Primer sequences and PCR fragment size of tested MLS resistance genes.
\r\n\tThe LED can be lingering further into three major categories are (i) Traditional inorganic LEDs, (ii) Organic LEDs (Small Molecule OLED, Polymer LED, Passive Matrix OLED Active Matrix OLED), (iii) High brightness LEDs, (iv) Deep-UV LEDs, (v) Active Matrix Organic Light-Emitting Diodes (AMOLED).
",isbn:"978-1-83968-886-7",printIsbn:"978-1-83968-885-0",pdfIsbn:"978-1-83968-887-4",doi:null,price:0,priceEur:0,priceUsd:0,slug:null,numberOfPages:0,isOpenForSubmission:!1,hash:"97e861d1556a639f0e5cc6ee8bdb0a0f",bookSignature:"Prof. Jagannathan Thirumalai",publishedDate:null,coverURL:"https://cdn.intechopen.com/books/images_new/10559.jpg",keywords:"Aluminum Gallium Arsenide, Gallium Arsenide Phosphide, Indium Phosphide, Thin-Film-Display, Organic Rare-Earth Complexes, Colour Rendering Index, High Brightness Leds, Luminous Control, Air Purification, Skin Therapy, Organic Compounds Form the Electroluminescent Material, Specific Type of Thin-Film-Display",numberOfDownloads:4,numberOfWosCitations:0,numberOfCrossrefCitations:0,numberOfDimensionsCitations:0,numberOfTotalCitations:0,isAvailableForWebshopOrdering:!0,dateEndFirstStepPublish:"September 21st 2020",dateEndSecondStepPublish:"October 19th 2020",dateEndThirdStepPublish:"December 18th 2020",dateEndFourthStepPublish:"March 8th 2021",dateEndFifthStepPublish:"May 7th 2021",remainingDaysToSecondStep:"3 months",secondStepPassed:!0,currentStepOfPublishingProcess:4,editedByType:null,kuFlag:!1,biosketch:"As an expert in the optoelectronics and nanotechnology area, Dr.Thirumalai has been invited to examine several MSc and Ph.D. theses, invited to give a talk in various forums, and to review papers for international and national journals.",coeditorOneBiosketch:null,coeditorTwoBiosketch:null,coeditorThreeBiosketch:null,coeditorFourBiosketch:null,coeditorFiveBiosketch:null,editors:[{id:"99242",title:"Prof.",name:"Jagannathan",middleName:null,surname:"Thirumalai",slug:"jagannathan-thirumalai",fullName:"Jagannathan Thirumalai",profilePictureURL:"https://mts.intechopen.com/storage/users/99242/images/system/99242.png",biography:"Dr. J. Thirumalai received his Ph.D. from Alagappa University, Karaikudi in 2010. \n\nHe was awarded the Post-doctoral Fellowship from Pohang University of Science and Technology (POSTECH), Republic of Korea, in 2013.\nHe worked as an Assistant Professor of Physics, B.S. Abdur Rahman University, Chennai, India (2011 to 2016). \nCurrently, he is working as an Assistant Professor & Head of the Department of Physics, SASTRA Deemed to be University, Kumbakonam (T.N.), India. \n\nHis research interests focus on luminescence, self-assembled nanomaterials, thin-film optoelectronic devices & Supercapacitors. \n\nHe has published more than 60 SCOPUS/ISI indexed papers, 11 book chapters, and he edited 5 books. He is serving as a member in various national and international societies. Currently, he is acting as a principal investigator for a funded project towards the application of luminescence-based thin-film optoelectronic devices, funded by the Science and Engineering Research Board (SERB), India. \nAs an expert in optoelectronics and nanotechnology area, he has been invited to examine several MSc and Ph.D. theses, invited to give a talk in various forums and to review papers for international and national journals.",institutionString:"SASTRA University",position:null,outsideEditionCount:0,totalCites:0,totalAuthoredChapters:"10",totalChapterViews:"0",totalEditedBooks:"6",institution:{name:"SASTRA University",institutionURL:null,country:{name:"India"}}}],coeditorOne:null,coeditorTwo:null,coeditorThree:null,coeditorFour:null,coeditorFive:null,topics:[{id:"11",title:"Engineering",slug:"engineering"}],chapters:[{id:"74673",title:"Economic Applications for LED Lights in Industrial Sectors",slug:"economic-applications-for-led-lights-in-industrial-sectors",totalDownloads:5,totalCrossrefCites:0,authors:[{id:"150046",title:"Prof.",name:"Muhammad M.A.S.",surname:"Mahmoud",slug:"muhammad-m.a.s.-mahmoud",fullName:"Muhammad M.A.S. Mahmoud"}]}],productType:{id:"1",title:"Edited Volume",chapterContentType:"chapter",authoredCaption:"Edited by"},personalPublishingAssistant:{id:"297737",firstName:"Mateo",lastName:"Pulko",middleName:null,title:"Mr.",imageUrl:"https://mts.intechopen.com/storage/users/297737/images/8492_n.png",email:"mateo.p@intechopen.com",biography:"As an Author Service Manager my responsibilities include monitoring and facilitating all publishing activities for authors and editors. From chapter submission and review, to approval and revision, copyediting and design, until final publication, I work closely with authors and editors to ensure a simple and easy publishing process. I maintain constant and effective communication with authors, editors and reviewers, which allows for a level of personal support that enables contributors to fully commit and concentrate on the chapters they are writing, editing, or reviewing. I assist authors in the preparation of their full chapter submissions and track important deadlines and ensure they are met. I help to coordinate internal processes such as linguistic review, and monitor the technical aspects of the process. As an ASM I am also involved in the acquisition of editors. Whether that be identifying an exceptional author and proposing an editorship collaboration, or contacting researchers who would like the opportunity to work with IntechOpen, I establish and help manage author and editor acquisition and contact."