Bacterial Leaf Spot of Cucurbits: A Menace to Cultivation

Abstract

Bacterial leaf spot is one of the important diseases of cucurbits affecting almost all the cultivated cucurbits worldwide. The disease has been reported to cause huge losses to the cucurbits as the symptoms of the disease appear on all plant parts including fruits. The disease is favoured by moderate-to-high temperatures and high humidity. The pathogen perpetuates in the seed and infected crop debris. The management efforts for the disease are still on and there are reports of its management up to more than 50 per cent level under field conditions. No resistant variety to this disease is known. However, the disease can be managed by the use of common antibiotics. The disease is an emerging disease at international and national level. Keeping in view the importance of the disease, the chapter is discussed under following headings such as occurrence, losses, symptoms, pathogenicity and host range, cultural studies, molecular characterisation, survival, disease cycle and epidemiology, host resistance and management, covering all the important aspects in the light of available literature.

1. Introduction

Family Cucurbitaceae, the second largest family among fruits and vegetables next to Solanaceae, contains genetically a diverse group of plants, and several important commodity crops in many parts of the world such as cucumber, pumpkin and melon [1]. Cucurbits, also known as gourds, consist of hundred genera, most of which are edible worldwide [2]. The most important edible plants of the family are Cucumber, pumpkin, different types of gourds, melons, squash and zucchini. The Cucurbit family is a source of dietary fibre such as β-carotene pro-vitamin A, potassium and vitamin C [3]. It is also a rich source of phytochemicals such as cucurbitacins, saponins, carotenoids, phytosterols, polyphenols and antioxidants [4]. Fruit can be consumed ripe (e.g. pumpkin) or unripe (e.g. zucchini), raw (watermelon), cooked (squash) or pickled (gherkins) and is a type of berry known as pepo [5]. Also, cucurbits are consumed fresh for the purpose of dessert (muskmelon and watermelon), in salad (cucumber and long melon), cooked (bottle gourd, bitter gourd, pumpkin, etc.), jam (pumpkin) or candied (ash gourd). Pumpkin which is also known by other names such as ‘Sitaphal’, ‘Kashiphal’ or ‘kaddu’ [6] is used in traditional medicine systems like antidiabetic, antihypertensive, antitumor, antibacterial, antihypercholesterolemia, intestinal antiparasitic and anti-inflammation [7]. Bottle gourd is one of the largest produced cucurbit vegetables and is also called calabash gourd, trumpet gourd, white-flowered gourd and zucca melon [8]. Bitter gourd has high nutritional value due to the presence of ascorbic acid and iron contents [9]. Watermelon flesh is thirst-quenching, highly nutritious and has vitamins C and A in the form of beta-carotene [10]. Luffa (Luffa cylindrica (L.)) is commonly called sponge gourd, loofah, vegetable sponge, bath sponge or dishcloth gourd [11]. Cucumber (Cucumis sativus L.) is the fourth most important vegetable worldwide [12].

Cucurbits are attacked by number of insects and pathogens. Among these, Xanthomonas cucurbitae (Bryan) Dowson or Xanthomonas campestris pv. cucurbitae causing bacterial spot is emerging as an important pathogen, which is a menace to cucurbits cultivation, especially in case of pumpkin, winter squash and bottle gourd and causes huge losses in the crops of up to 90 per cent [13]. About 100 per cent loss in yield of pumpkin is also reported [14]. The disease is Nationally and internationally important especially in bottle gourd and pumpkin, respectively [15]. This disease is also reported as an emerging disease of cucurbits [16].

2. Occurrence

Bacterial leaf spot disease was reported for the first time on Hubbard squash in New York in 1926 [17]. The disease has since then been reported in various cucurbits [18] like on watermelon from Georgia [19]; pumpkin from the United States [20], Reunion Island [21], Nepal [22], and Italy [23] and bottle gourd from India [13]. In India, the disease was first reported in 1989 from Bihar on cucumber. After that, there has no report of the disease in India till 2011 [13]. A survey was conducted in 64 areas including five regions of Himachal Pradesh, India, to reveal disease severity in the range of 12.50 to 78.33 per cent in bottle gourd [13]. A similar survey was conducted in Illinois, USA, between 2010 and 2011 in pumpkin fields, which demonstrated the prevalence of bacterial spots in the field on infected fruits with 25 per cent disease incidence on an average. The survey in Jammu and Kashmir, India, including 27 areas revealed disease severity ranging from 14.5 to 33.4 per cent [24]. Bacterial leaf spot was also recorded to be a predominant disease in 60 per cent of fields of pumpkin surveyed on Caribbean Island with 30 per cent disease incidence in the rainy season [25].

