Selection of primers used in RAPD analyses of
1. Introduction
Protozoan parasites of the genus
The current identification and classification of
Indeed, the diversity of
Molecular tools are based mainly on the amplification and subsequent restriction fragment length polymorphism (PCR-RFLP) of several targets including repeated gene families and coding and non-coding regions, or the sequence analysis of the products. Recently multilocus sequence typing (MLST) and multilocus microsatellite typing (MLMT) were also developed for
2. Parasite identification
2.1. Differentiation at the genus level
This is based on the amplification of the kinetoplast minicircle DNA (kDNA, about 10000 copies per cell) or the variable sequences of the small subunit ribosomal DNA genes (SSU rDNA, 40–200 copies per cell) [10–13].
kDNA and SSU rDNA primers were initially designed for Trypanosomatids including
2.2. Differentiation at the species level
The ability to distinguish between
Numerous PCR approaches have been published based on different coding and non-coding regions in the
2.2.1. Randomly amplified polymorphic DNA (RAPD) and anonymous markers
Randomly amplified polymorphic DNA (RAPD) technique is based on the PCR amplification of DNA fragments using only one short primer that was arbitrarily defined and thus could be applied to any organism without a prior knowledge on the genome [27]. Such primers correspond to decamers having 60-70 % GC content and no self-complementary ends, thus the number of primers that could be used is virtually unlimited. Only in few occasions, two primers were used for
Potential of RAPD and a selection of 28 primers was assessed for the discrimination between members of the
|
|
|
|
|
|
OPA-01 | CAGGCCCTTC | [30,34,36,43,44] | OPR-16 | CTCTGCGCGT | [38] |
H4 (OPA-02) | TGCCGAGCTG | [31,41,46] | OPR-20 | ACGGCAAGGA | [38] |
C4 (OPA-04) | AATCGGGCTG | [41] | OPU-15 | ACGGGCCAGT | [38] |
A5, P8, (OPA-05) | AGGGGTCTTG | [31,38,41,48] | OPU-16 | CTGCGCTGGA | [38] |
A4, (OPA-07) | GAAACGGGTG | [30,31,36,41,43] | OPU-02 | CTGAGGTCTC | [43] |
OPA-08 | GTGACGTAGG | [28,30,31,33] | ILO 509 | TGGTCAGTGA | [42] |
OPA-09 | GGGTAACGCC | [31] | ILO 526 | GCCGTCCGA | [42] |
OPA-10 | GTGATCGCAG | [28,30,31,36,38,43,48] | ILO 872 | CCCGCCATCT | [42] |
A12 (OPA-12) | TCGGCGATAG | [41] | ILO875 | GTCCGTGAGC | [41,42] |
A15 (OPA-15) | TTCCGAACCC | [41] | ILO 876 | GGGACGTCTC | [42] |
D10 (OPA-20) | GTTGCGATCC | [41] | ILO 878 | GTCGCGGAG | [42] |
D8 (OPA-16) | AGCCAGCGAA | [41] | A5, C5 | CTCACGTAGG | [39,41] |
OPB-01 | GTTTCGCTCC | [30] | C6 | CTGATCGCAG | [41] |
C (OPB-04) | GGACTGGAGT | [28,33,43,44] | L2 | CGGACGTCGC | [41] |
B5 (OPB-05) | TGCGCCCTTC | [41] | H1 | CGCGCCCGCT | [39,41] |
B6 (OPB-06) | TGCTCTGCCC | [41] | L15996 | CTCCACCATTAGCACCCAAAGC | [29,32] |
OPB-07 | GGTGACGCAG | [30,41] | λg11R | TTGACACCAGACCAACTGGTAAT | [29,32] |
OPB-08 | GTCCACACGG | [38,41] | M13a, M13 | GTAAAACGACGGCCAGT | [30,33] |
OPB-09 | TGGGGGACTC | [30,33] | M13-40 F/ M13 (−40) a | GTTTTCCCAGTCACGAC | [29,30,32] |
OPB-10 | CTGCTGGGAC | [43,44] | M13/pUC | CGCCAGGGTTTTCCCAGTCACGA | [31] |
OPB-12 | CCTTGACGCA | [30,41] | P53-1 | ACGACAGGGCTGGTTGCCCA | [32] |
OPB-13 | TTCCCCCGCT | [33,41] | PLiD2-9 | CAAAAGTCCCCACCAATCCC | [42] |
OPB-15 | GGAGGGTGTT | [30,43] | QG1 | CCATTAGCACCCAAAGCAGACCTCACCCTGTGGAGC | [29,32] |
A (OPB-18) | CCACAGCAGT | [28,30,33] | TA150 | ATGCGATGAGTGGTTGAG | [41,42] |
OPF-01 | ACGGATCCTG | [38] | TA610 | TCAACCGATTACAAACCA | [42] |
OPF-10 | GGAAGCTTGG | [43,44] | UMS | GGGGTTGGTGTA | [31,46] |
OPF-13 | GGCTGCAGAA | [38,43] | 37 | TGGATCCGGAATTTCGGCTTCACTAC | [42] |
OPN-13 | AGCGTCACTC | [38] | 198 | GCAGGACTGC | [41] |
OPN-20 | GGTGCTCCGT | [38] | 233 | CTATGCGCGC | [35] |
OPR-13 | GGACGACAAG | [38] | 283 | CGGCCACCGT | [35,48] |
OPR-14 | CAGGATTCCC | [38] | 3301 | TCGTAGCCAA | [30,33] |
OPR-15 | GGACAACGAG | [38,43,44] |
We have used the RAPD technique to identify and discriminate Old World species using 57 strains from different hosts, countries and reservoirs. Six random primers were tested from which 3 allowed to distinguish
Random amplification of polymorphic DNA has been also used alone or with other techniques to confirm taxonomic status of parasites, for instance putative natural hybrids such as
The RAPD technique was also used to investigate genetic diversity within
In Corte Pedra, North Eastern Brazil,
The RAPD technique has also been used to investigate epidemiology of leishmaniases, characterizing clinical or field isolates in diverse settings. For instance, in India the increasing reports on drug resistance of the VL patients and the implication of
In addition, RAPD technique constitutes a powerful alternative to the identification of PCR targets and markers. RAPD markers have been exploited for the design of species or complex specific PCR assays like for instance a PCR that only amplifies DNA of parasites of the
Randomly amplified polymorphic DNA products were used to develop markers that were targeted to develop typing strategies. For example, RAPD products that were amplified consistently across tested DNAs with a combination of 2 primers have been selected and sequenced partially to design marker specific PCR primers. The resulting PCR products were then screened for single stranded conformation polymorphisms (SSCP) and subsequently confirmed by sequence analysis [50]. This sequence confirmed amplified region analysis (SCAR) approach was used to differentiate 29
Alternatively, with the objective to identify markers and develop simple assays for the discrimination of viscerotropic parasites encountered in Africa, we have screened 5 Operon kits (100 primers) for reproducible profiles and a selection of 28 primers was then used to screen for DNA markers within a panel of viscerotropic parasites from different countries in Africa and India [51]. These primers organized the parasites according to their geographical origin in a similar way to other studies using RAPD or other types of tools [39,41]. Some of the differentially amplified RAPD bands obtained in our study were cloned and sequenced; their analysis with bioinformatics tools and comparison to their respective genomic sites in
Randomly amplified polymorphic DNA is highly suitable for analysis of cultured
2.2.2. Gp63 PCR-RFLP and sequencing analyses
Gp63 genes encode for the major metalloprotease of
|
|
|
|
|
|||
|
|
||||||
|
(F) Pia1: ACGAGGTCAGCTCCACTCC | 100 | - | - | [11,13] | ||
(R) Pia2: CTGCAACGCCTGTGTCTACG | - | - | |||||
(F) Pia3: CGGCTTCGCACCATGCGGTG | 260 | - | - | ||||
(R) Pia4: ACATCCCTGCCCACATACGC | - | - | |||||
(F) K13A : GTGGGGGAGGGGCGTTCT | 120 | ||||||
(R) K13B: ATTTTACACCAACCCCCAGTT | |||||||
(F) RV1: CTTTTCTGGTCCCGCGGGTAGG | 145 | ||||||
(R) RV2: CCACCTGGCCTATTTTACACCA | |||||||
|
(F) R221: GGTTCCTTTCCTGATTTACG (R) R332: GGCCGGTAAAGGCCGAATAG |
603 | + | + | [10] | ||
|
(F) TDM1: GTCTCCACCGCAGACCTCACGGA (R) TDM2: TGATGTAGCTGCCATTCACGAAG |
1300 | + | - | [20] | ||
(F) SG1: GTCTCCACCGAGGACCTCACCGA | 1300 | + | - | [21] | |||
(R) SG2: TGATGTAGCCGCCCTCCTCGAAG | |||||||
(F) PDD1: TCGGTGAGGTCCTCGGTGGAGAC | 1700 | + | - | ||||
(R) PDD2: CTTCGAGGAGGGCGGCTACATCA | |||||||
(F) C9F: GGCTCCCGACGTGAGTTA | 1750 | + | - | [58] | |||
(R) C1R: GGGCCCGGGCGACAGCAGCGATGACTG | |||||||
(F) C10F: GGGAAGCTTACGTACAGCGTGCAGGTG | 1600, 2000 and 4500 | + | - | ||||
(R) C1R: GGGCCCGGGCGACAGCAGCGATGACTG | |||||||
|
(F) LITSV: ACACTCAGGTCTGTAAAC (R) LITSR: CTGGATCATTTTCCGATG |
1040 or 950–1100 |
+ + |
+ + |
[64,65,69] | ||
|
(F) IR1: GCTGTAGGTGAACCTGCAGCAGCTGGATCATT (R) IR2: GCGGGTAGTCCI’GCCAAACACTCAGGTCTG |
1000–1200 | + | - | [16] | ||
(F) LITSR: CTGGATCATTTTCCGATG (R) L5.8S: TGATACCACTTATCGCACTT |
300–350 | + | + | [12,13,61,65,82] | |||
|
