Primer sequences and PCR fragment size of tested MLS resistance genes.
Abstract
A total of 92 genes that confer resistance to MLS antibiotics have been described to date. They can be roughly divided into three groups, depending on the mechanisms by which they confer resistance to one or all of these groups of antibiotics. Three main mechanisms of resistance to MLS antibiotics have been described: methylation of rRNA (target modification), active efflux and inactivation of the antibiotic. Target modification is achieved through the action of the protein product of one of more than 42 different erm (erythromycin rRNA methylase) genes. They confer cross resistance between macrolides, lincosamides and streptogramin B (so-called MLSB resistance) and evoke most concerns. Active efflux and inactivating enzymes (M and L) represent two additional mechanisms of resistance that are targeted only to particular antibiotics or antibiotic classes. Based on the mechanisms of resistance, various resistant phenotypes are expressed. The most prevalent phenotypes are ΜLSB (constitutive or inducible), which is associated with the presence mainly of ermA and ermC genes, followed by the MSB phenotype due to the presence of msrA gene. In livestock S. aureus strains, such as CC 398, other genes such as ermT, lnuA, lsaE and mphC genes are detected.
Keywords
- staphylococci
- MLSB
- resistance
- genes
1. Introduction
Resistance to macrolides-lincosamides and streptogramins B (MLSB antibiotics) is associated with three main mechanisms: (1) methylation of rRNA (target modification), (2) active efflux and (3) enzymatic inactivation. Till date, a total of 92 genes, conferring resistance to MLSB antibiotics, have been described. The most common genes are
The macrolide group of antibiotics includes natural members, prodrugs and semisynthetic derivatives. The chemical structure of macrolides is characterized by a large lactone ring containing from 12 to 16 atoms to which are attached, via glycosidic bonds, one or more sugars. Erythromycin, whose lactone ring contains 14 atoms, is the oldest molecule (1952), whereas all second-generation macrolides, like roxithromycin and clarithromycin, are hemisynthetic derivatives of erythromycin. Azithromycin is the only macrolide with 15 carbon atoms. Azithromycin, which is produced through the introduction of a nitrogen atom into the macrolide nucleus at C10, exhibits (1) improved penetration into macrophages, fibroblasts and polymorpho-neutrophils, (2) increased accumulation within acidified vacuoles and (3) extended half-life. Additionally, azithromycin shows improved activity against Gram-negative bacteria and other pathogens associated with parasitic infections. Spiramycin and josamycin are macrolides with 16 carbon atoms. All chemical modifications of macrolides were made in order that their properties and action are optimized.
Although the structure of lincosamides is different from the structure of macrolides, they present a similar action spectrum. Lincomycin, which was isolated in 1962, is a fermentation product of
Type-A streptogramin includes cyclic-poly-unsaturated macrolactones: virginiamycin M, pristinamycin IIA and dalfopristin. Type-B streptogramin consists of the cyclic hexadepsipeptide compounds virginiamycin S, pristinamycin IA and quinupristin. Until now, only three streptogramins have been marketed either for treatment or growth promotion: virginiamycin, pristinamycin and quinupristin-dalfopristin. Virginiamycin, a mixture of virginiamycin M (type A streptogramin) and virginiamycin S (type B streptogramin), has been used mainly as growth promoter feed additive in commercial animal farming in the United States and Europe. In contrast, pristinamycin has been used orally and topically in human medicine only in France. Qiunupristin-dalfopristin, in a 30:70 mixture (Synercid), was approved in 1999 for the treatment of serious infections caused by multidrug resistant Gram-positive pathogens, including vancomycin-resistant
MLSB antibiotics share a similar mode of action because they inhibit protein synthesis by targeting the peptidyl transferase center within the 50S subunit (23 s rRNA) of the bacterial ribosome [5]. We note that the bacterial ribosomes are 70S particles comprising of two subunits, 30s and 50S, which are made of RNAs enveloped by proteins; 50S is composed of 5S, 23S rRNAs and 36 proteins (L1-L36) [6, 7].
Although the peptidyl transferase center is the main target site for many antibiotics, the exact mechanism for its activity is still unclear [8]. Overall, the inhibitory action of antibiotics is not only determined by their interaction with specific nucleotides. MLSB could also inhibit peptidyl transferase by interfering with the proper positioning and movement of the tRNAs at the peptidyl transferase cavity [9, 10].
2. Antibacterial spectrum of MLSB
Τhe spectrum of MLSB includes mainly Gram-positive microorganisms (streptococci, staphylococci); however, some of them also have activity against Gram-negative microorganisms (
It is known that some Gram-positive species have intrinsic resistance to some of them.