}},relatedBooks:[{type:"book",id:"5348",title:"Luminescence",subtitle:"An Outlook on the Phenomena and their Applications",isOpenForSubmission:!1,hash:"d982c49fed4423a0ea7367af4f917b82",slug:"luminescence-an-outlook-on-the-phenomena-and-their-applications",bookSignature:"Jagannathan Thirumalai",coverURL:"https://cdn.intechopen.com/books/images_new/5348.jpg",editedByType:"Edited by",editors:[{id:"99242",title:"Prof.",name:"Jagannathan",surname:"Thirumalai",slug:"jagannathan-thirumalai",fullName:"Jagannathan Thirumalai"}],productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"6489",title:"Light-Emitting Diode",subtitle:"An Outlook On the Empirical Features and Its Recent Technological Advancements",isOpenForSubmission:!1,hash:"20818f168134f1af35547e807d839463",slug:"light-emitting-diode-an-outlook-on-the-empirical-features-and-its-recent-technological-advancements",bookSignature:"Jagannathan Thirumalai",coverURL:"https://cdn.intechopen.com/books/images_new/6489.jpg",editedByType:"Edited by",editors:[{id:"99242",title:"Prof.",name:"Jagannathan",surname:"Thirumalai",slug:"jagannathan-thirumalai",fullName:"Jagannathan Thirumalai"}],productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"6242",title:"Hydroxyapatite",subtitle:"Advances in Composite Nanomaterials, Biomedical Applications and Its Technological Facets",isOpenForSubmission:!1,hash:"6a18a9b6617ae6d943649ea7ad9655cc",slug:"hydroxyapatite-advances-in-composite-nanomaterials-biomedical-applications-and-its-technological-facets",bookSignature:"Jagannathan Thirumalai",coverURL:"https://cdn.intechopen.com/books/images_new/6242.jpg",editedByType:"Edited by",editors:[{id:"99242",title:"Prof.",name:"Jagannathan",surname:"Thirumalai",slug:"jagannathan-thirumalai",fullName:"Jagannathan Thirumalai"}],productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"5699",title:"Thin Film Processes",subtitle:"Artifacts on Surface Phenomena and Technological Facets",isOpenForSubmission:!1,hash:"164177fc1e3eca542ebad5fd34a79d1e",slug:"thin-film-processes-artifacts-on-surface-phenomena-and-technological-facets",bookSignature:"Jagannathan Thirumalai",coverURL:"https://cdn.intechopen.com/books/images_new/5699.jpg",editedByType:"Edited by",editors:[{id:"99242",title:"Prof.",name:"Jagannathan",surname:"Thirumalai",slug:"jagannathan-thirumalai",fullName:"Jagannathan Thirumalai"}],productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"9414",title:"Advances in Condensed-Matter and Materials Physics",subtitle:"Rudimentary Research to Topical Technology",isOpenForSubmission:!1,hash:"3aebac680de7d3af200eadd0a0b2f737",slug:"advances-in-condensed-matter-and-materials-physics-rudimentary-research-to-topical-technology",bookSignature:"Jagannathan Thirumalai and Sergey Ivanovich Pokutnyi",coverURL:"https://cdn.intechopen.com/books/images_new/9414.jpg",editedByType:"Edited by",editors:[{id:"99242",title:"Prof.",name:"Jagannathan",surname:"Thirumalai",slug:"jagannathan-thirumalai",fullName:"Jagannathan Thirumalai"}],productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"6124",title:"Micro/Nanolithography",subtitle:"A Heuristic Aspect on the Enduring Technology",isOpenForSubmission:!1,hash:"c94caf617c31b349bd3d9dd054a022a3",slug:"micro-nanolithography-a-heuristic-aspect-on-the-enduring-technology",bookSignature:"Jagannathan Thirumalai",coverURL:"https://cdn.intechopen.com/books/images_new/6124.jpg",editedByType:"Edited by",editors:[{id:"99242",title:"Prof.",name:"Jagannathan",surname:"Thirumalai",slug:"jagannathan-thirumalai",fullName:"Jagannathan Thirumalai"}],productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"1591",title:"Infrared Spectroscopy",subtitle:"Materials Science, Engineering and Technology",isOpenForSubmission:!1,hash:"99b4b7b71a8caeb693ed762b40b017f4",slug:"infrared-spectroscopy-materials-science-engineering-and-technology",bookSignature:"Theophile Theophanides",coverURL:"https://cdn.intechopen.com/books/images_new/1591.jpg",editedByType:"Edited by",editors:[{id:"37194",title:"Dr.",name:"Theophanides",surname:"Theophile",slug:"theophanides-theophile",fullName:"Theophanides Theophile"}],productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"3092",title:"Anopheles mosquitoes",subtitle:"New insights into malaria vectors",isOpenForSubmission:!1,hash:"c9e622485316d5e296288bf24d2b0d64",slug:"anopheles-mosquitoes-new-insights-into-malaria-vectors",bookSignature:"Sylvie Manguin",coverURL:"https://cdn.intechopen.com/books/images_new/3092.jpg",editedByType:"Edited by",editors:[{id:"50017",title:"Prof.",name:"Sylvie",surname:"Manguin",slug:"sylvie-manguin",fullName:"Sylvie Manguin"}],productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"3161",title:"Frontiers in Guided Wave Optics and Optoelectronics",subtitle:null,isOpenForSubmission:!1,hash:"deb44e9c99f82bbce1083abea743146c",slug:"frontiers-in-guided-wave-optics-and-optoelectronics",bookSignature:"Bishnu Pal",coverURL:"https://cdn.intechopen.com/books/images_new/3161.jpg",editedByType:"Edited by",editors:[{id:"4782",title:"Prof.",name:"Bishnu",surname:"Pal",slug:"bishnu-pal",fullName:"Bishnu Pal"}],productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"72",title:"Ionic Liquids",subtitle:"Theory, Properties, New Approaches",isOpenForSubmission:!1,hash:"d94ffa3cfa10505e3b1d676d46fcd3f5",slug:"ionic-liquids-theory-properties-new-approaches",bookSignature:"Alexander Kokorin",coverURL:"https://cdn.intechopen.com/books/images_new/72.jpg",editedByType:"Edited by",editors:[{id:"19816",title:"Prof.",name:"Alexander",surname:"Kokorin",slug:"alexander-kokorin",fullName:"Alexander Kokorin"}],productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}}]},chapter:{item:{type:"chapter",id:"60007",title:"Resistance of Staphylococci to Macrolides-Lincosamides- Streptogramins B (MLSB): Epidemiology and Mechanisms of Resistance",doi:"10.5772/intechopen.75192",slug:"resistance-of-staphylococci-to-macrolides-lincosamides-streptogramins-b-mlsb-epidemiology-and-mechan",body:'\nResistance to macrolides-lincosamides and streptogramins B (MLSB antibiotics) is associated with three main mechanisms: (1) methylation of rRNA (target modification), (2) active efflux and (3) enzymatic inactivation. Till date, a total of 92 genes, conferring resistance to MLSB antibiotics, have been described. The most common genes are erm, which encode rRNA methylases, resulting in the target modification of these antimicrobial agents. More than 42 different erm genes have been described to date; bacteria, that carry erm genes, express cross-resistance to all these classes of antimicrobial agents. On contrary, genes encoding pumps for active efflux (msrA and lsa) or enzymes for drug inactivation (lnu and mphC) confer resistance only to particular antibiotics. Based on the mechanisms of resistance, various resistant phenotypes are expressed. The most prevalent phenotypes are ΜLSB (constitutive or inducible), which, in staphylococci, are associated with the presence mainly of ermA and ermC genes, followed by the MSB phenotype due to the presence of msrA gene. In livestock S. aureus strains, such as CC 398, other genes such as ermT, lnuA, lsaE and mphC genes are detected [1, 2, 3, 4].