3. Losses

Xanthomonas cucurbitae has been reported to cause significant losses in cucurbits throughout the world. X. cucurbitae is prevalent during warm and humid conditions on different cucurbits. This pathogen can reduce the yield of the crop by up to 90 per cent by causing severe infection of foliage as well as fruit. Yield losses of up to 20 per cent have been observed in highly susceptible cultivars with the disease severity sometimes reaching up to 50–60 per cent during storage [26]. Ninety per cent yield loss has been reported in pumpkin fields in Illinois. [27] Bacterial leaf spot caused by X. cucurbitae is an important disease of cucurbits leading to huge crop losses especially to bottle gourd, pumpkin and squashes in sub-tropical zone of Himachal Pradesh, India [28]. In the case of bottle gourd, 10 to 70 per cent yield losses have been reported in Himachal Pradesh, India by, Jarial et al. [13]. The disease causes great havoc in pumpkin fields leading to up to 90 per cent yield loss [29]. It has also been reported from the pumpkin fields of Canada leading to 60 per cent yield losses [30].

4. Symptomatology

The disease has been reported to be prevalent on leaves and fruits of different cucurbits, such as watermelon, pumpkin, bottle gourd, cucumber and squashes. The symptoms of this malady have been described by various researchers on different crops. On Hubbard squash, the bacterial leaf spot was described to be mostly present on the lower surface of leaves [23]. These small water-soaked areas pierce the upper surface of the leaves as ill-defined yellow spots. These spots seem to grow in size to form a definite round spot of about 6 or 7 mm in width, even though they are restricted by veins, with a bright yellow halo prominent on the upper surface of the leaf. The lower surface of the leaf, however, shows spots with water-soaked margins or have no evident distinction. The bacterium has been known to enter through the stomata on leaves. As the infection spreads, large dead areas are produced by the coalescence, but these dead tissues do not drop out. Stems of young plants of the summer squashes have also been seen to be attacked by the pathogen. These young plants usually succumb to the injury caused to the growing points of the plant when it is infected. The symptoms of the disease on winter squash (Cucurbita moschata) [31] include fruit surface having circular water-soaked spots of 3 to 6 mm in width. These spots are somewhat sunken with the presence of sticky golden exudates.

These marks enlarge and became angular on ageing. Transverse section of the spot showed bacteria oozing out of the cut surface. It was later established that the symptoms on cucumber resemble that of angular leaf spots in features such as vein constraints, water-soaked spots on leaves with or in the absence of yellow halo and water-soaked injuries on fruits which may be deformed. The water-soaked spots on the leaves expand bit by bit to be later confined by the secondary veins [32].

On watermelon (Citrullus lanatus) leaves, the bacterium gives rise to angular and water-soaked spots with a chlorotic halo, which often becomes necrotic [21]. Along with this, scab-like lesions were also observed on fruits [20].

In case of bottle gourd, the disease appears on almost all plant parts of the crop [13]. Initially, small marginal chlorotic spots are formed on the margins of the leaves of any age group, which later merge and enlarge towards the centre of the leaf. In the later stages, these chlorotic spots convert into dead brown necrotic lesions and may cover the entire leaf lamina. These necrotic lesions do not drop as in the case of angular leaf spots. As the disease progresses, symptoms in the form of necrotic lesions may be seen developing on other plant parts such as stem/vine, tendrils and floral parts. In extreme cases, amber-coloured bacterial ooze is seen splitting the vine in two. In case of an attack on female flowers of the crop, the stigma and ovary rot, resulting in no fruit formation. On young fruits, the symptoms appear as water-soaked spots, which later lead to rotting of the entire fruit. On mature bottle gourd fruit, faint spots are visible, which later split to release amber-coloured bacterial ooze. Small, dark and angular lesions were observed on bottle gourd leaves, while the skin of the fruit showed soft, water-soaked dark green spots, which later changed into watery soft rot.