3. Mechanisms of acquisition of resistance to MLSB
Staphylococci resist MLSB antibiotics in three ways: (1) through target-site modification by methylation or mutation that prevents the binding of the antibiotic to its ribosomal target, (2) through efflux of the antibiotic and (3) by drug inactivation. Modification of the ribosomal target confers broad-spectrum resistance to macrolides, lincosamides and streptogramin B, whereas efflux and inactivation affect only some of these molecules [12].
3.1. Ribosomal methylation
The most widespread mechanism of resistance to MLSB in Gram-positive bacteria, including both
Erm proteins, encoded by
More than 42
3.2. Antibiotic efflux
In Gram-positive organisms, acquisition of macrolide resistance by active efflux is caused by two classes of pumps, members of the ATP-binding-cassette (ABC) transporter superfamily and of the major facilitator superfamily (MFS). ABC transporters require ATP to function and are usually formed by a channel comprising two membrane-spanning domains and two ATP-binding domains located at the cytosolic surface of the membrane [12].
The first determinant encoding ABC transporter in staphylococci was the plasmid-borne
However, latter, the combined resistance to lincosamides, pleuromutilins and streptogramin A (SA), referred as the PLSA phenotype, was found to be associated with the presence of the ARE subfamily of class 2 ATP-binding cassette (ABC) ATPases, a class of ABC proteins made up of two homologous ABC ATPase domains separated by a flexible linker without any identifiable transmembrane domains [16, 17, 18]. The flexible linker between each ATPase domain is presumed to be the drug-binding region of the ARE proteins. The
3.3. Enzymatic inactivation
Enzymatic inactivation confers resistance to structurally related antibiotics only. Esterases and phosphotransferases, encoded by
In addition, lincosamide nucleotidyl transferases encoded by
3.4. Uncommon mechanisms of resistance
Ribosomal mutations (A2058G/U or A2059G) of 23S rRNA gene such as mutations in the
On the other hand,
4. Resistant phenotypes: expression, detection and interpretation
Depending on the mechanism of resistance and on the carriage of respective genes, staphylococci can express various MLSB resistant phenotypes. Briefly, these types are described as follows.
4.1. MLSB phenotype (erm genotype)
MLSB phenotype can be expressed as constitutive or inducible [12]. Isolates with a constitutive MLSB phenotype express high level cross-resistance to macrolides, lincosamides and streptogramin B. In fact, clinical methicillin-resistant strains that are constitutively resistant to MLSB antibiotics are widespread.
On the other hand, isolates with an inducible MLSB phenotype express phenotypically only resistance to macrolides and susceptibility to lincosamides. This phenomenon is explained by the fact that, in constitutive resistance, bacteria produce an active mRNA encoding methylase, whereas in inducible resistance, bacteria produce an inactive mRNA, which is unable to encode ribosome methylases. However, in the presence of a macrolide, which acts like an inducer, the mRNA becomes active [38]. The presence of an inducer leads to rearrangements of mRNA, which allow ribosomes to translate the methylase coding sequence.
Inducible expression of
The use of antibiotics being noninducers (such as clindamycin) for treatment of an infection due to a
According to the rules of EUCAST, if a staphylococcal isolate with an inducible MLSB phenotype is detected, it must be reported as resistant and considered adding this comment to the report “Clindamycin may still be used for short-term therapy of less serious skin and soft tissue infections as constitutive resistance is unlikely to develop during such therapy.”
The
4.2. MSB-phenotype (msrA genotype)
MSB phenotype is associated with resistance only to 14- (clarithromycin, erythromycin, roxithromycin) and 15-membered ring macrolides (azithromycin) and streptogramin B, while 16-membered ring macrolides (josamycin and spiramycin) and lincosamides remain active [12, 15]. The
Another gene,
Isolates with this phenotype have probably decreased susceptibility to the combination of quinupristin-dalfopristin. Additional tests (see below) are required for its detection.
4.3. M- phenotype (mphC genotype)
M-phenotype is associated with the presence of enzymes which inactivate enzymatically only macrolides. Clinical isolates of erythromycin-resistant
4.4. PLS A -phenotype
PLSA-phenotype is associated with resistance to lincosamides, pleuromutilins and streptogramins A, while macrolides and streptogramin B remain active [42] . Various genes such as
4.5. L-phenotype (lnuB genotype)
L-phenotype is associated with resistance to lincomycin due to the presence of lincosamide nucleotidyl transferases encoded by
Although more than 90 genes conferring resistance to macrolides and lincosamides have been described till date, their presence has not turned out to be a successful story for Gram-positive bacteria. This observation, which is in contrast with the success of emergence of
4.6. SB-phenotype
SB-phenotype is expressed by resistance to streptogramin B due to the presence of
5. Confirmation methods of resistant phenotypes
Among the different types of resistant phenotypes, the most common are MLSB (constitutive or inducible), MSB and M-phenotypes. The clinical microbiology laboratory detects easily and reliably the MLSB constitutive phenotype: the isolates are fully resistant to macrolides and lincosamides. However, isolates with MLSB inducible, MSB and M-phenotypes share the same profile: resistance to macrolides and susceptibility to lincosamides. Therefore, additional test, the double disk diffusion test (D test) is required to be applied.