\nThe macrolide group of antibiotics includes natural members, prodrugs and semisynthetic derivatives. The chemical structure of macrolides is characterized by a large lactone ring containing from 12 to 16 atoms to which are attached, via glycosidic bonds, one or more sugars. Erythromycin, whose lactone ring contains 14 atoms, is the oldest molecule (1952), whereas all second-generation macrolides, like roxithromycin and clarithromycin, are hemisynthetic derivatives of erythromycin. Azithromycin is the only macrolide with 15 carbon atoms. Azithromycin, which is produced through the introduction of a nitrogen atom into the macrolide nucleus at C10, exhibits (1) improved penetration into macrophages, fibroblasts and polymorpho-neutrophils, (2) increased accumulation within acidified vacuoles and (3) extended half-life. Additionally, azithromycin shows improved activity against Gram-negative bacteria and other pathogens associated with parasitic infections. Spiramycin and josamycin are macrolides with 16 carbon atoms. All chemical modifications of macrolides were made in order that their properties and action are optimized.
\nAlthough the structure of lincosamides is different from the structure of macrolides, they present a similar action spectrum. Lincomycin, which was isolated in 1962, is a fermentation product of Streptococcus lincolnensis. Clindamycin (7-chloro-7-deoxy-lincomycin) is a semisynthetic derivative of lincomycin, produced by substitution of the C7 bearing a hydroxyl group with a chlorine atom. Clindamycin exhibits higher antibiotic activity and digestive absorption.
\nType-A streptogramin includes cyclic-poly-unsaturated macrolactones: virginiamycin M, pristinamycin IIA and dalfopristin. Type-B streptogramin consists of the cyclic hexadepsipeptide compounds virginiamycin S, pristinamycin IA and quinupristin. Until now, only three streptogramins have been marketed either for treatment or growth promotion: virginiamycin, pristinamycin and quinupristin-dalfopristin. Virginiamycin, a mixture of virginiamycin M (type A streptogramin) and virginiamycin S (type B streptogramin), has been used mainly as growth promoter feed additive in commercial animal farming in the United States and Europe. In contrast, pristinamycin has been used orally and topically in human medicine only in France. Qiunupristin-dalfopristin, in a 30:70 mixture (Synercid), was approved in 1999 for the treatment of serious infections caused by multidrug resistant Gram-positive pathogens, including vancomycin-resistant Enterococcus faecium and methicillin-resistant staphylococci (MRS).
\nMLSB antibiotics share a similar mode of action because they inhibit protein synthesis by targeting the peptidyl transferase center within the 50S subunit (23 s rRNA) of the bacterial ribosome [5]. We note that the bacterial ribosomes are 70S particles comprising of two subunits, 30s and 50S, which are made of RNAs enveloped by proteins; 50S is composed of 5S, 23S rRNAs and 36 proteins (L1-L36) [6, 7].
\nAlthough the peptidyl transferase center is the main target site for many antibiotics, the exact mechanism for its activity is still unclear [8]. Overall, the inhibitory action of antibiotics is not only determined by their interaction with specific nucleotides. MLSB could also inhibit peptidyl transferase by interfering with the proper positioning and movement of the tRNAs at the peptidyl transferase cavity [9, 10].
\nΤhe spectrum of MLSB includes mainly Gram-positive microorganisms (streptococci, staphylococci); however, some of them also have activity against Gram-negative microorganisms (Bordetella pertussis, Campylobacter, Helicobacter, Legionella, Moraxella catarrhalis), anaerobes, intracellular pathogens (Chlamydia and Rickettsia) and Mycobacterium avium [11, 12].
\nIt is known that some Gram-positive species have intrinsic resistance to some of them. Enterococcus faecalis, E. avium, E. gallinarum and E. casseliflavus express resistance to lincosamides. Among staphylococci, S. cohnii, S. xylosus and S. sciuri are also resistant to lincosamides [11, 12].
\nStaphylococci resist MLSB antibiotics in three ways: (1) through target-site modification by methylation or mutation that prevents the binding of the antibiotic to its ribosomal target, (2) through efflux of the antibiotic and (3) by drug inactivation. Modification of the ribosomal target confers broad-spectrum resistance to macrolides, lincosamides and streptogramin B, whereas efflux and inactivation affect only some of these molecules [12].
\nThe most widespread mechanism of resistance to MLSB in Gram-positive bacteria, including both Staphylococcus aureus and coagulase-negative staphylococci (CNS), is the methylation of ribosomes, which is the target of MLS antibiotics. Methylation of ribosomes leads to resistance to macrolides, lincosamides and streptogramins B (MLSB phenotype) [13]. The MLSB phenotype is conferred by erythromycin ribosome methylases (Erm), which are encoded by erm genes. erm genes have been reported in a large number of microorganisms [14].
\nErm proteins, encoded by erm genes, dimethylate the A2058 residue of 23S rRNA [13], which is located within the conserved domain V of 23S rRNA in the bacterial ribosome. Domain V of the 23S rRNA plays a key role in the binding of MLSB antibiotics. Methylation of 23S rRNA impairs binding of macrolides, lincosamides and streptogramins B, which accounts for the cross-resistance to these drugs. A wide range of microorganisms, including Gram-positive bacteria, spirochetes and anaerobes, which are targeted for MLSB antibiotics, express Erm methylases.
\nMore than 42 erm genes have been reported so far [14]. In bacteria, erm genes are usually carried by plasmids and transposons that are able to move independently. Four major classes are detected in microorganisms: ermA, ermB, ermC and ermF [13, 14]. ermA and ermC typically are staphylococcal gene classes.
\nIn Gram-positive organisms, acquisition of macrolide resistance by active efflux is caused by two classes of pumps, members of the ATP-binding-cassette (ABC) transporter superfamily and of the major facilitator superfamily (MFS). ABC transporters require ATP to function and are usually formed by a channel comprising two membrane-spanning domains and two ATP-binding domains located at the cytosolic surface of the membrane [12].
\nThe first determinant encoding ABC transporter in staphylococci was the plasmid-borne msr(A) gene [15]. The msr(A) gene encodes an ABC transporter protein with two ATP-binding domains. The nature of the transmembrane component of the MsrA pump remains unknown. In nature, a fully operational efflux pump is a multicomponent system that is composed of proteins encoded by msr(A) and chromosomal genes. MsrA pump has specificity for 14- and 15-membered macrolides and type B streptogramins (the MSB phenotype) [15]. MSB resistance phenotype is inducibly expressed by 14- and 15-membered macrolides, whereas streptogramins B are not inducers. msrA-positive strains are fully susceptible to clindamycin, since this antibiotic is neither an inducer nor a substrate for the pump.