(F) LGITSF2: GCATGCCATATTCTCAGTGTC (R) LGITSR2: GGCCAACGCGAAGTTGAATTC |
372–450 | - | + | [63] | ||
(F) L5.8SR: AAGTGCG-ATAAGTGGTA (R) LITSV: ACACTCAGGTCTGTAAAC |
720 | - | + | [65] | |||
|
(F) LITS-MG: ATG GCC AAC GCG AAG TTG (R) LITSR: CTGGATCATTTTCCGATG |
800 | - | + | [69] | ||
|
PCR-G : (F) HSP70sen: GACGGTGCCTGCCTACTTCAA (R) HSP70ant: CCGCCCATGCTCTGGTACATC |
1422 | + | - | [22,72] | ||
PCR-F : (F) F25: GGACGCCGGCACGATTKCT (R) R1310: CCTGGTTGTTGTTCAGCCACTC |
1286 | + | - | [73–75] | |||
PCR-N : (F) F25: GGACGCCGGCACGATTKCT (R) R617: CGAAGAAGTCCGATACGAGGGA |
593 | + | - | ||||
PCR-C : (F) F251: GACAACCGCCTCGTCACGTTC (R) R991: GTCGAACGTCACCTCGATCTGC |
741 | + | - | ||||
(F) HSP70sen: GACGGTGCCTGCCTACTTCAA (R) HSP70ant: CCGCCCATGCTCTGGTACATC |
1422 | - | + | [23] | |||
(F) HSP70-F335 CACGCTGTCGTCCGCGACG (R) HSP70-R429 AACAGGTCGCCGCACAGCTCC |
113 | - | + | ||||
(F) HSP70-2F CTGAACAAGAGCATCAACCC (R) HSP70-2R CTTGATCAGCGCCGTCATCAC |
170 | - | + | ||||
(F) HSP70-F893 GTTCGACCTGTCCGGCATCC (R) HSP70-R1005 GTGATCTGGTTGCGCTTGCC |
130 | - | + | ||||
PCR-F : (F) HSP70-F25: GGACGCCGGCACGATTKCT (R) HSP70-R1310: CCTGGTTGTTGTTCAGCCACTC |
1286 | - | + | [76] | |||
PCR-T : (F) HSP70-6F GTGCACGACGTGGTGCTGGTG (R) HSP70-R1310: CCTGGTTGTTGTTCAGCCACTC |
766 | - | + | ||||
PCR-N : (F) HSP70-F25: GGACGCCGGCACGATTKCT (R) HSP70-R617 CGAAGAAGTCCGATACGAGGGA |
593 | - | + | ||||
3’UTR : (F) 70-IR-D: CCAAGGTCGAGGAGGTCGACTA (R) 70-IR-M: ACGGGTAGGGGGAGGAAAGA |
516–733 | - | + | [77] | |||
|
(F) Fme: TATTGGTATGCGAAACTTCCG (R) Rme: GAAACTGATACTTATATAGCG |
220–443 | + | + | [19,13,78] | ||
(F) FME2: ACTTCCGGAACCTGTCTTCC ( (R) ME2R: CAGAAACTGATACTTATATAGCGTTA |
220–443 | + | + | [82] | |||
|
intragenic region : (F) CPBFOR: CGAACTTCGAGCGCAACCT (R) CPBREV: CAGCCCAGGACCAAAGCAA |
1079 | + | - | [83,84] | ||
Intergenic region : (F) PIGS1A: CCTCATTGCTTTGGTCCTGG (R) PIGS2B: GGCGTGCCCACGTATATCGC |
1600 | + | - | ||||
(F) CGTGACGCCGGTGAAGAAT (R) CGTGCACTCGGCCGTCTT |
702–741 | - | - | [25,85] | |||
(F) CGTGACGCCGGTGAAGAAT (R) CGTGCACTCGGCCGTCTT |
702–741 | + | + | [26] | |||
(F) LmcpbUNIF: ACGGTCTTAGCGTGCGAGTTGTG (R) LmcpbUNIR: CAAGGAGGTCCCCTCACGCG |
1440 | - | + | [85] | |||
(F) LmcpbUNIF: ACGGTCTTAGCGTGCGAGTTGTG (R) LmcpbR: TCGTGCAGCACATGTCGCTTG |
1176 | - | + | ||||
(F) cpbEF For: CGTGACGCCGGTGAAGAAT (R) L. inf Rev: CGTTTCGTTGCTCGGGATCAT |
325 | - | - | ||||
(F) LmcpbUNIF: ACGGTCTTAGCGTGCGAGTTGTG (R) Ltro Rev: ACAGGGCCGTCAGCCCGTGGC |
600 | - | - | ||||
(F) infcpbE: GTCTTACCAGAGCGGAGTGCTACT (R) Inf2.1: ATAACCAGCCATTCGGTTTTG |
278 | - | - | [86] | |||
(F) cpbF2.1: GCGGCGTGATGACCAGC (R) Do2.1: CAATAACCAGCCATTCGTTTTTA |
309 | - | - | ||||
(F) MATRAE2: GGCGATGGTGGAGCAGATGATCT | - | - | |||||
(R) Ma4.1: CGGTTCTCGTAGCACACTTGTTG | 99 ( |
||||||
(R) Tr4.1: CTCCCCCGTTCGGAT | 100 ( |
||||||
(R) Ae2.1: AGTACGTGCACATCAGCACATGGG | 154 ( |
||||||
(F) V5F: GGTGATGTGCCCGAGTGCA (R) V10R: CGTGCACATCAGCACATGGG |
564 | - | - | ||||
(F) CpbF: GTGCGTGCGGGTCGTGC (R) CpbR: AAAGCCCCGGACCAAAGCA |
735 | - | - | [87] |
Gp63 PCR-RFLP tool was also used to characterize isolates representative of the
Furthermore, still using gp63 coding sequences PCR-RFLP evaluated intra-specific polymorphism of
The gp63 PCR-RFLP method was applied to characterise parasites contained within the lesions of patients having cutaneous leishmaniasis, originating from areas in central Tunisia, known to be free of CL. This analysis confirmed assignment of the parasites to the
The gp63 PCR associated to RFLP analysis was also used to characterise transmitted
Another PCR-RFLP analysis of the gp63 intergenic region was also developed and tested on the
Although the gp63 PCR RFLP technique has been successfully used for
2.2.3. ITS1 PCR–RFLP and ITS2 targets
Ribosomal RNA (rRNA) genes are highly repetitive and conserved sequences. The ITS1 region is the sequence in between the 18S rRNA and 5.8S rRNA genes. It has enough conservation to serve as a PCR target but sufficient polymorphisms to facilitate species typing. ITS1 PCR has been developed in combination with an RFLP analysis (Table2) with different restriction enzymes (
It has been applied for the distinction of sympatric species, especially in the Mediterranean region [59,60]. However, representatives of the
Recently, real-time PCR product from the ITS1 region has been used in a high-resolution melt (HRM) analysis in order to identify and quantify Old World
The ITS2 region is located in between the 5.8S rRNA and LSU rRNA genes. It has been studied and found to be adequate for species identification. Indeed, generic PCR primers (LGITSF2/LGITSR2) were designed to amplify this fragment from
The ITS1 and ITS2 region have also been used to assess intra-specific DNA polymorphisms among
When the species
Recently, authors from Iran used primers LITSR and LITSV to amplify whole ITS region and found a double banded electrophoretic pattern in
Although PCR-RFLP of the ITS1 spacer is the most widely used assay for direct detection and identification of
2.2.4. hsp70 PCR–RFLP and sequencing
The 70kDa heat-shock proteins (HSP70) are encoded by genes that are highly conserved across prokaryotes and eukaryotes both in sequence and function. They have great importance as molecular chaperones in protein folding and transport [70]. Genes encoding cytoplasmic HSP70s were among the first kinetoplastid genes that were cloned and characterized because of their conserved nature [71]. HSP70 protein and its encoding gene have been widely used for phylogenetic and taxonomic studies of different parasites, including
The PCR-RFLP approach targeting hsp70 sequences has proven to be most useful for the differentiation between South American
In order to improve the sensitivity and specificity of the previously reported hsp70 PCR, alternative PCR primers and RFLPs were used [73] (Table2). Thus, three new PCR primer sets (PCR-F, PCR-N, and PCR-C) and their corresponding restriction scheme (RFLP-F, RFLP-N, and RFLP-C) were tested. The detection limit of the new PCRs was between 0.05 and 0.5 parasite genomes; they amplified clinical samples more efficiently, and were
Relevance of the hsp70 PCR-RFLP approach [72–74] is illustrated by a study that applied it on 89 clinical samples from a total of 73 Peruvian patients with either cutaneous or mucocutaneous leishmaniasis. The new PCRs were tested on tissue samples, lesion biopsies, aspirates, and scrapings. They showed an improved sensitivity both for genus detection and species typing and identified the species
In addition to PCR-RFLP analysis, the hsp70 gene was also used in sequencing. Indeed, the 1380bp fragment of the coding region commonly used in RFLP analysis was sequenced in 43 isolates from different geographic origins for studying evolutionary relationships [23]. Fifty-two hsp70 sequences representing 17 species commonly causing leishmaniasis both in the New and Old World were analyzed. The authors found that the genus
The 3’-untranslated region (UTR) of hsp70-type I gene constitutes an alternative target for sequence analysis [77]. These authors who used it to analyse 24 strains representing 11
Using hsp70 gene in PCR followed by RFLP or sequence analysis presents many advantages. It is easily comparable across all
2.2.5. Mini-exon PCR-RFLP
The mini-exon genes are involved in the trans-splicing process of nuclear mRNA in kinetoplastid protozoa and are present as 100 to 200 tandemly repeated copies per nuclear genome. Mini-exon genes contain a highly conserved exon of 39 bp with a moderately variable transcribed intron region (55 to 101 bp) and a highly variable non-transcribed spacer sequence (51 to 341 bp). These genes were extensively used as a PCR target to identify and discriminate Old and New World