For the detection of MLSB inducible resistance, it is recommended to place the erythromycin and clindamycin disks 12–20 mm apart (edge to edge, D test). In disk-diffusion tests, a D-shaped zone, caused by induction of methylase production by erythromycin, can be observed (Figure 1). Nowadays, the automated system Vitek II (BoMerieux) has the possibility to detect it.
![](http://cdnintech.com/media/chapter/60007/1512345123/media/F1.png)
Figure 1.
Expression of various resistant-phenotypes: (a) sensitive; (b) MLSB-inducible phenotype; (c) MSB-phenotype; (d) L-phenotype and (e) M-phenotype. ERY: erythromycin; CLIN: clindamycin; LIN: lincomycin.
However, after a negative D test, the differentiation between MSB and M-phenotypes is more complicated and could be based on the MIC values of erythromycin. Isolates with M-phenotype have often lower MIC values to erythromycin, due to the weak activity of hydrolytic enzymes, than isolates with MSB-phenotype, which express fully resistance to macrolides. In addition, MSB-phenotype affects the susceptibility to quinupristin-dalfopristin, decreasing it slowly.
Finally, it is difficult to discriminate isolates with PLSA-phenotype from those with L-phenotype; both share the same profile, including resistance to lincomycin and susceptibility to erythromycin. On the other hand, pleuromutilins and streptogramins A are not included in the panel of antibiotics proposed for susceptibility testing. Probably, the values of MICs to clindamycin and quinupristin-dalfopristin, which usually are not affected by L-phenotype, can be used as indicators [46].
Molecular detections of the most common genes involved in MLSB resistance are an accurate method for phenotype determination (Table 1).
Gene | Primers sequence (5′–3′) | PCR fragment size (bp) |
---|---|---|
F: TCTAAAAAGCATGTAAAAGAA | 645 | |
R: CTTCGATAGTTTATTAATATTAG | ||
F: GAAAAGTACTCAACCAAATA | 639 | |
R: AGTAACGGTACTTAAATTGTTTA | ||
F: TCAAAACATAATATAGATAAA | 642 | |
R: GCTAATATTGTTTAAATCGTCAAT | ||
F: GGCACAATAAGAGTGTTTAAAGG | 940 | |
R: AAGTTATATCATGAATAGATTGTCCTGTT | ||
F: TATGATATCCATAATAATTATCCAATC | 595 | |
R: AAGTTATATCATGAATAGATTGTCCTGTT | ||
F: GGTGGCTGGGGGGTAGATGTATTAACTGG | 323 | |
R: GCTTCTTTTGAAATACATGGTATTTTTCGATC | ||
F: CCTACCTATTGTTTGTGGAA | 925 | |
R: ATAACGTTACTCTCCTATTC | ||
F: GGCAATCGCTTGTGTTTTAGCG | 1200 | |
R: GTGAATCCCATGATGTTGATACC |
Table 1.
MLS: macrolides, lincosamides and streptogramins; PCR: polymerase chain reaction.
6. Historical background
The first report about the activity of erythromycin was confirmed in 1954 by Derek [47]; in 1964, Macleod et al. indicated that lincomycin was effective against
In 1971, Lai et al. demonstrated altered methylation of ribosomal RNA in a erythromycin-resistant
In 1990, Ross et al. identified
To date, a variety of genes (such as
7. Epidemiology of MLSΒ resistant staphylococci: recent data
The rate of MLSB-resistant staphylococci varies between countries and species. Unfortunately, in the last decade, data concerning the rate of MLS resistance in staphylococci are limited. Otsuka et al. reported that 97% of MRSA and 34.6% of MSSA were resistant to one or more MLSB agents in a study conducted between 2001 and 2006 [64]. Cetin et al. in a large collection of staphylococci in a Turkish hospital have found that 38.5% were resistant to MLSB antibiotics, while Uzun et al. reported that during 2011–2012, 79% isolates were found as erythromycin-resistant in a tertiary hospital in Ismir [65, 66]. In a tertiary Greek hospital, the rate of MLSB
Regarding the distribution of resistant phenotypes, the most common are MLSB (constitutive or inducible) followed by MSB. In Japan, Otsuka et al. revealed higher incidence of the MLSB-inducible phenotype than in Europe, Turkey and the USA [41, 64, 70, 71, 72, 73]. Such differences in the incidence of phenotypes might reflect differences in the drug usage, the gene carriage and the clonality of strains.