\nHowever, latter, the combined resistance to lincosamides, pleuromutilins and streptogramin A (SA), referred as the PLSA phenotype, was found to be associated with the presence of the ARE subfamily of class 2 ATP-binding cassette (ABC) ATPases, a class of ABC proteins made up of two homologous ABC ATPase domains separated by a flexible linker without any identifiable transmembrane domains [16, 17, 18]. The flexible linker between each ATPase domain is presumed to be the drug-binding region of the ARE proteins. The vga-, lsa- and sal-like genes, encoding ABC transporters of the Vga, Lsa, or Sal families confer the PLSA resistance phenotype. These genes have been mainly identified in staphylococci causing food-borne diseases [19, 20, 21, 22, 23, 24, 25, 26].
\nEnzymatic inactivation confers resistance to structurally related antibiotics only. Esterases and phosphotransferases, encoded by ere and mphC genes, respectively, confer resistance to erythromycin and other 14- and 15-membered macrolides but not to lincosamides [27, 28, 29, 30] .
\nIn addition, lincosamide nucleotidyl transferases encoded by lnu(A) (formerly linA) and lnu(B) (formerly linB) genes in staphylococci (S. aureus and coagulase-negative staphylococci) inactivate lincosamides only [14, 31, 32, 33]. In addition, enzymes such as virginiamycin B hydrolase and streptogramin B lactonase, encoded by vgbA and vgbB genes, which hydrolyze streptogramin B, are rarely found in staphylococci [14, 34, 35].
\nRibosomal mutations (A2058G/U or A2059G) of 23S rRNA gene such as mutations in the rplV gene, encoding the L22 ribosomal protein have been reported by Prunier et al. [36]. These rare Staphylococcus aureus isolates, recovered from patients with cystic fibrosis after long-term treatment with azithromycin, were cross-resistant to azithromycin and erythromycin.
\nOn the other hand, Staphylococcus epidermidis isolates, which carried the T2504A mutation of 23S rRNA gene were found to be fully resistant to lincomycin, clindamycin, linezolid and pleuromutilins [37].
\nDepending on the mechanism of resistance and on the carriage of respective genes, staphylococci can express various MLSB resistant phenotypes. Briefly, these types are described as follows.
\nMLSB phenotype can be expressed as constitutive or inducible [12]. Isolates with a constitutive MLSB phenotype express high level cross-resistance to macrolides, lincosamides and streptogramin B. In fact, clinical methicillin-resistant strains that are constitutively resistant to MLSB antibiotics are widespread.
\nOn the other hand, isolates with an inducible MLSB phenotype express phenotypically only resistance to macrolides and susceptibility to lincosamides. This phenomenon is explained by the fact that, in constitutive resistance, bacteria produce an active mRNA encoding methylase, whereas in inducible resistance, bacteria produce an inactive mRNA, which is unable to encode ribosome methylases. However, in the presence of a macrolide, which acts like an inducer, the mRNA becomes active [38]. The presence of an inducer leads to rearrangements of mRNA, which allow ribosomes to translate the methylase coding sequence.
\nInducible expression of ermA or ermC genes is characterized by dissociated resistance to MLSB antibiotics. Dissociated resistance to MLSB antibiotics is due to the differences in the inducing capacity of the antibiotics. For example, 14- and 15-membered ring macrolides, which are inducers, are inactive. Thus, ermA- or ermC-positive strains are phenotypically resistant to these antibiotics. However, strains remain susceptible to 16-membered ring macrolides, lincosamides, and streptogramins B that are not inducers.
\nThe use of antibiotics being noninducers (such as clindamycin) for treatment of an infection due to a Staphylococcus aureus that is inducibly resistant to MLSB antibiotics is not devoid of risk. In the presence of these antibiotics, constitutive mutants can be selected in vitro at frequencies of ∼10−7 cfu. Previous reports have demonstrated the risk of selection of constitutive mutants during the course of clindamycin therapy administered to patients with severe infections due to inducibly erythromycin-resistant S. aureus [39, 40]. In addition, the risk for selection of a constitutive mutant is higher if, at the site of infection, staphylococcal inoculum is higher.
\nAccording to the rules of EUCAST, if a staphylococcal isolate with an inducible MLSB phenotype is detected, it must be reported as resistant and considered adding this comment to the report “Clindamycin may still be used for short-term therapy of less serious skin and soft tissue infections as constitutive resistance is unlikely to develop during such therapy.”
\nThe ermA and ermC are the most common determinants in staphylococci [41]. The ermA genes are mostly spread in methicillin-resistant strains and are borne by transposons related to Tn554, whereas ermC genes are mostly responsible for erythromycin resistance in methicillin-susceptible strains and are borne by plasmids. Recently, the ermT gene was found to be present in livestock staphylococci [21].
\nMSB phenotype is associated with resistance only to 14- (clarithromycin, erythromycin, roxithromycin) and 15-membered ring macrolides (azithromycin) and streptogramin B, while 16-membered ring macrolides (josamycin and spiramycin) and lincosamides remain active [12, 15]. The msrA resistance determinant was originally detected in Staphylococcus epidermidis, and, since then, it has been found in a variety of staphylococcal species, including S. aureus. The MSB resistance phenotype is inducibly expressed by 14- and 15-membered macrolides. Streptogramins B are not inducers and, therefore, the msrA-positive strains are resistant to streptogramins B only after induction. The 16-membered ring macrolides and lincosamides are neither inducers nor substrates for the pump. Thus, msrA-positive strains are fully susceptible to these antimicrobials.
\nAnother gene, msrB from Staphylococcus xylosus, which is nearly identical to the 3′ end of msrA, has been reclassified as msrA [14]. It contains a single ATP-binding domain but also confers an MSB phenotype.
\nIsolates with this phenotype have probably decreased susceptibility to the combination of quinupristin-dalfopristin. Additional tests (see below) are required for its detection.
\nM-phenotype is associated with the presence of enzymes which inactivate enzymatically only macrolides. Clinical isolates of erythromycin-resistant S. aureus and coagulase-negative staphylococci produce phosphotransferases encoded by mphC genes [29, 30]. This phenotype must be differentiated from MLSB-inducible phenotype and from MSB phenotype. Additional tests (see below) are required for its detection.
\nPLSA-phenotype is associated with resistance to lincosamides, pleuromutilins and streptogramins A, while macrolides and streptogramin B remain active [42] . Various genes such as vgaA, vgaC, vgaE, and lsaE have been detected in methicillin-resistant Staphylococcus aureus (MRSA) of clonal complex (CC) 398 of swine, cattle and poultry origin and shown to confer this resistance phenotype [43, 44].
\nL-phenotype is associated with resistance to lincomycin due to the presence of lincosamide nucleotidyl transferases encoded by lnuA and lnuB genes. Both lnu-like genes confer resistance to lincomycin. Generally, expression of lincosamide nucleotidyl transferases causes increase of lincomycin MICs by only 1 or 2 dilutions [45]. However, lnu-like genes do not confer resistance to clindamycin. Indeed, the bactericidal activity of clindamycin, which is already weak against susceptible strains, is totally abolished [45], but the impact of this alteration on the therapeutic efficacy of clindamycin is unknown. Because of dissociated resistance among lincosamides, the detection of L-phenotype is possible only if lincomycin is used, instead of clindamycin.