This genotyping method was successfully applied to naturally infected clinical samples for the differentiation of New and Old World
Recently, mini-exon PCR-RFLP was compared to the ITS1 PCR RFLP approach on a set of reference strains [82]. The ITS1 PCR proved to be slightly more sensitive and more practical than the mini-exon. Analysis using the ITS1 digested with
2.2.6. Cysteine protease B (cpb) based PCR and PCR RFLP
Cpb genes are multicopy genes that encode for cathepsin L-like cysteine proteinase B (cpb), a major antigen of
PCR RFLP assays targeting cpb genes and their non-coding inter-genic sequences were also developed and applied for characterization of strains from the
Different species–specific PCR assays were developed using these genes as target. PCR assays discriminating
Five species-specific PCR tests that can discriminate each of the Old World species:
However, upon sequencing of the cpb- coding region in clinical isolates of
Recently, primers developed in [25] were used and new ones were designed, to set up three species-specific PCR assays based on the amplification of different copies and parts of the cpb genes (Table2) [85]. They allowed amplification of 1176bp, 600bp and 325bp fragments, thus discriminating between Old World Tunisian
Multi-copy cpb genes have been recently used to develop a species–specific
Cpb coding sequence and UTR targets have a proven and good potential to characterize or identify
2.2.7. Cytochrome gene sequencing
Cytochromes are involved in the electron transport process of the mitochondrial respiratory chain. They are considered one of the most useful genes for taxonomy given their slow evolution rate. They were used for discrimination of
Cytochrome b (
Since that,
This target is a slow evolving DNA molecule and is thus considered as a good marker for phylogeny. Being located on the mitochondrial maxicercle, the copy number constitutes another advantage. Given demonstration of natural genetic exchange experimentally [99] and naturally [100], these targets known to have a monoparental transmission (also confirmed for
2.2.8. Other molecular tools
Several other molecular tools have also been used for identification and characterization of
In recent years, quantitative PCR methods based either on SYBR Green or TaqMan technology have been set up for the quantification of
Amplified fragment length polymorphism (AFLP) has also been developed for
Assays using alternative amplification technologies such as quantitative nucleic acid sequence-based amplification (QT-NASBA) based on amplification of 18S RNA or Loop mediated isothermal amplification (LAMP) targeting rRNA, kinetoplast DNA or a multigenic family were also tested on
3. Strain typing
3.1. Multilocus sequence typing (MLST)
Multilocus sequence typing (MLST) refers to analysis based on the DNA sequence of multiple gene targets. It is based on the comparison of partial sequences (usually 700 bp) of a defined set of housekeeping genes. Similarly to MLEE, alleles are scored as identical or not, regardless of how many different polymorphic loci they have. Strains sharing the same allele combinations for the set of genes tested are referred to as sequence types. MLST is able to detect co-dominant single nucleotide polymorphisms (SNP) and although indels can complicate the analysis, they are extremely rare in protein-coding genes.
The first
MLST using 6 gene targets that are not associated with MLEE analysis (inorganic pyrophosphatase, spermidine synthase 1, hypoxanthine-guanine phosphoribosyl transferase, mitogen-activated protein kinase, RNA polymerase II largest sub-unit and adenylate kinase 2) have been used to characterize suspected
In the New World, four housekeeping genes (glucose-6-phosphate dehydrogenase (G6PD), 6-phosphogluconate dehydrogenase (6PGD), mannose phosphate isomerase (MPI) and isocitrate dehydrogenase (ICD)) were sequenced from 96
The main advantage of MLST is the possibility of generating genus-wide phylogenies, since MLST markers are co-dominant and are amenable for population and phylogenetic analyses. Also, given the high quality of sequence data, results can be easily compared between laboratories. Compared to MLEE, MLST does not necessarily require sterile culture of parasites. In addition, simultaneous typing of reference strains and sequencing can be done commercially without in-house specialized equipment. For those reasons, MLST is likely to become the gold standard basis for taxonomy and thus identification of
3.2. Multilocus microsatellite typing (MLMT)
Microsatellites are repeated motives of 1–6 nucleotide(s), which present allelic length variation. They mutate fast, therefore, 10–20 independent markers have to be analyzed for each strain owing to homoplasy. Microsatellite sequence variation results from the gain and loss of repeat units, which can easily be detected after amplification with specific primers annealing to their flanking regions. Then length polymorphisms are detected using PAGE, MetaPhor agarose gel electrophoresis or, preferably, automated capillary sequencers. A multilocus microsatellite profile is compiled for each sample from the fragment length measured for the microsatellite markers analyzed.
During the last years, microsatellite-based approaches have been developed for strain typing within the genus
3.2.1. Subgenus L. Leishmania
3.2.1.1. L. donovani complex
Within the
Different genetic groups of strains of
In Spain,
Analysis of
Within the
Analysis of
3.2.1.2. L. tropica
MLMT technique was also applied for
3.2.1.3. L. major
Concerning
3.2.2. Subgenus L. Viannia
Within the New World
In another study, polymorphisms of 30 strains of
Recently, 28 strains of the main species of the
All together, these studies confirmed that microsatellite markers constitute good tools for typing and population genetic studies of
4. Leishmania parasite evolution, genetics and genome analyses – Consequences and prospects
For many years
MLMT analysis showed that recombination events are much more frequent in
Also,
The fact that
New high-throughput sequencing technologies have opened the door for population genome analyses and genome-wide association studies. Genome of the
Genomic research on
Novel genomics technologies are expected to bring more powerful tools to characterize the pathogens and particularly the infectious stages of
Genome-wide multilocus genotyping in malaria research through novel sequencing technologies has allowed the identification of almost 47000 single nucleotide polymorphisms (SNPs) across the
5. Conclusion
Epidemiological, taxonomic and population genetic studies of
At the strain level differentiation, MLMT has potential for being a gold standard, because on its principle it is expected to be reproducible and brings possibility of data storage and exchange. However, microsatellite markers are largely species-specific in
Parasite knowledge is so far built on strains obtained
In spite of the increasing potential of sophisticated technologies and techniques, some disease endemic areas still need simple assays for eco-epidemiological investigations or diagnosis as well as capacity building in this highly relevant area to disease control.
Acknowledgments
Research on
References
- 1.
Lainson R, Shaw JJ. New World leishmaniasis–the neotropical Leishmania species. In: Cox FEG, Kreier JP, Wakelin D, editors. Topley & Wilson’s Microbiology and Microbial Infections . London: Arnold; 1998. - 2.
Sacks DL, Kenney RT, Kreutzer RD, Jaffe CL, Gupta AK, Sharma MC, et al. Indian kala-azar caused byLeishmania tropica .Lancet . 1995 Apr 15;345(8955):959-61. - 3.
Alvar J, Vélez ID, Bern C, Herrero M, Desjeux P, Cano J, et al.; WHO Leishmaniasis Control Team. Leishmaniasis worldwide and global estimates of its incidence. PLoS One . 2012;7(5):e35671. - 4.