Totally, 92 genes, which confer resistance to MLS antibiotics, have been described to date. They can be roughly divided into three groups, depending on the mechanisms by which they confer resistance to one or all of these groups of antibiotics. Data from different studies agree that the most prevalent genes are
8. Conclusions
Staphylococci and specially
References
- 1.
Chabbert Y. Antagonisme in vitro entre la erythromycin et la spiroamycine. Annales De l'Institut Pasteur. 1956;90 :787-790 - 2.
Garrod LP. The erythromycin group of antibiotics. British Medical Journal. 1957; II :57-63 - 3.
Jones WF Jr, Nichols RL, Finland M. Development of resistance and cross-resistance in vitro to erythromycin, carbomycin, oleandomycin, and streptogramin. Proceedings of the Society for Experimental Biology and Medicine. 1956;93 :388-393 - 4.
McGuire JM, Bunch RL, Anderson RC, Boaz HE, Flynn EH, Powell HM, Smith HW. Ilotycin: A new antibiotic. Antibiotics and Chemotherapy. 1952; 2 :281-283 - 5.
Bozdogan B, Appelbaum PC. Macrolide resistance in streptococci and Haemophilus influenzae . Clinics in Laboratory Medicine. 2004;24 :455-475. DOI: 10.1016/j.cll.2004.03.006 - 6.
Johnston NJ, Mukhtar TA, Wright GD. Streptogramin antibiotics: Mode of action and resistance. Current Drug Targets. 2002; 3 :335-344 - 7.
Cocito C, Di Giambattista M, Nyssen E, Vannuffel P. Inhibition of protein synthesis by streptogramins and related antibiotics. Journal of Antimicrobial Chemotherapy. 1997; 39 (Suppl A):7-13 - 8.
Schlünzen F, Zarivach R, Harms J, Bashan A, Tocilj A, Albrecht R, Yonath A, Franceschi F. Structural basis for the interaction of antibiotics with the peptidyl transferase centre in eubacteria. Nature. 2001; 413 :814-821. DOI: 10.1038/35101544 - 9.
Franklin TJ, Snow GA. Biochemistry of Antimicrobial Agents. 2nd ed. New York: John Wiley; 1975 - 10.
Brisson-Noël A, Trieu-Cuot P, Courvalin P. Mechanism of action of spiramycin and other macrolides. Journal of Antimicrobial Chemotherapy. 1988; 22 (Suppl B):13-23 - 11.
Steigbigel NH. Macrolides and clindamycin. In: Mandell GL, Bennett JE, Dolin R, editors. Mandell Douglas and Bennett's Principles and Practice of Infectious Diseases. 4th ed. New York: Churchill Livingstone; 1995. pp. 1719-1727 - 12.
Leclercq R. Mechanisms of resistance to macrolides and lincosamides: Nature of the resistance elements and their clinical implications. Clinical Infectious Diseases. 2002; 34 :482-492. DOI: 10.1086/324626 - 13.
Weisblum B. Erythromycin resistance by ribosome modification. Antimicrobial Agents and Chemotherapy. 1995; 39 :577-585 - 14.
Roberts MC, Sutcliffe J, Courvalin P, Jensen LB, Rood J, Seppala H. Nomenclature for macrolide and macrolide-lincosamide-streptogramin B resistance determinants. Antimicrobial Agents and Chemotherapy. 1999; 43 :2823-2830 - 15.
Ross JI, Eady EA, Cove JH, Cunliffe WJ, Baumberg S, Wootton JC. Inducible erythromycin resistance in staphylococci is encoded by a member of the ATP-binding transport super-gene family. Molecular Microbiology. 1990; 4 :1207-1214 - 16.
Kerr ID, Reynolds ED, Cove JH. ABC proteins and antibiotic drug resistance: is it all about transport? Biochemical Society Transactions. 2005; 33 :1000-1002. DOI: 10.1042/BST20051000 - 17.
Jacquet E, Girard JM, Ramaen O, Pamlard O, Lévaique H, Betton JM, Dassa E, Chesneau O. ATP hydrolysis and pristinamycin IIA inhibition of the Staphylococcus aureus Vga(A), a dual ABC protein involved in streptogramin A resistance. The Journal of Biological Chemistry. 2008;283 :25332-25339. DOI: 10.1074/jbc.M800418200 - 18.
Novotna G, Janata J. A new evolutionary variant of the streptogramin A resistance protein, Vga(A)LC, from Staphylococcus haemolyticus with shifted substrate specificity towards lincosamides. Antimicrobial Agents and Chemotherapy. 2006;50 :4070-4076. DOI: 10.1128/AAC.00799-06 - 19.