\nAlthough more than 90 genes conferring resistance to macrolides and lincosamides have been described till date, their presence has not turned out to be a successful story for Gram-positive bacteria. This observation, which is in contrast with the success of emergence of bla genes in Gram-negative bacteria, could be explained by: (1) a low-level resistance conferred by these genes or (2) a failure of detection.
\nSB-phenotype is expressed by resistance to streptogramin B due to the presence of vgbA/B encoding lyases that inactivate the drug. It is very difficult to detect this phenotype since quinupristin is not used alone but combined with dalfopristin. The isolates might express a decreased susceptibility to the combination of quinupristin-dalfopristin .
\nAmong the different types of resistant phenotypes, the most common are MLSB (constitutive or inducible), MSB and M-phenotypes. The clinical microbiology laboratory detects easily and reliably the MLSB constitutive phenotype: the isolates are fully resistant to macrolides and lincosamides. However, isolates with MLSB inducible, MSB and M-phenotypes share the same profile: resistance to macrolides and susceptibility to lincosamides. Therefore, additional test, the double disk diffusion test (D test) is required to be applied.
\nFor the detection of MLSB inducible resistance, it is recommended to place the erythromycin and clindamycin disks 12–20 mm apart (edge to edge, D test). In disk-diffusion tests, a D-shaped zone, caused by induction of methylase production by erythromycin, can be observed (Figure 1). Nowadays, the automated system Vitek II (BoMerieux) has the possibility to detect it.
\nExpression of various resistant-phenotypes: (a) sensitive; (b) MLSB-inducible phenotype; (c) MSB-phenotype; (d) L-phenotype and (e) M-phenotype. ERY: erythromycin; CLIN: clindamycin; LIN: lincomycin.
However, after a negative D test, the differentiation between MSB and M-phenotypes is more complicated and could be based on the MIC values of erythromycin. Isolates with M-phenotype have often lower MIC values to erythromycin, due to the weak activity of hydrolytic enzymes, than isolates with MSB-phenotype, which express fully resistance to macrolides. In addition, MSB-phenotype affects the susceptibility to quinupristin-dalfopristin, decreasing it slowly.
\nFinally, it is difficult to discriminate isolates with PLSA-phenotype from those with L-phenotype; both share the same profile, including resistance to lincomycin and susceptibility to erythromycin. On the other hand, pleuromutilins and streptogramins A are not included in the panel of antibiotics proposed for susceptibility testing. Probably, the values of MICs to clindamycin and quinupristin-dalfopristin, which usually are not affected by L-phenotype, can be used as indicators [46].
\nMolecular detections of the most common genes involved in MLSB resistance are an accurate method for phenotype determination (Table 1).
\nGene | \nPrimers sequence (5′–3′) | \nPCR fragment size (bp) | \n
---|---|---|
ermA | \nF: TCTAAAAAGCATGTAAAAGAA | \n645 | \n
R: CTTCGATAGTTTATTAATATTAG | \n||
ermB | \nF: GAAAAGTACTCAACCAAATA | \n639 | \n
R: AGTAACGGTACTTAAATTGTTTA | \n||
ermC | \nF: TCAAAACATAATATAGATAAA | \n642 | \n
R: GCTAATATTGTTTAAATCGTCAAT | \n||
msrA | \nF: GGCACAATAAGAGTGTTTAAAGG | \n940 | \n
R: AAGTTATATCATGAATAGATTGTCCTGTT | \n||
msrB | \nF: TATGATATCCATAATAATTATCCAATC | \n595 | \n
R: AAGTTATATCATGAATAGATTGTCCTGTT | \n||
lnuA | \nF: GGTGGCTGGGGGGTAGATGTATTAACTGG | \n323 | \n
R: GCTTCTTTTGAAATACATGGTATTTTTCGATC | \n||
lnuB | \nF: CCTACCTATTGTTTGTGGAA | \n925 | \n
R: ATAACGTTACTCTCCTATTC | \n||
lsaA | \nF: GGCAATCGCTTGTGTTTTAGCG | \n1200 | \n
R: GTGAATCCCATGATGTTGATACC | \n
Primer sequences and PCR fragment size of tested MLS resistance genes.
MLS: macrolides, lincosamides and streptogramins; PCR: polymerase chain reaction.
The first report about the activity of erythromycin was confirmed in 1954 by Derek [47]; in 1964, Macleod et al. indicated that lincomycin was effective against S. aureus [48]. Inducible resistance to MLS antibiotics was identified in Gram-positive bacteria by Weaver and Pattee shortly after the introduction of erythromycin into clinical practice [49]. One year later, in 1965, Griffith et al. described antagonism between lincomycin and erythromycin [50]. During their study, the authors observed an antagonistic action between lincomycin and erythromycin, when the two drugs were allowed to diffuse into the same area of an agar plate seeded with a strain of Staphylococcus which was resistant to erythromycin but sensitive to lincomycin. Since the molecular basis of this mechanism was unknown, the authors explained the phenomenon as the result of an altered metabolism stimulated by erythromycin on erythromycin-resistant staphylococci.
\nIn 1971, Lai et al. demonstrated altered methylation of ribosomal RNA in a erythromycin-resistant S. aureus strain, whereas the same study group in 1973, concluded that modification of 23S rRNA, methylation to form dimethyladenine, was responsible for the resistance to lincomycin and spiramycin in S. aureus [51]. Subsequently, causation has been attributed to post-transcriptional methylation of A2058 (Escherichia coli numbering) at the peptidyl transferase center in domain V of 23S rRNA [52]. The family of enzymes responsible for A2058 has been designed as Erm (erythromycin resistance methylase) with the corresponding genes designed as erm. To date, five different methylase genes have been described in staphylococci: ermA, ermB, ermC, ermF, ermY and ermT [21, 53, 54, 55, 56, 57].
\nIn 1990, Ross et al. identified msrA gene, which encodes an ATP-dependent efflux pump [15]. Esterases encoded by ereA and ereB, which inactivate erythromycin by hydrolyzing the lactone ring of the macrocyclic nucleus, were identified by Quinissi and Courvalin in 1985 [27]. On the other hand, the nucleotide sequence of lnuA gene, which confers resistance only to lincosamides, has been determined by Bisson-Noel and Courvalin, in 1986 [31]. Inactivation of macrolides by phosphotransferases (encoded by mphC genes) has also been described by Wondrack et al. in 1996 [29].
\nTo date, a variety of genes (such as vgaA, vgaC, vgaE, lsaE, vgaA, lnuA, lnuB, and mphC), which are involved in the MLS-resistance expression, have been described and are disseminated among staphylococcal species.