Guizani I, Mukhtar M, Alvar J, Ben Abderrazak S, Shaw J. (2011) Leishmaniases. In: Nriagu JO, editor. Encyclopedia of Environmental Health , volume 3, pp. 453–480. Burlington: Elsevier; 2011. - 5.
Schönian G, Mauricio I, Gramiccia M, Cañavate C, Boelaert M, Dujardin JC. Leishmaniases in the Mediterranean in the era of molecular epidemiology. Trends Parasitol . 2008 Mar;24(3):135-42. - 6.
Jamjoom MB, Ashford RW, Bates PA, Chance ML, Kemp SJ, Watts PC, et al. Leishmania donovani is the only cause of visceral leishmaniaisis in East Africa; previous descriptions of L. infantum and “L. archibaldi” from this region are a consequence of convergent evolution in the isoenzyme data.Parasitology . 2004 Oct;129(Pt 4):399-409. - 7.
Mauricio IL, Yeo M, Baghaei M, Doto D, Pratlong F, Zemanova E, et al. Towards multilocus sequence typing of the Leishmania donovani complex: resolving genotypes and haplotypes for five polymorphic metabolic enzymes (ASAT, GPI, NH1, NH2, PGD).Int J Parasitol . 2006 Jun;36(7):757-69. - 8.
Zemanová E, Jirků M, Mauricio IL, Horák A, Miles MA, Lukes J. The Leishmania donovani complex: genotypes of five metabolic enzymes (ICD, ME, MPI, G6PDH, and FH), new targets for multilocus sequence typing. Int J Parasitol . 2007 Feb;37(2):149-60. - 9.
Alam MZ, Haralambous C, Kuhls K, Gouzelou E, Sgouras D, Soteriadou K, et al. The paraphyletic composition of Leishmania donovani zymodeme MON-37 revealed by multilocus microsatellite typing.Microbes Infect . 2009 May-Jun;11(6-7):707-15. - 10.
Van Eys GJ, Schoone GJ, Kroon NC, Ebeling SB. Sequence analysis of small subunit ribosomal RNA genes and its use for detection and identification of Leishmania parasites. Mol Biochem Parasitol . 1992 Mar;51(1):133-42. - 11.
Lachaud L, Marchergui-Hammami S, Chabbert E, Dereure J, Dedet JP, Bastien P. Comparison of six PCR methods using peripheral blood for detection of canine visceral leishmaniasis. J Clin Microbiol . 2002 Jan;40(1):210-5. - 12.
Schönian G, Nasereddin A, Dinse N, Schweynoch C, Schallig HD, Presber W, et al. PCR diagnosis and characterization of Leishmania in local and imported clinical samples.Diagn Microbiol Infect Dis . 2003 Sep;47(1):349-58. - 13.
Bensoussan E, Nasereddin A, Jonas F, Schnur LF, Jaffe CL. Comparison of PCR assays for diagnosis of cutaneous leishmaniasis. J Clin Microbiol . 2006 Apr;44(4):1435-9. - 14.
Nicolas L, Prina E, Lang T, Milon G. Real-time PCR for detection and quantitation of leishmania in mouse tissues. J Clin Microbiol . 2002 May;40(5):1666-9. - 15.
Schulz A, Mellenthin K, Schönian G, Fleischer B, Drosten C. Detection, differentiation, and quantitation of pathogenic leishmania organisms by a fluorescence resonance energy transfer-based real-time PCR assay. J Clin Microbiol . 2003 Apr;41(4):1529-35. - 16.
Cupolillo E, Grimaldi Júnior G, Momen H, Beverley SM. Intergenic region typing (IRT): a rapid molecular approach to the characterization and evolution of Leishmania. Mol Biochem Parasitol . 1995 Jul;73(1-2):145-55. - 17.
Nasereddin A, Bensoussan-Hermano E, Schönian G, Baneth G, Jaffe CL. Molecular diagnosis and species identification of Old World cutaneous leishmaniasis using a reverse line blot hybridization assay. J Clin Microbiol . 2008 Sep;46(9):2848-55. - 18.
Harris E, Kropp G, Belli A, Rodriguez B, Agabian N. Single-step multiplex PCRassay for characterization of NewWorld Leishmania complexes. J Clin Microbiol . 1998 Jul;36(7):1989-95. - 19.
Marfurt J, Niederwieser I, Makia ND, Beck HP, Felger I. Diagnostic genotyping of Old and New World Leishmania species by PCR-RFLP. Diagn Microbiol Infect Dis . 2003 Jun;46(2):115-24. - 20.
Victoir K, Bañuls AL, Arevalo J, Llanos-Cuentas A, Hamers R, Noël S, et al. The gp63 gene locus, a target for genetic characterization of Leishmania belonging to subgenus Viannia.Parasitology . 1998 Jul;117(Pt 1):1-13. - 21.
Guerbouj S, Victoir K, Guizani I, Seridi N, Nuwayri-Salti N, Belkaid M, et al. Gp63 gene polymorphism and population structure of Leishmania donovani complex: influence of the host selection pressure?Parasitology . 2001 Jan;122(Pt 1):25-35. - 22.
Garcia L, Kindt A, Bermudez H, Llanos-Cuentas A, De Doncker S, Arevalo J, et al. Culture-independent species typing of neotropical Leishmania for clinical validation of a PCR-based assay targeting heat shock protein 70 genes.J Clin Microbiol . 2004 May;42(5):2294-7. - 23.
Fraga J, Montalvo AM, De Doncker S, Dujardin JC, Van der Auwera G. Phylogeny of Leishmania species based on the heat-shock protein 70 gene. Infect Genet Evol . 2010 Mar;10(2):238-45. - 24.
Da Silva LA, de Sousa Cdos S, da Graça GC, Porrozzi R, Cupolillo E. Sequence analysis and PCR-RFLP profiling of the hsp70 gene as a valuable tool for identifying Leishmania species associated with human leishmaniasis in Brazil. Infect Genet Evol . 2010 Jan;10(1):77-83. - 25.
Hide M, Bañuls AL. Species-specific PCR assay for L. infantum/L. donovani discrimination. Acta Trop . 2006 Dec;100(3):241-5. - 26.
Oshaghi MA, Ravasan NM, Hide M, Javadian EA, Rassi Y, Sedaghat MM, et al. Development of species-specific PCR and PCR-restriction fragment length polymorphism assays for L.infantum/L. donovani discrimination.Exp Parasitol . 2009 May;122(1):61-5. - 27.
Williams JG, Kubelik AR, Livak KJ, Rafalski JA, Tingey SV. DNA polymorphisms amplified by arbitrary primers are useful as genetic markers. Nucleic Acids Res . 1990 Nov 25;18(22):6531-5. - 28.
Schriefer AL, Góes-Neto A, Guimarães LH, Carvalho LP, Almeida RP, et al. Multiclonal Leishmania braziliensis population structure and its clinical implication in a region of endemicity for American tegumentary leishmaniasis.Infect Immun . 2004 Jan;72(1):508-14. - 29.
Gomes RF, Macedo AM, Pena SD, Melo MN. Leishmania (Viannia) braziliensis: genetic relationships between strains isolated from different areas of Brazil as revealed by DNA fingerprinting and RAPD. Exp Parasitol . 1995 Jun;80(4):681-7. - 30.
Motazedian H, Noyes H, Maingon R. Leishmania and Sauroleishmania: the use of random amplified polymorphic DNA for the identification of parasites from vertebrates and invertebrates. Exp Parasitol . 1996 Jun;83(1):150-4. - 31.
Manna M, Majumder HK, Sundar S, Bhaduri AN. The molecular characterization of clinical isolates from Indian Kala-azar patients by MLEE and RAPD-PCR. Med Sci Monit . 2005 Jul;11(7):BR220-7. - 32.
Carvalho Mde L, de Andrade AS, Fontes CJ, Hueb M, de Oliveira Silva S, Melo MN. Leishmania (Viannia) braziliensis is the prevalent species infecting patients with tegumentary leishmaniasis from Mato Grosso State, Brazil. Acta Trop . 2006 Jul;98(3):277-85. - 33.
Noyes HA, Belli AA, Maingon R. Appraisal of various random amplified polymorphic DNA-polymerase chain reaction primers for Leishmania identification. Am J Trop Med Hyg . 1996 Jul;55(1):98-105. - 34.
Hanafi R, Barhoumi M, Ali SB, Guizani I. Molecular analyses of Old World Leishmania RAPD markers and development of a PCR assay selective for parasites of the L. donovani species Complex. Exp Parasitol . 2001 Jun;98(2):90-9. - 35.
Diakou A, Dovas CI. Optimization of random-amplified polymorphic DNA producing amplicons up to 8500 bp and revealing intraspecies polymorphism in Leishmania infantum isolates. Anal Biochem . 2001 Jan 15;288(2):195-200. - 36.
Guizani I, Dellagi K, Ismaïl RB. Random amplified polymorphic DNA technique for identification and differentiation of Old World Leishmania species. Am J Trop Med Hyg . 2002 Feb;66(2):152-6. - 37.