Allignet J, El Solh N. Characterization of a new staphylococcal gene, vgaB , encoding a putative ABC transporter conferring resistance to streptogramin A and related compounds. Gene. 1997;202 :133-138 - 20.
Haroche J, Allignet J, Aubert S, Van Den Bogaard AE, El Solh N. satG , conferring resistance to streptogramin A, is widely distributed inEnterococcus faecium strains but not in staphylococci. Antimicrobial Agents and Chemotherapy. 2000;44 :190-191 - 21.
Kadlec K, Schwarz S. Identification of a plasmid-borne resistance gene cluster comprising the resistance genes erm (T),dfrK , andtet (L) in a porcine methicillin-resistantStaphylococcus aureus ST398 strain. Antimicrobial Agents and Chemotherapy. 2010;54 :915-918. DOI: 10.1128/AAC.01091-09 - 22.
Jung YH, Shin ES, Kim O, Yoo JS, Lee KM, Yoo JI, Chung GT, Lee YS. Characterization of two newly identified genes, vgaD andvatH , [corrected] conferring resistance to streptogramin A inEnterococcus faecium . Antimicrobial Agents and Chemotherapy. 2010;54 :4744-4749. DOI: 10.1128/AAC.00798-09 - 23.
Wendlandt S, Lozano C, Kadlec K, Gómez-Sanz E, Zarazaga M, Torres C, Schwarz S. The enterococcal ABC transporter gene lsa (E) confers combined resistance to lincosamides, pleuromutilins and streptogramin A antibiotics in methicillin-susceptible and methicillin-resistantStaphylococcus aureus . The Journal of Antimicrobial Chemotherapy. 2013;68 :473-475. DOI: 10.1093/jac/dks398 - 24.
Lozano C, Aspiroz C, Rezusta A, Gómez-Sanz E, Simon C, Gómez P, Ortega C, Revillo MJ, Zarazaga M, Torres C. Identification of novel vga (A)-carrying plasmids and a Tn5406 -like transposon in meticillin-resistantStaphylococcus aureus andStaphylococcus epidermidis of human and animal origin. International Journal of Antimicrobial Agents. 2012;40 :306-312. DOI: 10.1016/j.ijantimicag.2012.06.009 - 25.
Hauschild T, Fessler AT, Kadlec K, Billerbeck C, Schwarz S. Detection of the novel vga (E) gene in methicillin-resistantStaphylococcus aureus CC398 isolates from cattle and poultry. The Journal of Antimicrobial Chemotherapy. 2012;67 :503-504. DOI: 10.1093/jac/dkr446 - 26.
Hot C, Berthet N, Chesneau O. Characterization of sal (A), a novel gene responsible for lincosamide and streptogramin A resistance inStaphylococcus sciuri . Antimicrobial Agents and Chemotherapy. 2014;58 :3335-3341. DOI: 10.1128/AAC.02797-13 - 27.
Ounissi H, Courvalin P. Nucleotide sequence of the gene ereA encoding the erythromycin esterase inEscherichia coli . Gene. 1985;35 :271-278 - 28.
Arthur M, Andremont A, Courvalin P. Distribution of erythromycin esterase and rRNA methylase genes in members of the family Enterobacteriaceae highly resistant to erythromycin. Antimicrobial Agents and Chemotherapy. 1987;31 :404-409 - 29.
Wondrack L, Massa M, Yang BV, Sutcliffe J. Clinical strain of Staphylococcus aureus inactivates and causes efflux of macrolides. Antimicrobial Agents and Chemotherapy. 1996;40 :992-998 - 30.
Chesneau O, Tsvetkova K, Courvalin P. Resistance phenotypes conferred by macrolide phosphotransferases. FEMS Microbiology Letters. 2007; 269 :317-322. DOI: 10.1111/j.1574-6968.2007.00643.x - 31.
Brisson-Noël A, Delrieu P, Samain D, Courvalin P. Inactivation of lincosaminide antibiotics in Staphylococcus . Identification of lincosaminide O-nucleotidyltransferases and comparison of the corresponding resistance genes. The Journal of Biological Chemistry. 1988;263 :15880-15887 - 32.
Brisson-Noël A, Courvalin P. Nucleotide sequence of gene linA encoding resistance to lincosamide in Staphylococcus haemolyticus . Gene. 1986;43 :247-253 - 33.
Bozdogan B, Berrezouga L, Kuo M, Yurek D, Farley K, Stockman B, Leclercq R. A new resistance gene, linB , conferring resistance to lincosamides by nucleotidylation inEnterococcus faecium HM1025. Antimicrobial Agents and Chemotherapy. 1999;43 :925-929 - 34.