On pumpkin [26] foremost symptoms observed were small dark brown spots on the cotyledons itself. The margins of leaves of adult plants show chlorosis and necrotic spots, which later coalesce and finally give a dead brown colour appearance to the leaves. The necrotic areas on leaves do not fall, unlike angular leaf spots. The characteristic lesions on fruits begin with small oily, slightly depressed spots with a yellow border. The disease is also occasionally seen on stems along with fruits. In damp weather, amber-coloured ooze can be seen on the fruits. Lesions on pumpkin fruits have been described as scab-like [22]. On the foliage, water-soaked lesions are seen, which later turn brown with a prominent yellow halo. On enlarging, the lesions are observed to be limited by the veins, becoming angular. Pumpkin leaves develop small (1–2 mm) lesions, with indefinite yellow edges that may merge to form bigger necrotic areas usually on the leaf edges [17]. On pumpkin fruits, the appearance and types of symptoms may vary depending upon rind maturity and the presence of moisture. Initial lesions on fruits are small, sunken and circular spots ranging from 1/6 to 1/4 inch in diameter. These have a beige centre with dark brown halo. Later, the cuticle and epidermis break and the abrasion grows in size to be 1/2 inch in diameter. These huge lesions have a scab-like appearance and give rise to tan-coloured blisters. Bacterial leaf spot symptoms may develop on foliage as well as fruit. Small, round water-soaked symptoms can be seen on the underside of the leaves [33]. The corresponding upper surface of the leaf soon develops a yellow spot that later turns brown with a distinguished yellow halo. The leaf lesions usually remain small or may increase to about 7 mm in width. As they grow, they become angular, due to the constrictions offered by leaf veins. Another study outlined pumpkin lesions to have 1–4 mm irregular tan lesions with a yellow halo, while the matured ones displayed 1–4 mm tan-coloured sunken spots with dark brown borders, which later developed into severe soft rot [30]. Three different types of lesions were described on leaves of pumpkins based on the variation in colour and size. These ranged from small brown necrotic spots (1 mm) on leaves to angular spots (1–4 mm), with brown halo and beige centres. Small (1 mm), numerous, angular, tan-coloured necrotic spots on the leaves fall under Type 1 lesions. Spots with a beige centre and brown halo with an estimated size of 1–4 mm fall under Type 2 lesion category. Translucent angular spots with chlorotic halo, which are few in number on the leaf and measure up to 4 to 8 mm in diameter, fall under Type 3 lesions. Lesions on pumpkin, winter squash and gourd leaves are small up to 1.7 mm initially and enlarge to 1.7–3.81 mm in size [29]. Similarly, the circular spots on fruits are observed to be 1–2.5 mm initially, which enlarge to about 15.24 mm in diameter. In another study, symptoms on both upper and lower surfaces of the leaves were noticed but not on the fruit [25]. Lesions on the leaves are small, marginally sunken round spots with a beige centre and dark brown halo. On fruits, small, earthy-coloured spots appear, which later turn into necrotic spots attacked by saprophytes ultimately leading to fruit rot. On leaves, chlorotic spots were seen after rain storms in July, which later turned necrotic and coalesced (Figure 1) [23].

Figure 1.

Symptoms of Xanthomonas cucurbitae on different host: (a) leaf, (b) twig, (c) flower, (d) stem and (e,f,g) fruit of bottle gourd. (h) Bacterial spot infected field area (i) leaves of sponge gourd (J,k) leaves and fruit of pumpkin.