\nStaphylococcus aureus and coagulase negative Staphylococci (CONS) are challenging pathogens causing a variety of infections (minor skin and soft tissue infections, endocarditis, pneumonia, septicemia, etc.) [58], while the emergence of drug-resistant staphylococci is an important public threat [59]. The isolation frequency of methicillin-resistant S. aureus (MRSA) has dramatically increased in the recent years [60]. Thus, these factors have led to a renewed interest in the use of macrolides, lincosamides and streptogramins B (MLSB) antibiotics for the treatment of staphylococci-associated infections. From these antibiotics, clindamycin is the preferable agent, because of its excellent pharmacokinetic properties [61]. Additionally, clindamycin is the preferred agent due to its proven efficacy, low cost, the availability of its oral and parenteral forms, tolerability, excellent tissue penetration, its good accumulation in abscesses and because no renal dosing adjustments are required. Clindamycin also inhibits the production of staphylococcal toxin, and can be used as an alternative of penicillin, in patients who are allergic to the latter agent [62]. However, the widespread use of the MLSB antibiotics has increased the number of the Staphylococcus isolates which are resistant to them [63].
\nThe rate of MLSB-resistant staphylococci varies between countries and species. Unfortunately, in the last decade, data concerning the rate of MLS resistance in staphylococci are limited. Otsuka et al. reported that 97% of MRSA and 34.6% of MSSA were resistant to one or more MLSB agents in a study conducted between 2001 and 2006 [64]. Cetin et al. in a large collection of staphylococci in a Turkish hospital have found that 38.5% were resistant to MLSB antibiotics, while Uzun et al. reported that during 2011–2012, 79% isolates were found as erythromycin-resistant in a tertiary hospital in Ismir [65, 66]. In a tertiary Greek hospital, the rate of MLSBS. aureus reached to 44%, whereas in Cyprus 67.61% of S. aureus and 59.4% of the coagulase-negative staphylococci were resistant to erythromycin [67, 68]. On the other hand, high rate of erythromycin-resistant staphylococci was also observed in veterinary [69].
\nRegarding the distribution of resistant phenotypes, the most common are MLSB (constitutive or inducible) followed by MSB. In Japan, Otsuka et al. revealed higher incidence of the MLSB-inducible phenotype than in Europe, Turkey and the USA [41, 64, 70, 71, 72, 73]. Such differences in the incidence of phenotypes might reflect differences in the drug usage, the gene carriage and the clonality of strains.
\nTotally, 92 genes, which confer resistance to MLS antibiotics, have been described to date. They can be roughly divided into three groups, depending on the mechanisms by which they confer resistance to one or all of these groups of antibiotics. Data from different studies agree that the most prevalent genes are ermA and ermC followed by msrA gene [41, 70, 71, 72, 73, 74]. Gatermann et al. have demonstrated that in a large collection of coagulase-negative staphylococci ermC gene predominated and was constitutively expressed, whereas in S. aureus the ermA predominates [65, 75]. In livestock S. aureus strains, such as CC 398, other genes such as ermT, lnuB and lsa are detected [76, 77, 78]. In contrast, mphC gene is frequently found in staphylococci isolated from animals [79, 80].
\nStaphylococci and specially S. aureus are considered as important pathogen in a wide variety of human and animal infections. The sharp emergence and a spread of methicillin-resistant staphylococci in the community setting and the occurrence of vancomycin-resistant staphylococci, along with vancomycin-intermediate S. aureus are of concern. This phenomenon has led to the development of new antimicrobial compounds. Moreover, traditional antibiotics, such as MLSB, should be carefully considered for the treatment of infections caused by multiple drug-resistant staphylococci.
\nToday, information has become the main component of what we produce, do, buy, and consume. Having an economic value in almost all products and services that meet the needs of today’s societies, it has been now obligatory for individuals and organizations to obtain information technologies and to actively use them in both work and social life domains. Hence, in the current information age, where information is seen as power, this situation has made it imperative for organizations to become increasingly information-based and to benefit from information technologies in many processes and activities.
The intensive use of information technologies in many functions and processes has also required some changes in organizations [1]. This is due to the fact that information technologies, unlike traditional technologies, do not only change the technical fields but also affect the communication channels, decision-making functions and mechanisms, control, etc. [2]. Consequently, one of the most striking developments is on organizational structures that are becoming increasingly flattened and horizontal. Relatedly, information technologies have begun to take over the role of middle management, which supports decision-making processes of senior management and has reduced the importance of this level [3, 4, 5]. Similarly, while information technologies enable managers to obtain faster, more accurate, and more information [6, 7, 8], it also provides lower-level managers with more information about the general situation of the organization, the nature of current problems, and important organizational matters [9, 10, 11, 12].
Moreover, information technologies also have an important potential in determining whether organizations have a mechanical or an organic structure [13]. Within the mechanical organizational structures, people do not have much autonomy, and behaviors expected from employees are being careful and obedience to upper authority and respect for traditions. In such organizations, predictability, consistency, and stability are desirable phenomena. In contrast, people in organic structures have more freedom in shaping and controlling their activities, and being enthusiastic, creative, and taking risks have important places among the desired behaviors [14].
Accordingly, information technologies begin to influence the cultural values of the organization over time, through these transformations they create on organizational structures, processes, and operations. In other words, the fact that organizational structures are mechanical or organic causes the formation of diverse cultural values in organizations [15]. Therefore, the desired cultural values in mechanical organizations are quite different from those in organic structures [1, 16, 17]. In this context, this chapter deals with the influences of information technologies on cultural characteristics of organizations along with the reflections of the use of these technologies on organizational structures and their functioning.
When we look at studies on the relations between organizational culture and information technologies, we generally see the studies on the effects of culture on technology adaptation or use [18, 19, 20, 21], as well as on the effects of certain specific information technologies and applications (e.g., e-mail use, group support practices, etc.) on some aspects of any organizational culture [22, 23, 24, 25, 26, 27, 28, 29, 30, 31]. However, the number of studies that consider the use of information technologies as a “whole” and that address “why” and “how” its effects on organizational culture occurred is still limited. And so, this chapter aims to examine and discuss the overall effects of the usage and intensity of information technologies established in organizations on the cultural life within.
In this context, the chapter plan is as follows: Firstly, the basic concepts related to information and information technologies are included. Emphasis is placed on the meaning differences between knowledge and information, and their connections to information technologies are tried to be explained briefly. Secondly, the effects of information technologies on organizational structure are given particular attention. The reason for this is that as a system of values, beliefs, assumptions, and practices [32], organizational culture encompasses many features closely related to structures of organizations. Thirdly, possible links between organizational structure and organizational culture are included. Fourthly, important theoretical approaches and studies on the relationships between information technologies and organizational culture are provided. Finally, by deepening a bit more and by emphasizing key points, some important arguments are discussed.