Allignet J, Liassine N, El Solh N. Characterization of a staphylococcal plasmid related to pUB110 and carrying two novel genes, vatC andvgbB , encoding resistance to streptogramins A and B and similar antibiotics. Antimicrobial Agents and Chemotherapy. 1998;42 :1794-1798 - 35.
Mukhtar TA, Koteva KP, Hughes DW, Wright GD. Vgb from Staphylococcus aureus inactivates streptogramin B antibiotics by an elimination mechanism not hydrolysis. Biochemistry. 2001;40 :8877-8886 - 36.
Prunier AL, Malbruny B, Tandé D, Picard B, Leclercq R. Clinical isolates of Staphylococcus aureus with ribosomal mutations conferring resistance to macrolides. Antimicrobial Agents and Chemotherapy. 2002;46 :3054-3056 - 37.
Liakopoulos A, Neocleous C, Klapsa D, Kanellopoulou M, Spiliopoulou I, Mathiopoulos KD, Papafrangas E, Petinaki E. A T2504A mutation in the 23S rRNA gene responsible for high-level resistance to linezolid of Staphylococcus epidermidis . The Journal of Antimicrobial Chemotherapy. 2009;64 :206-207 - 38.
Weisblum B. Insights into erythromycin action from studies of its activity as inducer of resistance. Antimicrobial Agents and Chemotherapy. 1995; 39 :797-780 - 39.
Watanakunakorn C. Clindamycin therapy of Staphylococcus aureus endocarditis: Clinical relapse and development of resistance to clindamycin, lincomycin and erythromycin. The American Journal of Medicine. 1976;60 :419-425 - 40.
Drinkovic D, FulleR ER, Shore KP, Holland DJ, Ellis-Pegler R. Clindamycin treatment of Staphylococcus aureus expressing inducible clindamycin resistance. The Journal of Antimicrobial Chemotherapy. 2001;48 :315-316 - 41.
Lina G, Quaglia A, Reverdy ME, Leclercq R, Vandenesch F, Etienne J. Distribution of genes encoding resistance to macrolides, lincosamides, and streptogramins among staphylococci. Antimicrobial Agents and Chemotherapy. 1999; 43 :1062-1066 - 42.
Malbruny B, Werno AM, Murdoch DR, Leclercq R, Cattoir V. Cross-resistance to lincosamides, streptogramins A, and pleuromutilins due to the lsa (C) gene inStreptococcus agalactiae UCN70. Antimicrobial Agents and Chemotherapy. 2011;55 :1470-1474 - 43.
Deng F, Wang H, Liao Y, Li J, Feßler AT, Michael GB, Schwarz S, Wang Y. Detection and genetic environment of pleuromutilin-lincosamide-streptogramin A resistance genes in staphylococci isolated from pets. Frontiers in Microbiology. 2017; 8 :234. DOI: 10.3389/fmicb.2017.00234 - 44.
Tessé S, Trueba F, Berthet N, Hot C, Chesneau O. Resistance genes underlying the LSA phenotype of staphylococcal isolates from France. Antimicrobial Agents and Chemotherapy. 2013; 57 :4543-4546. DOI: 10.1128/AAC.00259-13 - 45.
Leclercq R, Brisson-Noël A, Duval J, Courvalin P. Phenotypic expression and genetic heterogeneity of lincosamide inactivation in Staphylococcus spp. Antimicrobial Agents and Chemotherapy. 1987;31 :1887-1891 - 46.
Singh KV, Murray BE. Differences in the Enterococcus faecalis lsa locus that influence susceptibility to quinupristin-dalfopristin and clindamycin. Antimicrobial Agents and Chemotherapy. 2005;49 :32-39. DOI: 10.1128/AAC.49.1.32-39.2005 - 47.
Derek H. Activity of erythromycin against Staphylococcus aureus . British Medical Journal. 1954;1 :236-239 - 48.
Macleod AJ, Ross HB, Ozere RL, Digout G, Rooyenc V. Lincomycin: A new antibiotic active against staphylococci and other gram-positive cocci: Clinical and laboratory studies. Canadian Medical Association Journal. 1964; 91 :1056-1060 - 49.
Weaver JR, Pattee PA. Inducible resistance to erythromycin in Staphylococcus aureus . Journal of Bacteriology. 1964;88 :574-580 - 50.
Gtiffith LJ, Ostrander WE, Mullins CG, Beswick DE. Drug antagonism betweeen lincomycin and erythromycin. Science. 1965; 147 :746-747 - 51.
Lai CJ, Weisblum B. Altered methylation of ribosomal RNA in an erythromycin-resistant strain of Staphylococcus aureus . Proceedings of the National Academy of Sciences of the United States of America. 1971;68 :856-860 - 52.
