mitchell M, Olpin S, Moat SJ, Hargreaves IP, Heales SJ, Chung YL, Griffiths JR, Dalgleish A, McGrath JA, Gleeson MJ, Hodgson SV, Poulsom R, Rustin P, Tomlinson IP. Accumulation of Krebs cycle intermediates and over-expression of HIFalpha in tumors which result from germline FH and SDH mutations. Hum. Mol. Genet. 2005; 14 (15): 2231-2239.
  133. 133. Chinnadurai G. The transcriptional corepressor CtBP: a foe of multiple tumor suppressors. Cancer Res. 2009; 69 (3): 731-734.
  134. 134. Di LJ, Fernandez AG, De Siervi A, Longo DL, Gardner K. Transcriptional regulation of BRCA1 expression by a metabolic switch. Nat. Strultural Mol. Biol. 2010; 17 (12): 1406-1413.
  135. 135. Suvà ML, Riggi N, Bernstein BE. Epigenetic reprogrammning in cancer. Science 2013; 339 (6127): 1567-1570.
  136. 136. Nicolae DL, Gamazon E, Zhang W, Duan S, Dolan ME, Cox NJ. Trait-associated SNPs are more likely to be eQTLs: annotation to enhance discovery from GWAS. PLoS Genet. 2010; 6: e1000888.
  137. 137. Nica AC, Montgomery SB, Dimas AS, Stranger BE, Beazley C, Barroso I, Dermitzakis ET. Candidate causal regulatory effects by integration of expression QTLs with complex trait genetic associations. PLoS Genet. 2010; 6: e1000895.
  138. 138. Lappalainen T, Sammeth M, Friedländer MR, 't Hoen PA, Monlong J, Rivas MA, Gonzàlez-Porta M, Kurbatova N, Griebel T, Ferreira PG, Barann M, Wieland T, Greger L, van Iterson M, Almlöf J, Ribeca P, Pulyakhina I, Esser D, Giger T, Tikhonov A, Sultan M, Bertier G, MacArthur DG, Lek M, Lizano E, Buermans HP, Padioleau I, Schwarzmayr T, Karlberg O, Ongen H, Kilpinen H, Beltran S, Gut M, Kahlem K, Amstislavskiy V, Stegle O, Pirinen M, Montgomery SB, Donnelly P, McCarthy MI, Flicek P, Strom TM; Geuvadis Consortium, Lehrach H, Schreiber S, Sudbrak R, Carracedo A, Antonarakis SE, Häsler R, Syvänen AC, van Ommen GJ, Brazma A, Meitinger T, Rosenstiel P, Guigó R, Gut IG, Estivill X, Dermitzakis ET. Transcriptome and genomic sequencing uncovers functional variation in humans. Nature 2013; 501 (7468): 506-511.
  139. 139. Edwards B, Howe HL, Ries LA, Thun MJ, Rosenberg HM, Yancik R, Wingo PA, Jemal A, Feigal EG. Annual report to the nation on the status of cancer, 1973-1999, featuring implications of age and aging on U.S. cancer burden. Cancer 2002; 94 (10): 2766-2792.
  140. 140. Benz CC, Yau C. Aging, oxidative stress and cancer: paradigms in parallax. Nat. Rev. Cancer 2008; 8 (11): 875-879.
  141. 141. Bristow RG, Hill RP. Hypoxia, DNA repair and genetic instability. Nat. Rev. Cancer 2008; 8 (3): 180-192.
  142. 142. Welford SM, Giaccia AJ. Hypoxia and senescence: the impact of oxygenation on tumor suppression. Mol. Cancer Res. 2011; 9 (5): 538-544.
  143. 143. Cencioni C, Spallotta F, Martelli F, Valente S, Mai A, Zeiher AM, Gaetano C. Oxidative stress and epigenetic regulation in ageing and age-related diseases. Int. J. Mol. Sci. 2013; 14 (9): 17643-17663.
  144. 144. Geigl JB, Langer S, Barwisch S, Pfleghaar K, Lederer G, Speicher MR. Analysis of gene expression patterns and chromosomal changes associated with aging. Cancer Res. 2004; 64 (23): 8550-8557.
  145. 145. Agarkar VB, Babayeva ND, Wilder PJ, Rizzino A, Tahirov TH. Crystal structure of mouse Elf3 C-terminal DNA-binding domain in complex with type II TGF-β receptor promoter DNA. J. Mol. Biol. 2010; 397 (1): 278-289.
  146. 146. Walz S, Lorenzin F, Morton J, Wiese KE, von Eyss B, Herold S, Rycak L, Dumay-Odelot H, Karim S, Bartkuhn M, Roels F, Wüstefeld T, Fischer M, Teichmann M, Zender L, Wei CL, Sansom O, Wolf E, Eilers M. Activation and repression by oncogenic MYC shape tumor-specific gene expression profiles. Nature 2014; 511 (7510): 483-487.

Written By

Fumiaki Uchiumi, Steven Larsen and Sei-ichi Tanuma

Submitted: June 16th, 2014 Published: November 18th, 2015