Bañuls AL, Guerrini F, Le Pont F, Barrera C, Espinel I, Guderian R, et al. Evidence for hybridization by multilocus enzyme electrophoresis and random amplified polymorphic DNA between Leishmania braziliensis and Leishmania panamemsis/ guyanensis in Ecuador.J Eukaryot Microbiol . 1997 Sep-Oct;44(5):408-11. - 38.
Bañuls AL, Jonquieres R, Guerrini F, Le Pont F, Barrera C, Espinel I, et al. Genetic analysis of Leishmania parasites in Ecuador : are Leishmania (Viannia) panamensis and Leishmania (V.) guyanensis distinct taxa ?Am J Trop Med Hyg . 1999 Nov;61(5):838-45. - 39.
Mauricio IL, Howard MK, Stothard JR, Miles MA. Genomic diversity in the Leishmania donovani complex. Parasitology . 1999 Sep;119 ( Pt 3):237-46. - 40.
Rioux JA, Lanotte G, Serres E, Pratlong F, Bastien P, Perieres J. Taxonomy of Leishmania. Use of isoenzymes. Suggestions for a new classification. Ann Parasitol Hum Comp . 1990;65(3):111-25. - 41.
Zemanová E, Jirků M, Mauricio IL, Miles MA, Lukes J. Genetic polymorphism within the Leishmania donovani complex: correlation with geographic origin. Am J Trop Med Hyg . 2004 Jun;70(6):613-7. - 42.
Toledo A, Martín-Sánchez J, Pesson B, Sanchiz-Marín C, Morillas-Márquez F. Genetic variability within the species Leishmania infantum by RAPD. A lack of correlation with zymodeme structure. Mol Biochem Parasitol . 2002 Feb;119(2):257-64. - 43.
Hide M, Bañuls AL, Tibayrenc M. Genetic heterogeneity and phylogenetic status of Leishmania (Leishmania) infantum zymodeme MON-1: epidemiological implications. Parasitology . 2001 Nov;123(Pt 5):425-32. - 44.
Segatto M, Ribeiro LS, Costa DL, Costa CH, Oliveira MR, Carvalho SF, et al . Genetic diversity of Leishmania infantum field populations from Brazil.Mem Inst Oswaldo Cruz . 2012 Feb;107(1):39-47. - 45.
Cupolillo E, Brahim LR, Toaldo CB, de Oliveira-Neto MP, de Brito ME, Falqueto A, et al. Genetic polymorphism and molecular epidemiology of Leishmania (Viannia) braziliensis from different hosts and geographic areas in Brazil.J Clin Microbiol . 2003 Jul;41(7):3126-32. - 46.
Khanra S, Bandopadhyay SK, Chakraborty P, Datta S, Mondal D, Chatterjee M, et al. Characterization of the recent clinical isolates of Indian Kala-azar patients by RAPD-PCR method.J Parasit Dis . 2011 Oct;35(2):116-22. - 47.
Khanra S, Datta S, Mondal D, Saha P, Bandopadhyay SK, Roy S, et al. RFLPs of ITS, ITS1 and hsp70 amplicons and sequencing of ITS1 of recent clinical isolates of Kala-azar from India and Bangladesh confirms the association of L. tropica with the disease.Acta Trop . 2012 Dec;124(3):229-34. - 48.
Mahmoudzadeh-Niknam H, Ajdary S, Riazi-Rad F, Mirzadegan E, Rezaeian A, Khaze V, et al. Molecular epidemiology of cutaneous leishmaniasis and heterogeneity of Leishmania major strains in Iran.Trop Med Int Health . 2012 Nov;17(11):1335-44. - 49.
Martinez E, Alonso V, Quispe A, Thomas MC, Alonso R, Piñero JE, González AC, Ortega A, Valladares B. RAPD method useful for distinguishing Leishmania species: design of specific primers for L. braziliensis. Parasitology . 2003 Dec;127(Pt 6):513-7. - 50.
Lewin S, Schönian G, El Tai N, Oskam L, Bastien P, Presber W. Strain typing in Leishmania donovani by using sequence-confirmed amplified region analysis. Int J Parasitol . 2002 Sep;32(10):1267-76. - 51.
Mkada-Driss I, Lahmadi R, Chakroun AS, Talbi C, Elamin EM, Cupollilo E, et al. Screening and characterization of RAPD polymorphic markers in viscerotropic Leishmania parasites. In preparation. - 52.
Mkada-Driss I, Talbi C, Elamin EM, Lahmadi R, Bakhiet S, Fathallah-Mili A, et al. Simple DNA assays for molecular epidemiology of visceral leishmaniasis in Africa: development and evaluation of species and countries specific PCR assays. In preparation. - 53.
Mauricio IL, Gaunt MW, Stothard JR, Miles MA. Glycoprotein 63 (gp63) genes show gene conversion and reveal the evolution of Old World Leishmania. Int J Parasitol . 2007 Apr;37(5):565-76. - 54.
Guerbouj S, Chamekh L, Jlassi M, Jbir R, Guizani I. Genetic polymorphism of Tunisian Leishmania infantum species by restriction analysis of PCR amplified gp63 and PSA2 coding genes. Personal communication. - 55.
BenSaid M, Guerbouj S, Saghrouni F, Fathallah-Mili A, Guizani I. Occurrence of Leishmania infantum cutaneous leishmaniasis in central Tunisia. Trans R Soc Trop Med Hyg . 2006 Jun;100(6):521-6. - 56.
Elamin EM, Guerbouj S, Musa AM, Guizani I, Khalil EA, Mukhtar MM, et al. Uncommon clinical presentations of cutaneous leishmaniasis in Sudan.Trans R Soc Trop Med Hyg . 2005 Nov;99(11):803-8. - 57.
Elamin EM, Guizani I, Guerbouj S, Gramiccia M, El Hassan AM, Di Muccio T, et al. Identification of Leishmania donovani as a cause of cutaneous leishmaniasis in Sudan.Trans R Soc Trop Med Hyg . 2008 Jan;102(1):54-7. - 58.
Mauricio IL, Gaunt MW, Stothard JR, Miles MA. Genetic typing and phylogeny of the Leishmania donovani complex by restriction analysis of PCR amplified gp63 intergenic regions. Parasitology . 2001 Apr;122(Pt 4):393-403. - 59.
Al-Jawabreh A, Schnur LF, Nasereddin A, Schwenkenbecher JM, Abdeen Z, Barghuthy F, et al. The recent emergence of Leishmania tropica in Jericho (A’riha) and its environs, a classical focus of L. major.Trop Med Int Health . 2004 Jul;9(7):812-6. - 60.
Rhajaoui M, Nasereddin A, Fellah H, Azmi K, Amarir F, Al-Jawabreh A, et al. New clinico-epidemiologic profile of cutaneous leishmaniasis, Morocco.Emerg Infect Dis . 2007 Sep;13(9):1358-60. - 61.
Kuhls K, Mauricio IL, Pratlong F, Presber W, Schönian G. Analysis of ribosomal DNA internal transcribed spacer sequences of the Leishmania donovani complex. Microbes Infect . 2005 Aug-Sep;7(11-12):1224-34. - 62.
Talmi-Frank D, Nasereddin A, Schnur LF, Schönian G, Töz SO, Jaffe CL, et al. Detection and identification of Old World Leishmania by high resolution melt analysis.PLoS Negl Trop Dis . 2010 Jan 12;4(1):e581. - 63.
De Almeida ME, Steurer FJ, Koru O, Herwaldt BL, Pieniazek NJ, da Silva AJ. Identification of Leishmania spp. by molecular amplification and DNA sequencing analysis of a fragment of rRNA internal transcribed spacer 2. J Clin Microbiol . 2011 Sep;49(9):3143-9. - 64.
El Tai NO, Osman OF, el Fari M, Presber W, Schönian G. Genetic heterogeneity of ribosomal internal transcribed spacer in clinical samples of Leishmania donovani spotted on filter paper as revealed by single-strand conformation polymorphisms and sequencing. Trans R Soc Trop Med Hyg . 2000 Sep-Oct;94(5):575-9. - 65.
El Tai NO, El Fari M, Mauricio I, Miles MA, Oskam L, El Safi SH, et al. Leishmania donovani: intra-specific polymorphisms of Sudanese isolates revealed by PCR-based analyses and DNA sequencing.Exp Parasitol . 2001 Jan;97(1):35-44. - 66.
Schönian G, Schnur L, el Fari M, Oskam L, Kolesnikov AA, Sokolowska-Köhler W, et al. Genetic heterogeneity in the species Leishmania tropica revealed by different PCR-based methods.Trans R Soc Trop Med Hyg . 2001 Mar-Apr;95(2):217-24. - 67.
Schönian G, El Fari M, Lewin S, Schweynoch C, Presber W. Molecular epidemiology and population genetics in Leishmania. Med Microbiol Immunol . 2001 Nov;190(1-2):61-3. - 68.