In the literature, the concepts of information and knowledge are sometimes expressed by a single term, “information.” However, although the concepts of knowledge and information are intertwined, they are two different concepts that have different meanings and describe different phenomena. The reason for this is that knowledge is also included in the concept of information as it is transformed into a commodity when it begins to be processed, stored, and shared by information technologies.
Becoming the basic elements of today’s economic, social, and cultural systems, information is obtained in a certain hierarchy. The images are at the beginning of the process, and the process is completed with a hierarchical staging in the form of data, information, and knowledge, respectively [33]. Image is located in the first step of the process. Humans copy the picture of any object and event they previously perceived by sensory organs. When faced with a similar phenomenon in the later stages of life, these pictures in the mind are redesigned. We call these pictures of realities occurring in the human mind as images [33]. The next stage, the data, contains symbols that represent events and their properties. For this reason, data are expressed as figures and/or facts without content and interpretation [34]. Information that constitutes the next stage of the process and is mixed with knowledge and used interchangeably is expressed as a reporting of one system’s own status to another system [33]. In information, associated data are combined for a specific purpose. Therefore, we can explain information as meaningful data [35]. Knowledge, on the other hand, is defined as personalized information that allows people to fully and accurately grasp what is happening around them and manifests itself in the form of thoughts, insights, intuition, ideas, lessons learned, practices, and experiences [36]. According to Kautz and Thaysen [37] who stated that knowledge is found only in the people’s minds, knowledge is, therefore, a subjective formation. In other words, knowledge is the form of information enriched with interpretation, analysis, and context [38]. However, here, it should be emphasized again by highlighting a very important issue that knowledge is also accepted as information when this knowledge begins to be processed, stored, shared, and used over information technologies. Therefore, after this, when talking about information, one should consider not only the information created by the data brought together in a meaningful way but also the knowledge shared and used over information technologies.
On the other hand, information technologies, used as the most important tool of generating value today, are defined as the technologies that enable processes such as recording and storing data, producing information through certain operational processes, and accessing, storing, and transmitting this produced information effectively and efficiently [39, 40, 41, 42, 43, 44, 45, 46]. The term information technologies is used to cover computer and electronic communication technologies, as they are now inseparably intertwined in literature and everyday use and are generally used in this way [47]. In this context, data processing systems, management information systems (MIS), office automation systems, executive support systems, expert systems, intranet and extranet, electronic mail (e-mail), group applications (groupware), database management systems, decision support systems, artificial intelligence, and telecommunication systems can be given as examples of information technologies [33, 48, 49].
Towards the end of the twentieth century, the rapid changes with the impact of developments in information technologies led to the emergence of customer satisfaction-based, learning, knowledge-based, and constantly changing organizations [50]. The fact that organizations have become considerably information-based and benefit from information technologies intensively in their activities and processes has made also the changes in their organizational structures mandatory [1]. Accordingly, the effects of information technologies on organizational structure will be summarized under the subtitles of differentiation, centralization, and standardization/formalization, which are the three main components of organizational structure [15].
Differentiation within an organization occurs in three ways: Specialization/division of labor, horizontal and vertical differentiation, and hierarchy and size [15]. Specialization refers to the amount of different expertise or types of work [51, 52]. Specialization generally increases the number of subunits and makes it harder to understand the larger structure that people contribute to with their skills and expertise [53]. Information technologies have the potential to reduce this tendency by providing more access to information and experts at this point. In this way, access to information resources provides synergy [54].
Vertical and horizontal differentiation refers to the amount of hierarchical levels in an organization [55]. Information technologies, with the support of problem solving and decision-making, lead to the emergence of more flattened organizational structures as they require fewer levels within the hierarchy [56]. Since information technologies give employees in lower positions more autonomy to harmonize their activities, this can allow them to find and try better methods while performing their work. In this context, we can increasingly see that organizational structures have become horizontal and strengthened and that virtual organizations have begun to emerge as the most cost-effective structure [17].
In terms of hierarchy and size, Heinze and Stuart [4] argue that the mid-level management staff is unnecessary, increases bureaucracy, reduces efficiency, and has no function in organizations any more. Since most of the tasks performed by mid-level executives can be fulfilled by computers, both less costly and faster, information technology has begun to take over the role of mid-level management, which supports the decision-making process of senior management [5]. Sharing the same opinion, Fulk and DeSanctis [57] also stated that the largely witnessed situation in modern organizational designs is the reduction of intermediate-level managers and administrative support.
Centralization points to the extent to which decision-making power within an organization is scattered or centered [58]. Due to increasing local and global competition, many companies have started to leave their strategic decision-making task further down the organization to benefit from the expert people with more precise and timely local knowledge [10]. Information technologies affect these efforts directly in two ways. Firstly, information technologies increase local knowledge by contributing to obtaining closer information about market trends, opportunities, and customers. Secondly, information technologies can create synergies for organizations because, thanks to information technologies, communication and coordination between distributed decision makers, central planners, and senior managers can be realized more effectively and efficiently [59].
However, whether information technologies will lead to centralization or decentralization is a very controversial question. Regarding centralization, it enables managers to acquire faster, more accurate, and more information, reduces uncertainty, and allows them to make decisions that they cannot make before [6, 7, 8]. Conversely, by the use of other forms of information technologies (e.g., electronic bulletin boards), decentralization provides more information to lower- and mid-level managers about the general situation of the organization and the nature of current matters and problems [9, 10, 11, 12]. Raymond et al. [60] argued that because information technologies facilitate the use and transmission of information by all levels and units in the organization, it enables top management, which is the decision authority, to be disabled in certain areas and the decentralization of control. Thach and Woodman [61] maintained that this is due to the fact that as a result of sharing information at lower levels with the help of information technologies, this power of senior management has decreased to a certain extent, and the knowledge and participation of the staff in organizational matters have increased.
The literature shows that information technologies allow both centralization and decentralization. Researchers are in the agreement that information technologies make it possible for organizational managers to leave their decision-making power to a large part of the hierarchical levels without compromising the quality and timeliness of the decision [62, 63]. Keen [64] combined the concepts of centralization and decentralization and used the term “federated organization” in which organizations do not have to choose either because information technologies simultaneously allow centralization-decentralization [64, 65].
Formalization is the process of detailing how activities are coordinated for organizational purposes in order for employees and organizational units to respond routinely to recurring situations [51, 66]. Formalization involves rules, instructions, shared values, and norms [67]. In fact, formalization is based on the objective of more efficiency and less uncertainty [13].
Information technologies provide the ability to reduce the negative effects of formalization by facilitating the documenting and retrieving of information on organizational occurrences and endeavors that make behaviors and processes more consistent through formalization [63]. The more information technologies assist in reducing search times and preventing downtime, the more the administrative cost of formalization decreases and the productivity increases, which ultimately benefits the path to innovation [68].