5. Causal organism

Bacterial spot of cucurbits is caused by Xanthomonas cucurbitae (ex. Bryan) Vauterin et al., 1995. Initially, this bacterium was named as Bacterium cucurbitae Bryan, Phytomonas cucurbitae (Bryan) Bergey et al., Pseudomonas cucurbitae (Bryan) Stapp, Xanthomonas cucurbitae (Bryan) Dowson, Xanthomonas campestris pv. cucurbitae (Bryan) Dye and is internally seed-borne in nature [34]. Gram staining test shows that bacterium is Gram-negative. Also, other tests show that it is oxidase-negative and indole-negative, hydrolyses starch and esculin and forms pits on crystal violet pectate and carboxymethyl cellulose media [19]. Bacteria are rod-shaped and colonies are mucoid, circular, smooth textured, convex and glistening with entire margins and yellow in colour having a diameter of about 3–4 mm on nutrient agar medium. This bacterium hydrolyses esculin, which is clear from the blackening of esculin medium within 4 days of inoculation, digests protein which is confirmed as appearance of clear solution within 10 days of inoculation and liquefies gelatin as indicated by the appearance of a clear zone around bacterial growth [13].

6. Pathogenicity and host range

The disease is found and reported on many cucurbits throughout the world after its initial discovery [35]. Concentration of 10⁵ to 10⁸ cfu/ml induces diseases in different cucurbit hosts [28]. Incubation period of 3 to 5 days and 5 to 8 days has been reported on inoculated leaves and fruits, respectively, in the case of bottle gourd, cucumber, pumpkin and squash plants [13], while in inoculated leaves of pumpkin plants have been reported in 10 days [30]. Symptoms appear two days later on fruits in comparison to leaves [13]. T3SS helps to overcome host immunity to suppress MAMPs [36] and to manipulate host genes for infection [37].

7. Cultural studies

Cultural characteristics of bacterium were studied first by Bryan [17]. He described the bacterium as a short, rod-shaped, 0.5 to 1.3 × 0.45 to 0.6 μ in diameter with polar flagellum occurring singly in pairs or in short chains. Bacterium is non-acid fast staining, non spore producing and Gram negative. Colony characters are yellow and opalescent on beef agar. Minimum, maximum and optimum temperatures were found to be 4–6, 34–36, and 24–30°C, respectively, and a pH of 6.5 to 7 has been reported for colony development of X. cucurbitae isolates. [38]. For growth of bacteria, an optimum temperature range of 25 to 30°C and pH range of 6–7 has been reported in case of bottle gourd and pumpkin [28]. Regarding media, Yeast extract calcium carbonate broth has been reported the best followed by nutrient glucose broth for both bottle gourd and pumpkin while nutrient sodium chloride broth is for bottle gourd only [28]. As far as host range of the pathogen is concerned, the disease has been observed on almost all cucurbits including pumpkin, bottle gourd, cucumber, bitter gourd, sponge gourd, watermelon and other melons.

8. Molecular characterisation

Species identification was confirmed by using primers RST2 (5′AGGCCCTGGAAGGTGCCCTGGA3′) and RST3 (5′ATCGCACTGCGTACCGCGCGCGA3′) in PCR resulting in 1500 bp band. Identification of the pathogen was also identified by using the same primers resulting in 840-bp band. Also, amplification and sequencing of 16s rRNA gene resulted in 98 to 99 per cent similarity to X. cucurbitae accessions in GenBank [19]. Amplification of hrpD gene of X. cucurbitae in leaf spot disease of pumpkin was successfully carried out in isolates of X. cucurbitae [38]. PCR of X. cucurbitae with same primers resulted in 1.4 kb amplicon and gyrB rpoD fyuA dnaK resulted in isolate identity [23]. Genome sequencing and functional characterisation of cucurbitae studies lead to the first reference-quality whole-genome sequence of the X. cucurbitae, which isolates and showed that for infection in Pumpkin, both type II enzymes and type III effectors are necessary for infection [35].

9. Survival disease cycle and epidemiology

X. cucurbitae is internally seed borne [34], but exact location of the bacterium in the seed has not been located [27]. It has also been reported to survive on infected crop debris [33]. Fifty-three per cent of seed lots collected from pumpkin fields in Illinois were infected with X. cucurbitae [39]. The pathogen has been subsequently isolated from kernels and shells of naturally infected seeds. It also survives in infected leaves and fruit tissues of pumpkin for up to 24 months [40]. Pathogen is also known to survive in seed for more than 26 months at 4°C [41] and has been isolated from infected seeds even after 2 years of storage [42]. Much work has not been done on X. cucurbitae as yet, but available literature on other species of Xanthomonas reveals that seed is the most common method of survival for different Xanthomonas species.