Tashakori M, Kuhls K, Al-Jawabreh A, Mauricio IL, Schönian G, Farajnia S, et al. Leishmania major: genetic heterogeneity of Iranian isolates by single-strand conformation polymorphism and sequence analysis of ribosomal DNA internal transcribed spacer.Acta Trop . 2006 Apr;98(1):52-8. - 69.
Ghatee M, Sharifi I, Mirhendi H, Kanannejad Z, Hatam G. Investigation of Double-Band Electrophoretic Pattern of ITS-rDNA Region in Iranian Isolates of Leishmania tropica. Iran J Parasitol . 2013 Apr;8(2):264-72. - 70.
Hartl FU, Hayer-Hartl M. Molecular chaperones in the cytosol: from nascent chain to folded protein. Science . 2002 Mar 8;295(5561):1852-8. - 71.
Folgueira C, Requena JM. A postgenomic view of the heat shock proteins in kinetoplastids. FEMS Microbiol Rev . 2007 Jul;31(4):359-77. - 72.
Montalvo AM, Fraga J, Monzote L, Montano I, De Doncker S, Dujardin JC, et al. Heat-shock protein 70 PCR-RFLP: a universal simple tool forLeishmania species discrimination in the New and Old World.Parasitology . 2010 Jul;137(8):1159-68. - 73.
Montalvo AM, Fraga J, Maes I, Dujardin JC, Van der Auwera G. Three new sensitive and specific heat-shock protein 70 PCRs for global Leishmania species identification.Eur J Clin Microbiol Infect Dis . 2012 Jul;31(7):1453-61. - 74.
Fraga J, Montalvo AM, Maes L, Dujardin JC, Van der Auwera G. HindII and SduI digests of heat-shock protein 70 PCR for Leishmania typing.Diagn Microbiol Infect Dis . 2013 Nov;77(3):245-7. - 75.
Fraga J, Veland N, Montalvo AM, Praet N, Boggild AK, Valencia BM, et al. Accurate and rapid species typing from cutaneous and mucocutaneous leishmaniasis lesions of the New World.Diagn Microbiol Infect Dis . 2012 Oct;74(2):142-50. - 76.
Van der Auwera G, Maes I, De Doncker S, Ravel C, Cnops L, Van Esbroeck M, et al. Heat-shock protein 70 gene sequencing forLeishmania species typing in European tropical infectious disease clinics.Euro Surveill . 2013 Jul 25;18(30):20543. - 77.
Requena JM, Chicharro C, García L, Parrado R, Puerta CJ, Cañavate C. Sequence analysis of the 3'-untranslated region of HSP70 (type I) genes in the genus Leishmania : its usefulness as a molecular marker for species identification.Parasit Vectors . 2012 Apr 28;5:87. - 78.
Serin MS, Waki K, Chang KP, Aslan G, Direkel S, Otag F, et al. Consistence of miniexon polymerase chain reaction–restriction fragment length polymorphism and single-copy gene sequence analyses in discriminating Leishmania genotypes.Diagn Microbiol Infect Dis . 2007 Mar;57(3):295-9. - 79.
Marfurt J, Nasereddin A, Niederwieser I, Jaffe CL, Beck HP, Felger I. Identification and differentiation of Leishmania species in clinical samples by PCR amplification of the miniexon sequence and subsequent restriction fragment length polymorphism analysis. J Clin Microbiol . 2003 Jul;41(7):3147-53. - 80.
Serin MS, Daglioglu K, Bagirova M, Allahverdiyev A, Uzun S, Vural Z, et al. Rapid diagnosis and genotyping of Leishmania isolates from cutaneous and visceral leishmaniasis by microcapillary cultivation and polymerase chain reaction-restriction fragment length polymorphism of miniexon region.Diagn Microbiol Infect Dis . 2005 Nov;53(3):209-14. - 81.
Pandey K, Yanagi T, Pandey BD, Mallik AK, Sherchand JB, Kanbara H. Characterization of Leishmania isolates from Nepalese patients with visceral leishmaniasis. Parasitol Res . 2007 May;100(6):1361-9. - 82.
Roelfsema JH, Nozari N, Herremans T, Kortbeek LM, Pinelli E. Evaluation and improvement of two PCR targets in molecular typing of clinical samples of Leishmania patients. Exp Parasitol . 2011 Jan;127(1):36-41. - 83.
Quispe Tintaya KW, Ying X, Dedet JP, Rijal S, De Bolle X, Dujardin JC. Antigen genes for molecular epidemiology of leishmaniasis: polymorphism of cysteine proteinase B and surface metalloprotease glycoprotein 63 in the Leishmania donovani complex. J Infect Dis . 2004 Mar 15;189(6):1035-43. - 84.
Seridi N, Belkaid M, Quispe-Tintaya W, Zidane C, Dujardin JC. Application of PCR-RFLP for the exploration of the molecular diversity of Leishmania infantum in Algeria. Trans R Soc Trop Med Hyg . 2008 Jun;102(6):556-63. - 85.
Chaouch M, Fathallah-Mili A, Driss M, Lahmadi R, Ayari C, Guizani I, et al. Identification of Tunisian Leishmania spp. by PCR amplification of cysteine proteinase B (cpb) genes and phylogenetic analysis.Acta Trop . 2013 Mar;125(3):357-65. - 86.
Laurent T, Van der Auwera G, Hide M, Mertens P, Quispe-Tintaya W, Deborggraeve S, et al. Identification of Old World Leishmania spp. by specific polymerase chain reaction amplification of cysteine proteinase B genes and rapid dipstick detection.Diagn Microbiol Infect Dis . 2009 Feb;63(2):173-81. - 87.
Kuru T, Janusz N, Gadisa E, Gedamu L, Aseffa A. Leishmania aethiopica: development of specific and sensitive PCR diagnostic test. Exp Parasitol . 2011 Aug;128(4):391-5. - 88.
Chaouch M, Mhadhbi M, Adams ER, Schoone GJ, Limam S, Gharbi Z, et al. Development and evaluation of a loop-mediated isothermal amplification assay for rapid detection of Leishmania infantum in canine leishmaniasis based on cysteine protease B genes.Vet Parasitol . 2013 Nov 15;198(1-2):78-84. - 89.
Notomi T, Okayama H, Masubuchi H, Yonekawa T, Watanabe K, Amino N, et al. Loop-mediated isothermal amplification of DNA.Nucleic Acids Res . 2000 Jun 15;28(12):E63. - 90.
Adams ER, Schoone GJ, Ageed AF, Safi SE, Schallig HD. Development of a reverse transcriptase loopo-mediated isothermal amplification (LAMP) assay for the sensitive detection of Leishmania parasites in clinical samples. Am J Trop Med Hyg . 2010 Apr;82(4):591-6. - 91.
Ibrahim ME, Barker DC. The origin and evolution of the Leishmania donovani complex as inferred from a mitochondrial cytochrome oxidase II gene sequence. Infect Genet Evol . 2001 Jul;1(1):61-8. - 92.
Luyo-Acero GE, Uezato H, Oshiro M, Takei K, Kariya K, Katakura K, et al. Sequence variation of the cytochrome b gene of various human infecting members of the genus Leishmania and their phylogeny.Parasitology . 2004 May;128(Pt 5):483-91. - 93.
Lainson R, Shaw JJ. Evolution, classification and geographical distribution. In: Peters W, Killick-Kendrick R, editors. The Leishmaniasis in Biology and Medicine. Vol. I Biology and Epidemiology . Orlando, USA: Orlando Academic Press; 1987. - 94.
Asato Y, Oshiro M, Myint CK, Yamamoto Y, Kato H, Marco JD, et al. Phylogenic analysis of the genus Leishmania by cytochrome b gene sequencing.Exp Parasitol . 2009 Apr;121(4):352-61. - 95.
Marco JD, Bhutto AM, Soomro FR, Baloch JH, Barroso PA, Kato H, et al. Multilocus enzyme electrophoresis and cytochrome B gene sequencing-based identification of Leishmania isolates from different foci of cutaneous leishmaniasis in Pakistan.Am J Trop Med Hyg . 2006 Aug;75(2):261-6. - 96.
Myint CK, Asato Y, Yamamoto Y, Kato H, Bhutto AM, Soomro FR, et al. Polymorphisms of cytochrome b gene in Leishmania parasites and their relation to types of cutaneous leishmaniasis lesions in Pakistan.J Dermatol . 2008 Feb;35(2):76-85. - 97.
Martínez LP, Rebollo JA, Luna AL, Cochero S, Bejarano EE. Molecular identification of the parasites causing cutaneous leishmaniasis on the Caribbean coast of Colombia. Parasitol Res . 2010 Feb;106(3):647-52. - 98.
Yang BB, Chen DL, Chen JP, Liao L, Hu XS, Xu JN. Analysis of kinetoplast cytochrome b gene of 16 Leishmania isolates from different foci of China: different species of Leishmania in China and their phylogenetic inference. Parasit Vectors . 2013 Feb 5;6:32. - 99.
Akopyants NS, Kimblin N, Secundino N, Patrick R, Peters N, Lawyer P, et al. Demonstration of genetic exchange during cyclical development of Leishmania in the sand fly vector.Science 2009 Apr 10;324(5924):265-8. - 100.