Barta A, Steiner G, Brosius J, Noller HF, Kuechler E. Identification of a site on 23S ribosomal RNA located at the peptidyl transferase center. Proceedings of the National Academy of Sciences of the United States of America. 1984; 81 :3607-3611 - 53.
Murphy E. Nucleotide sequence of ermA , a macrolide-lincosamide-streptogramin B determinant inStaphylococcus aureus . Journal of Bacteriology. 1985;162 :633-640 - 54.
Wu SW, de Lencastre H, Tomasz A. The Staphylococcus aureus transposon Tn551 : Complete nucleotide sequence and transcriptional analysis of the expression of the erythromycin resistance gene. Microbial Drug Resistance. 1999;5 :1-7 - 55.
Projan SJ, Monod M, Narayanan CS, Dubnau D. Replication properties of pIM13, a naturally occurring plasmid found in Bacillus subtilis , and of its close relative pE5, a plasmid native toStaphylococcus aureus . Journal of Bacteriology. 1987;169 :5131-5139 - 56.
Chung WO, Werckenthin C, Schwarz S, Roberts MC. Host range of the ermF rRNA methylase gene in bacteria of human and animal origin. The Journal of Antimicrobial Chemotherapy. 1999;43 :5-14 - 57.
Matsuoka M, Inoue M, Nakajima Y, Endo Y. New erm gene inStaphylococcus aureus clinical isolates. Antimicrobial Agents and Chemotherapy. 2002;46 :211-215 - 58.
Fiebelkorn KR, Crawford SA, McElmeel ML, Jorgensen JH. Practical disc diffusion method for the detection of inducible clindamycin resistance in Staphylococcus aureus and coagulase negativeStaphylococcus . Journal of Clinical Microbiology. 2003;41 :4740-4744 - 59.
Mallick SK, Basak S, Bose S. Inducible clindamycin resistance in Staphylococcus aureus . A therapeutic challenge. Journal of Clinical and Diagnostic Research. 2009;3 :1513-1518 - 60.
Rajaduraipandi K, Mani KR, Panneerselvam K, Mani M, Bhaskar M, Manikandan P. The prevalence and the antimicrobial susceptibility pattern of the methicillin resistant Staphylococcus aureus: A multicentre study. Indian Journal of Medical Microbiology. 2006; 24 :34-38 - 61.
Vivek JS, Rajesh GN, Mukesh S, Manpreet K, Misra RN, Matnani GB, Ujagare MT, Saikat B, Kumar A. The prevalence of inducible clindamycin resistance among community-and hospital-associated Staphylococcus aureus isolates in a tertiary care hospital in India. Biomedical Research. 2011;22 :465-469 - 62.
Kasten MJ. Clindamycin, metronidazole, and chloramphenicol. Mayo Clinic Proceedings. 1999; 74 :825-833 - 63.
Saiman L, O’Keefe M, Graham PL III, Wu F, Said-Salim B, Kreiswirth B, LaSala A, Schlievert PM, Della-Latta P. The hospital transmission of community-acquired methicillin resistant Staphylococcus aureus among postpartum women. Clinical Infectious Diseases. 2003;37 :1313-1319 - 64.
Otsuka T, Zaraket H, Takano T, Saito K, Dohmae S, Higuchi W, Yamamoto T. Macrolide-lincosamide-streptogramin B resistance phenotypes and genotypes among Staphylococcus aureus clinical isolates in Japan. Clinical Microbiology and Infection. 2007;13 :325-327. DOI: 10.1111/j.1469-0691.2006.01632.x - 65.
Cetin ES, Gunes H, Kaya S, Aridogan BC, Demirci M. Macrolide-lincosamide-streptogramin B resistance phenotypes in clinical staphylococcal isolates. International Journal of Antimicrobial Agents. 2008; 31 :364-368. DOI: 10.1016/j.ijantimicag.2007.11.014 - 66.
Uzun B, Güngör S, Pektaş B, Aksoy Gökmen A, Yula E, Koçal F, Kaya S. Macrolide-lincosamide-streptogramin B (MLSB) resistance phenotypes in clinical Staphylococcus isolates and investigation of telithromycin activity. Mikrobiyoloji Bülteni. 2014; 48 :469-476 - 67.
Vallianou N, Evangelopoulos A, Hadjisoteriou M, Avlami A, Petrikkos G. Prevalence of macrolide, lincosamide, and streptogramin resistance among staphylococci in a tertiary care hospital in Athens, Greece. Journal of Chemotherapy. 2015; 27 :319-323. DOI: 10.1179/1973947814Y.0000000205 - 68.