The bacteria spread very rapidly in fields via rain splash in the soil. Fruit infection occurs through a natural opening or wound in young fruits prior to the development of a thick, waxy cuticle. Leaf infection, however, does not result in plant death of pumpkin, but likely plays a role in providing inoculum for fruit infection, as leaf infection occurs before fruit development. Therefore, control of leaf infection by X. cucurbitae may reduce fruit infection [20]. Long distance dispersal of pathogens is believed to be by contaminated seeds [34].

Disease development of bacterial spots of cucurbits occurs at temperatures ranging from 25–35°C and the pathogen stops spreading above 35°C [43]. The disease is favoured by warm humid weather and frequent rainfall [17, 42]. Temperatures between 25 and30°C with 90 per cent relative air humidity are favourable conditions for disease development [34]. Disease incidence reaches its peak at the end of July and the beginning of August [44].

Bacterial spots of cucurbits are affected by various epidemiological factors viz., inoculation method, sowing of plant and plant age, which ultimately affect the initiation and development of infection. Among various methods of inoculation with isolates of the pathogen, syringe method of inoculation resulted in a minimum incubation period (2.33 and 3.33 days) and maximum disease severity (46.33 and 37.97%) in both bottle gourd and pumpkin, respectively, followed by pinprick method of inoculation. It was found that disease severity decreased with a delay in date of sowing from mid-May to the end of June (27th June) or mid-July (17th July) in pumpkin and bottle gourd [21]. A high disease severity was recorded in early sown (17 May and 7 June) crops [44]. Development of bacterial spots of bottle gourd and pumpkin was favoured by temperatures ranging between 30 and 35°C and relative humidity more than 80 per cent [21]. The plants of bottle gourd and pumpkin at the age of 10, 20 and 30 days were more susceptible to infection as compared to the older plants (40, 50 and 60 days old), which exhibited the presence of adult plant resistance in both the crops against X. cucurbitae [21]. It has been found that disease intensity continuously increases during vegetative phase and reaches its peak at the end of July or beginning of August [34]. Maximum temperature of 33.5°C and 85 per cent RH resulted in the increased disease intensity of bacterial spot of bottle gourd [32].

10. Host resistance

No X. cucurbitae-resistant cultivars have been identified to date. However, adult plant resistance, an enigmatic phenomenon in which resistance genes confer robust resistance at maturity but ineffective at seedling stage of plant [15], has been reported in two cultivars of cucumber viz., collection 72–10 and Japanese Long Green which are moderately resistant against X. cucurbitae [36]. According to Babadoost, no cucurbit cultivar resistant to X. cucurbitae has been found yet [35]. Similar observations have been documented by Jarial et al. in case of bottle gourd where six different genotypes/varieties were observed for disease development and all were found to exhibit susceptible reactions towards the disease [45].

11. Management

Successful management of the disease needs integrated disease management to keep the disease below the economic threshold [46]. Several workers have mentioned various methods for disease management in affected regions of the world including cultural, seed treatments and foliar sprays. Crop rotation with non-cucurbitaceous crops for 2 years or more will decrease the disease levels [47]. Avoidance of overhead irrigation and working in fields when plants are wet (morning dew or after rain) reduces the bacterial spread from diseased to healthy plants [37]. Since the pathogen is seed-borne, disease management initiates with the use of pathogen-free seed [33]. Out of the various chemicals evaluated as seed treatments or foliar sprays against the pathogen, it was found that streptocycline, mancozeb, copper oxychloride, zineb and Bordeaux mixture were effective against the bacterium under in vitro experiments [16]. A seed dip treatment in a combination of streptocycline (100 ppm) plus copper oxychloride (3000 ppm) for 3.0 h has been reported to be quite effective in eliminating the bacterium from naturally infected seed [48].