Sadlova J, Yeo M, Seblova V, Lewis MD, Mauricio I, Volf P, et al. Visualisation of Leishmania donovani fluorescent hybrids during early stage development in the sand fly vector.PLoS One . 2011;6(5):e19851. - 101.
Lombardo G, Pennisi MG, Lupo T, Migliazzo A, Caprì A, Solano-Gallego L. Detection of Leishmania infantum DNA by real-time PCR in canine oral and conjunctival swabs and comparison with other diagnostic techniques. Vet Parasitol . 2012 Feb 28;184(1):10-7. - 102.
Da Silva RN, Amorim AC, Brandão RM, de Andrade HM, Yokoo M, Ribeiro ML, et al. Real-time PCR in clinical practice: a powerful tool for evaluating Leishmania chagasi loads in naturally infected dogs.Ann Trop Med Parasitol . 2010 Mar;104(2):137-43. - 103.
De Paiva Cavalcanti M, Felinto de Brito ME, de Souza WV, de Miranda Gomes Y, Abath FG. The development of a real-time PCR assay for the quantification of Leishmania infantum DNA in canine blood. Vet J. 2009 Nov;182(2):356-8. - 104.
Antinori S, Calattini S, Piolini R, Longhi E, Bestetti G, Cascio A, et al. Is real-time polymerase chain reaction (PCR) more useful than a conventional PCR for the clinical management of leishmaniasis?Am J Trop Med Hyg . 2009 Jul;81(1):46-51. - 105.
Weirather JL, Jeronimo SM, Gautam S, Sundar S, Kang M, Kurtz MA, et al. Serial quantitative PCR assay for detection, species discrimination, and quantification of Leishmania spp. in human samples.J Clin Microbiol . 2011 Nov;49(11):3892-904. - 106.
Jara M, Adaui V, Valencia BM, Martinez D, Alba M, Castrillon C, et al. Real-time PCR assay for detection and quantification of Leishmania (Viannia) organisms in skin and mucosal lesions: exploratory study of parasite load and clinical parameters.J Clin Microbiol . 2013 Jun;51(6):1826-33. - 107.
De Paiva Cavalcanti M, Dantas-Torres F, da Cunha Gonçalves de Albuquerque S, Silva de Morais RC, de Brito ME, Otranto D, et al. Quantitative real time PCR assays for the detection of Leishmania (Viannia) braziliensis in animals and humans.Mol Cell Probes . 2013 Jun-Aug;27(3-4):122-8. - 108.
Kumar A, Boggula VR, Misra P, Sundar S, Shasany AK, Dube A. Amplified fragment length polymorphism (AFLP) analysis is useful for distinguishing Leishmania species of visceral and cutaneous forms. Acta Trop . 2010 Feb;113(2):202-6. - 109.
Odiwuor S, Vuylsteke M, De Doncker S, Maes I, Mbuchi M, Dujardin JC, et al. Leishmania AFLP: paving the way towards improved molecular assays and markers of diversity.Infect Genet Evol . 2011 Jul;11(5):960-7. - 110.
Kumar A, Misra P, Dube A. Amplified fragment length polymorphism: an adept technique for genome mapping, genetic differentiation, and intraspecific variation in protozoan parasites. Parasitol Res . 2013 Feb;112(2):457-66. - 111.
Van der Meide WF, Schoone GJ, Faber WR, Zeegelaar JE, de Vries HJ, Ozbel Y, et al. Quantitative nucleic acid sequence-based assay as a new molecular tool for detection and quantification of Leishmania parasites in skin biopsy samples.J Clin Microbiol . 2005 Nov;43(11):5560-6. - 112.
Takagi H, Itoh M, Islam MZ, Razzaque A, Ekram AR, Hashighuchi Y, et al. Sensitive, specific, and rapid detection of Leishmania donovani DNA by loop-mediated isothermal amplification.Am J Trop Med Hyg . 2009 Oct;81(4):578-82. - 113.
Khan MG, Bhaskar KR, Salam MA, Akther T, Pluschke G, Mondal D. Diagnostic accuracy of loop-mediated isothermal amplification (LAMP) for detection of Leishmania DNA in buffy coat from visceral leishmaniasis patients. Parasit Vectors . 2012 Dec 3;5:280. - 114.
Lukes J, Mauricio IL, Schönian G, Dujardin JC, Soteriadou K, Dedet JP, et al. Evolutionary and geographical history of the Leishmania donovani complex with a revision of current taxonomy.Proc Natl Acad Sci U S A . 2007 May 29;104(22):9375-80. - 115.
Ravel C, Cortes S, Pratlong F, Morio F, Dedet JP, Campino L. First report of genetic hybrids between two very divergent Leishmania species: Leishmania infantum and Leishmania major. Int J Parasitol . 2006 Nov;36(13):1383-8. - 116.
El Baidouri F, Diancourt L, Berry V, Chevenet F, Pratlong F, Marty P, et al. Genetic structure and evolution of the Leishmania genus in Africa and Eurasia: what does MLSA tell us.PLoS Negl Trop Dis . 2013 Jun 13;7(6):e2255. - 117.
Boité MC, Mauricio IL, Miles MA, Cupolillo E. New insights on taxonomy, phylogeny and population genetics of Leishmania (Viannia) parasites based on multilocus sequence analysis. PLoS Negl Trop Dis . 2012;6(11):e1888. - 118.
Tsukayama P, Lucas C, Bacon DJ. Typing of four genetic loci discriminates among closely related species of New World Leishmania. Int J Parasitol . 2009 Feb;39(3):355-62. - 119.
Tsukayama P, Núñez JH, De Los Santos M, Soberón V, Lucas CM, Matlashewski G, et al. A FRET-based real-time PCR assay to identify the main causal agents of New World tegumentary leishmaniasis.PLoS Negl Trop Dis . 2013;7(1):e1956. - 120.
Bulle B, Millon L, Bart JM, Gállego M, Gambarelli F, Portús M, et al. Practical approach for typing strains of Leishmania infantum by microsatellite analysis.J Clin Microbiol . 2002 Sep;40(9):3391-7. - 121.
Jamjoom MB, Ashford RW, Bates PA, Kemp SJ, Noyes HA. Towards a standard battery of microsatellite markers for the analysis of the Leishmania donovani complex. Ann Trop Med Parasitol . 2002 Apr;96(3):265-70. - 122.
Ochsenreither S, Kuhls K, Schaar M, Presber W, Schönian G. Multilocus microsatellite typing as a new tool for discrimination of Leishmania infantum MON-1 strains. J Clin Microbiol . 2006 Feb;44(2):495-503. - 123.
Jamjoom MB, Ashford RW, Bates PA, Kemp SJ, Noyes HA. Polymorphic microsatellite repeats are not conserved between Leishmania donovani and Leishmania major. Molecular Ecology Notes . 2002 June;2(2):104–6. - 124.
Al-Jawabreh A, Diezmann S, Müller M, Wirth T, Schnur LF, Strelkova MV, et al. Identification of geographically distributed subpopulations of Leishmania (Leishmania) major by microsatellite analysis.BMC Evol Biol . 2008 Jun 24;8:183. - 125.
Schwenkenbecher JM, Wirth T, Schnur LF, Jaffe CL, Schallig H, Al-Jawabreh A, et al. Microsatellite analysis reveals genetic structure of Leishmania tropica.Int J Parasitol . 2006 Feb;36(2):237-46. - 126.
Russell R, Iribar MP, Lambson B, Brewster S, Blackwell JM, Dye C, et al. Intra and inter-specific microsatellite variation in the Leishmania subgenus Viannia. Mol Biochem Parasitol . 1999 Sep 20;103(1):71-7. - 127.
Rougeron V, Waleckx E, Hide M, DE Meeûs T, Arevalo J, Llanos-Cuentas A, et al. PERMANENT GENETIC RESOURCES: A set of 12 microsatellite loci for genetic studies of Leishmania braziliensis.Mol Ecol Resour . 2008 Mar;8(2):351-3. - 128.
Oddone R, Schweynoch C, Schönian G, de Sousa Cdos S, Cupolillo E, Espinosa D, et al. Development of a multilocus microsatellite typing approach for discriminating strains of Leishmania (Viannia) species.J Clin Microbiol . 2009 Sep;47(9):2818-25. - 129.
Kuhls K, Keilonat L, Ochsenreither S, Schaar M, Schweynoch C, Presber W, et al. Multilocus microsatellite typing (MLMT) reveals genetically isolated populations between and within the main endemic regions of visceral leishmaniasis.Microbes Infect . 2007 Mar;9(3):334-43. - 130.
Alam MZ, Kuhls K, Schweynoch C, Sundar S, Rijal S, Shamsuzzaman AK, et al. Multilocus microsatellite typing (MLMT) reveals genetic homogeneity of Leishmania donovani strains in the Indian subcontinent.Infect Genet Evol . 2009 Jan;9(1):24-31. - 131.