Petrikkos G, Vallianou N, Evangelopoulos A, Gourni M, Bagatzouni D, Syriopoulou V, Daikos GL. Prevalence of macrolide resistance genes among staphylococci in Cyprus. Journal of Chemotherapy. 2006; 18 :480-484. DOI: 10.1179/joc.2006.18.5.480 - 69.
Bagcigil FA, Moodley A, Baptiste KE, Jensen VF, Guardabassi L. Occurrence, species distribution, antimicrobial resistance and clonality of methicillin- and erythromycin-resistant staphylococci in the nasal cavity of domestic animals. Veterinary Microbiology. 2007; 121 :307-315. DOI: 10.1016/j.vetmic.2006.12.007 - 70.
Schmitz FJ, Sadurski R, Kray A, Boos M, Geisel R, Köhrer K, Verhoef J, Fluit AC. Prevalence of macrolide-resistance genes in Staphylococcus aureus andEnterococcus faecium isolates from 24 European university hospitals. The Journal of Antimicrobial Chemotherapy. 2000;45 :891-894 - 71.
Azap OK, Arslan H, Timurkaynak F, Yapar G, Oruc E, Gagir U. Incidence of inducible clindamycin resistance in staphylococci: First results from Turkey. Clinical Microbiology and Infection. 2005; 11 :582-584. DOI: 10.1111/j.1469-0691.2005.01174.x - 72.
Schmitz FJ, Petridou J, Fluit AC, Hadding U, Peters G, von Eiff C. Distribution of macrolide-resistance genes in Staphylococcus aureus blood-culture isolates from fifteen German university hospitals. M.A.R.S. Study Group. Multicentre Study on Antibiotic Resistance in Staphylococci. European Journal of Clinical Microbiology & Infectious Diseases. 2000; 19 :385-387 - 73.
Schreckenberger PC, Ilendo E, Ristow KL. Incidence of constitutive and inducible clindamycin resistance in Staphylococcus aureus and coagulase-negative staphylococci in a community and a tertiary care hospital. Journal of Clinical Microbiology. 2004;42 :2777-2779. DOI: 10.1128/JCM.42.6.2777-2779.2004 - 74.
Spiliopoulou I, Petinaki E, Papandreou P, Dimitracopoulos G. erm (C) is the predominant genetic determinant for the expression of resistance to macrolides among methicillinresistantStaphylococcus aureus clinical isolates in Greece. The Journal of Antimicrobial Chemotherapy. 2004;53 :814-817. DOI: 10.1093/jac/dkh197 - 75.
Gatermann SG, Koschinski T, Friedrich S. Distribution and expression of macrolide resistance genes in coagulase-negative staphylococci. Clinical Microbiology and Infection. 2007; 13 :777-781. DOI: 10.1111/j.1469-0691.2007.01749.x - 76.
Lozano C, Aspiroz C, Ara M, Gómez-Sanz E, Zarazaga M, Torres C. Methicillin-resistant Staphylococcus aureus (MRSA) ST398 in a farmer with skin lesions and in pigs of his farm: Clonal relationship and detection oflnu (A) gene. Clinical Microbiology and Infection. 2011;17 :923-927. DOI: 10.1111/j.1469-0691.2010.03437.x - 77.
Sarrou S, Liakopoulos A, Chasioti M, Foka A, Fthenakis G, Billinis C, Spyrou V, Pantelidi K, Roussaki-Schulze A, Lachanas V, Makaritsis K, Skoulakis C, Daikos GL, Dalekos G, Spiliopoulou I, Petinaki E. Dissemination of methicillin-susceptible CC398 Staphylococcus aureus strains in a rural Greek area. PLoS One. 2015;10 :e0122761. DOI: 10.1371/journal.pone.0122761 - 78.
Sarrou S, Liakopoulos A, Tsoumani K, Sagri E, Mathiopoulos KD, Tzouvelekis LS, Miriagou V, Petinaki E. Characterization of a novel lsa (E)- andlnu (B)-carrying structure located in the chromosome of a Staphylococcus aureus sequence type 398 strain. Antimicrobial Agents and Chemotherapy. 2015;60 :1164-1166. DOI: 10.1128/AAC.01178-15 - 79.
Lüthje P, Schwarz S. Antimicrobial resistance of coagulase-negative staphylococci from bovine subclinical mastitis with particular reference to macrolide-lincosamide resistance phenotypes and genotypes. The Journal of Antimicrobial Chemotherapy. 2006; 57 :966-969. DOI: 10.1093/jac/dkl061 - 80.
Li L, Feng W, Zhang Z, Xue H, Zhao X. Macrolide-lincosamide-streptogramin resistance phenotypes and genotypes of coagulase-positive Staphylococcus aureus and coagulase-negative staphylococcal isolates from bovine mastitis. BMC Veterinary Research. 2015;11 :168. DOI: 10.1186/s12917-015-0492-8