Frequent foliar application of preventive sprays can help decrease bacterial spread in the field to some extent [37]. It has been reported that eight foliar sprays of chemicals such as plantomycin, paushamycin, streptocycline, Ceresan wet (phenyl mercury acetate), Blitox 50 (copper oxychloride) and captan were quite effective in managing the disease [39]. A management strategy comprising seed treatment with streptocycline (0.01%) plus copper oxychloride (0.3%) and four foliar sprays of the same combination at 10 days interval along with the removal of diseased plant parts regularly during the cropping season is a useful strategy against bacterial spot of bottle gourd [45]. In the field trials, copper oxychloride + copper hydroxide (Badge X2 DF), copper sulphate (Cuprofix Ultra 40 DF), oxytetracycline (Mycoshield 40 WSP), copper sulfate pentahydrate (Phyton-016B), copper hydroxide (Kocide-3000 46.1 DF) plus acibenzolar-s-methyl (ActiGard 50 WG), Kocide-3000 46.1 DF plus famoxadone + cymoxanil (Tanos 50D WG), an extract from Reynoutria sachalinensis (Regalia) and B. subtilis (Serenade ASO) were more effective in reducing incidence and severity of bacterial spot on both leaves and fruit compared to controls [48]. These chemical compounds or biocontrol agents may be used in combination with other methods to manage X. cucurbitae in pumpkins. It was found that a chemical combination comprising streptocycline (100 ppm) + captan (2500 ppm) proved effective in controlling the pathogen and disease both under in vitro and pot house conditions [49].

12. Conclusions

The gourd family or Cucurbitaceae is the second largest family among fruits and vegetables next to Solanaceae and contains edible crops such as cucumber, pumpkin and melon. Bacterial leaf spot is caused by X. cucurbitae and was reported for the first time on Hubbard squash in New York in 1926. Initially, the bacterium was named Bacterium cucurbitae by Bryan, later Phytomonas cucurbitae (Bryan) Bergey et al., Pseudomonas cucurbitae (Bryan) Stapp, Xanthomonas cucurbitae (Bryan) Dowson, Xanthomonas campestris pv. cucurbitae (Bryan) Dye. It is one of the most important diseases of cucurbits such as watermelon, pumpkin, bottle gourd, cucumber and squashes in the world and leads to huge losses of up to 100 per cent. The disease has been reported to be prevalent on leaves and fruits of different cucurbits, such as watermelon, pumpkin, bottle gourd, cucumber and squashes. The bacterium has been known to enter through the stomata on leaves. As the infection spreads, large dead areas are produced by the coalescence, but these dead tissues do not drop out. Stems of young plants of the summer squashes have also been seen to be attacked by the pathogen. These young plants usually succumb to the injury caused to the growing points of the plant when it is infected. This disease is favoured by warm humid weather and frequent rainfall. Bacteria is Gram negative, rod shaped. Colonies are yellow, mucoid, circular, smooth textured, convex and entire margins are glistening with diameter of about 3–4 mm diameter, oxidase-negative, indole-negative; hydrolyzes starch and esculin and forms pits on crystal violet pectate and carboxymethyl cellulose media. Minimum, maximum and optimum temperatures were found to be 4–6, 34–36, and 24–30°C, respectively, and a pH of 6.5 to 7 has been reported for colony development of X. cucurbitae isolates. Pathogen is internally seed-borne and also perpetuates in infected crop debris. Pathogen is also known to survive in seed for more than 26 months at 4°C and has been isolated from infected seeds even after 2 years of storage. Much work has not been done on X. cucurbitae as yet, but available literature on other species of Xanthomonas reveals that seed is the most common method of survival for different Xanthomonas species. No X. cucurbitae-resistant cultivars have been identified to date. Since the pathogen is seed-borne, disease management initiates with the use of pathogen-free seed. Crop rotation with non-cucurbitaceous crops for 2 years or more will decrease the disease levels. However, Streptocycline reduces the disease severity up to some extent in the field. Current research is being conducted on molecular characterisation of different isolates and possible management strategies along with antibiotics.

Conflict of interest

The authors declare no conflict of interest.