Seridi N, Amro A, Kuhls K, Belkaid M, Zidane C, Al-Jawabreh A, et al. Genetic polymorphism of Algerian Leishmania infantum strains revealed by multilocus microsatellite analysis.Microbes Infect . 2008 Oct;10(12-13):1309-15. - 132.
Chargui N, Amro A, Haouas N, Schönian G, Babba H, Schmidt S, et al. Population structure of Tunisian Leishmania infantum and evidence for the existence of hybrids and gene flow between genetically different populations.Int J Parasitol . 2009 Jun;39(7):801-11. - 133.
Amro A, Schönian G, Al-Sharabati MB, Azmi K, Nasereddin A, Abdeen Z, et al. Population genetics of Leishmania infantum in Israel and the Palestinian Authority through microsatellite analysis.Microbes Infect . 2009 Apr;11(4):484-92. - 134.
Montoya L, Gállego M, Gavignet B, Piarroux R, Rioux JA, Portús M, et al. Application of microsatellite genotyping to the study of a restricted Leishmania infantum focus: different genotype compositions in isolates from dogs and sand flies.Am J Trop Med Hyg . 2007 May;76(5):888-95. - 135.
Kuhls K, Alam MZ, Cupolillo E, Ferreira GE, Mauricio IL, Oddone R, et al. Comparative microsatellite typing of new world leishmania infantum reveals low heterogeneity among populations and its recent old world origin.PLoS Negl Trop Dis . 2011 Jun;5(6):e1155. - 136.
Siriwardana HV, Noyes HA, Beeching NJ, Chance ML, Karunaweera ND, Bates PA. Leishmania donovani and cutaneous leishmaniasis, Sri Lanka. Emerg Infect Dis . 2007 Mar;13(3):476-8. - 137.
Nolder D, Roncal N, Davies CR, Llanos-Cuentas A, Miles MA. Multiple hybrid genotypes of Leishmania (Viannia) in a focus of mucocutaneous leishmaniasis. Am J Trop Med Hyg . 2007 Mar;76(3):573-8. - 138.
Rougeron V, De Meeûs T, Hide M, Waleckx E, Bermudez H, Arevalo J, et al. Extreme inbreeding in Leishmania braziliensis.Proc Natl Acad Sci U S A . 2009 Jun 23;106(25):10224-9. - 139.
Rougeron V, De Meeûs T, Hide M, Waleckx E, Dereure J, Arevalo J, et al. A battery of 12 microsatellite markers for genetic analysis of the Leishmania (Viannia) guyanensis complex.Parasitology . 2010 Nov;137(13):1879-84. - 140.
Alam MZ, Kovalenko DA, Kuhls K, Nasyrova RM, Ponomareva VI, Fatullaeva AA, et al. Identification of the agent causing visceral leishmaniasis in Uzbeki and Tajiki foci by analysing parasite DNA extracted from patients' Giemsa-stained tissue preparations.Parasitology . 2009 Aug;136(9):981-6. - 141.
Tibayrenc M, Ayala FJ. Reproductive clonality of pathogens: a perspective on pathogenic viruses, bacteria, fungi, and parasitic protozoa. Proc Natl Acad Sci U S A . 2012 Nov 27;109(48):E3305-13. - 142.
Tibayrenc M, Ayala FJ. How clonal are Trypanosoma and Leishmania? Trends Parasitol . 2013 Jun;29(6):264-9. - 143.
Delgado O, Cupolillo E, Bonfante-Garrido R, Silva S, Belfort E, Grimaldi Júnior G, et al. Cutaneous leishmaniasis in Venezuela caused by infection with a new hybrid between Leishmania (Viannia) braziliensis and L. (V.) guyanensis.Mem Inst Oswaldo Cruz . 1997 Sep-Oct;92(5):581-2. - 144.
Dujardin JC, Banuls AL, Llanos-Cuentas A, Alvarez E, DeDoncker S, Jacquet D, et al. Putative Leishmania hybrids in the Eastern Andean valley of Huanuco, Peru.Acta Trop . 1995 Aug;59(4):293-307. - 145.
Belli AA, Miles MA, Kelly JM. A putative Leishmania panamensis/Leishmania braziliensis hybrid is a causative agent of human cutaneous leishmaniasis in Nicaragua. Parasitology . 1994 Nov;109 (Pt 4):435-42. - 146.
Kelly JM, Law JM, Chapman CJ, Van Eys GJ, Evans DA. Evidence of genetic recombination in Leishmania. Mol Biochem Parasitol . 1991 Jun;46(2):253-63. - 147.
Miles MA, Yeo M, Mauricio IL. Genetics. Leishmania exploit sex. Science . 2009 Apr 10;324(5924):187-9. - 148.
Inbar E, Akopyants NS, Charmoy M, Romano A, Lawyer P, Elnaiem DE, et al. The mating competence of geographically diverse Leishmania major strains in their natural and unnatural sand fly vectors.PLoS Genet . 2013 Jul;9(7):e1003672. - 149.
Volf P, Benkova I, Myskova J, Sadlova J, Campino L, Ravel C. Increased transmission potential of Leishmania major/Leishmania infantum hybrids. Int J Parasitol . 2007 May;37(6):589-93. - 150.
Ivens AC, Peacock CS, Worthey EA, Murphy L, Aggarwal G, Berriman M, et al. The genome of the kinetoplastid parasite, Leishmania major.Science . 2005 Jul 15;309(5733):436-42. - 151.
Peacock CS, Seeger K, Harris D, Murphy L, Ruiz JC, Quail MA, et al. Comparative genomic analysis of three Leishmania species that cause diverse human disease.Nat Genet . 2007 Jul;39(7):839-47. - 152.
Rogers MB, Hilley JD, Dickens NJ, Wilkes J, Bates PA, Depledge DP, et al. Chromosome and gene copy number variation allow major structural change between species and strains of Leishmania.Genome Res . 2011 Dec;21(12):2129-42. - 153.
Downing T, Imamura H, Decuypere S, Clark TG, Coombs GH, Cotton JA, et al. Whole genome sequencing of multiple Leishmania donovani clinical isolates provides insights into population structure and mechanisms of drug resistance.Genome Res . 2011 Dec;21(12):2143-56. - 154.
Raymond F, Boisvert S, Roy G, Ritt JF, Légaré D, Isnard A, et al. Genome sequencing of the lizard parasite Leishmania tarentolae reveals loss of genes associated to the intracellular stage of human pathogenic species.Nucleic Acids Res. 2012 Feb;40(3):1131-47. - 155.
Srividya G, Duncan R, Sharma P, Raju BV, Nakhasi HL, Salotra P. Transcriptome analysis during the process of in vitro differentiation of Leishmania donovani using genomic microarrays. Parasitology . 2007 Oct;134(Pt 11):1527-39. - 156.
Rochette A, Raymond F, Ubeda JM, Smith M, Messier N, Boisvert S, et al. Genome-wide gene expression profiling analysis of Leishmania major and Leishmania infantum developmental stages reveals substantial differences between the two species.BMC Genomics . 2008 May 29;9:255. - 157.
Ubeda JM, Légaré D, Raymond F, Ouameur AA, Boisvert S, Rigault P, et al. Modulation of gene expression in drug resistant Leishmania is associated with gene amplification, gene deletion and chromosome aneuploidy.Genome Biol . 2008;9(7):R115. - 158.
Leprohon P, Légaré D, Raymond F, Madore E, Hardiman G, Corbeil J, et al. Gene expression modulation is associated with gene amplification, supernumerary chromosomes and chromosome loss in antimony-resistant Leishmania infantum.Nucleic Acids Res . 2009 Apr;37(5):1387-99. - 159.
Depledge DP, Evans KJ, Ivens AC, Aziz N, Maroof A, Kaye PM, et al. Comparative expression profiling of Leishmania: modulation in gene expression between species and in different host genetic backgrounds.PLoS Negl Trop Dis . 2009 Jul 7;3(7):e476. - 160.
Volkman SK, Sabeti PC, DeCaprio D, Neafsey DE, Schaffner SF, Milner DA Jr, et al. A genome-wide map of diversity in Plasmodium falciparum.Nat Genet . 2007 Jan;39(1):113-9. - 161.
Neafsey DE, Schaffner SF, Volkman SK, Park D, Montgomery P, Milner DA Jr, et al. Genome-wide SNP genotyping highlights the role of natural selection in Plasmodium falciparum population divergence.Genome Biol . 2008;9(12):R171. - 162.
Mu J, Myers RA, Jiang H, Liu S, Ricklefs S, Waisberg M, et al. Plasmodium falciparum genome-wide scans for positive selection, recombination hot spots and resistance to antimalarial drugs.Nat Genet . 2010 Mar;42(3):268-71. - 163.
Miles MA, Llewellyn MS, Lewis MD, Yeo M, Baleela R, Fitzpatrick S, et al. The molecular epidemiology and phylogeography of Trypanosoma cruzi and parallel research on Leishmania: looking back and to the future.Parasitology . 2009 Oct;136(12):1509-28.