Different organizational structures lead to the development of different cultural values [15]. The fact that the structure which an organization has established to control its activities and is defined as a formal system consisting of duties and authority relations is mechanical or organic causes the emergence of completely different cultural values, rules, and norms [69]. While mechanical structures are vertical, highly centralized, and almost everything in them are standardized, organic structures are horizontal, decentralized, and based on mutual adaptation [14]. People feel relatively less autonomous in vertical and centralized organizations, and being careful, obeying the upper authority, and respecting traditions are among the desired behaviors. Therefore, in a mechanical organizational structure, there are cultural values where predictability and stability are important [69]. In contrast, in horizontal and decentralized organizations, people can freely choose their own activities and control them. Creativity, courage, and risk-taking are given importance as desired behaviors. Therefore, organic structures contribute to the formation of cultures that value innovation and flexibility [15].
Organizational structure is also important for the development of cultural values that support integration and coordination. In a structure with stable task and role relations, sharing of rules and norms is more since there will be no communication problems and the information flow will be fast [70]. In organizations where the sharing of cultural values, norms, and rules is at a high level, the level of performance also increases [15]. Particularly in team or matrix structures where face-to-face communication is intense, the sharing of these cultural values and common reactions to the problems develop more rapidly [9].
Whether an organization is centralized or not causes different cultural values to emerge. In decentralized structures, authority is divided into subordinate levels, and an environment is created for the formation of cultural values in which creativity and innovation are rewarded [13]. Employees are allowed to use the organization’s resources and work in projects that they want, by spending some of their time in these projects, thus contributing to the production of innovative and creative products and services [15]. The structures of such organizations constitute the cultural values that give their employees the message “as long as it is in the interest of the organization, it is okay to do things in an innovative and the way you want.”
Conversely, in some organizations, it may be more important for employees not to decide on their own and all activities to be followed and controlled by their superiors. In such cases, a centralized structure is preferred to create cultural values that will ensure accountability and obedience [71]. Through norms and rules, all employees are expected to behave honestly and consistently and inform their superiors about wrongs or mistakes, because this is the only acceptable form of behavior within these structures [72].
Since working on the factors that determine the consequences of the adoption and use of information technologies, researchers have focused on people’s beliefs, values, assumptions, and codes of conduct. As a result, they have given names to this research field such as “socio-technical systems,” “social system,” “social structure,” and most recently “culture” [73]. For example, Markus and Robey [23] using “social elements” and Barley [26] using “social system” or “social structure” tried to explain this phenomenon. When examined more closely, it is seen that the details that these authors emphasize while depicting the case are the assumptions, beliefs, and values that exist in common among the group members, and this corresponds to the definition of organizational culture.
Research examining the relationships between information technologies and values, beliefs, and norms belonging to a particular group has gone through certain stages and used rich and complex research models to explain the relationships in each of these stages [74]. In the first studies on information technology applications, it has been suggested that information technologies cause changes in various organizational phenomena including structural features and thus have certain effects on organizations [74]. For instance, in some studies on adoption of groupware software, several researchers have used this deterministic approach to describe how groupware use affects communication and collaboration among employees and their productivity [27, 28]. These studies assume that certain results will certainly emerge after the adoption of information technologies, without considering the motives or activities that shape the use of information technologies by managers and employees. Like much more deterministic studies, these authors often assumed that information technologies would have predetermined influences on the adoption of information technologies, regardless of the environment in which information technologies were applied, how they were applied, and the users’ specific behaviors and particular purposes.
The second group of views concerning the relationships between organizational culture and information technologies includes the fact that information technologies are seen as a tool that can be used for any change that managers desire to make in organizational practices [22]. In studies in this approach, researchers believe that there is a wide range of possibilities to identify changes in organizational culture, structure, processes, and performance [22, 75]. Researchers from this tradition presume that with the right choice of information technologies and appropriate system design, managers can achieve whatever goals they desire.
These works were mostly adopted in the 1980s and reflect a perspective that managers think can manipulate organizational culture in the way they want. Often called “management and control,” “a functional or instrumental approach” to organizational culture, this methodology has caused serious debate in the literature [76]. This approach attributes great powers to the management level in this regard, which conflicts with anthropologists’ views that culture cannot be consciously controlled and goes much deeper to understand it [76]. Robey and Azevido [77] also do not accept the rational thought on the assumption that culture can be manipulated directly in this way.
Studies with this rational perspective in the information technology literature assume that managers can use information technologies as a leverage to make changes in the norms of behavior, strategy, structure, and performance among members within the organization. For example, in studies on group support systems (GSS), we find managers’ beliefs that they can use collaborative technologies to create a more cooperative organizational culture. This perspective was not accepted by Karsten [78] and some experimental research on GSS [30, 79]. Organizational necessity is no longer accepted, as it is viewed by information technology researchers as an overly simple approach [23, 80].
Researchers who take another approach suggest that information technologies and organizational culture can interact with each other to produce various results [22, 23]. These results can be in the form of adoption and effective use of information technologies (if there is a harmony between organizational culture and information technologies) or user reluctance, refusal, or sabotage (if no fit). Researchers who have been working on information systems since the 1980s have focused on understanding information technology features and functionality that cause effective or problematic information technology applications and the interaction between users’ values, assumptions, and other elements of organizational culture. In this regard, Romm et al. [81] argued that many forms of information technologies comprise cultural assumptions embedded within themselves and these assumptions may conflict with existing values of a particular organization. The authors argued that these embedded assumptions present information technologies as a “cultural boundary” and that a cultural analysis should be made to predict compliance or incompatibility. The authors in this approach warn managers to think of organizational culture as a binding limitation in information technology applications. In a warning by Pliskin et al. [76], managers are advised not to try to change the culture of the organization. Regarding this issue, Orlikowski [30] cites Lotus Notes (a group software) application at Alpha Corporation, a consultancy company. In this example, this system, which was established by the CEO of the company only with the benefits to be obtained, did not create the expected effects, became unsuccessful, and disappointed due to reasons such as no cultural analysis and inadequate training. Employees responded to the use of Notes with resistance and refrained from using it. The reason for this was that the employees in this organization, which had a competitive culture where information was seen as a power, avoided sharing information with others. As a result, this incompatibility between the collaborative culture that Notes had in itself and the competitive culture of the organization in question had failed this application of information technologies.
In a different approach, it is stated that information technologies and culture are not fixed and they are more flexible in terms of change [23, 75]. Managers in this approach may set specific goals for the use of information technologies, but actual results of the use of information technologies are not deterministic, and results cannot be predicted or controlled even under the best conditions [23]. The effects of information technologies are not deterministic because technology has interpretable flexibility considering that it can have different meanings for different employees. Similar technology can be interpreted in a different way by distinct people, based on certain assumptions, beliefs, and values. Robey and coauthors [24, 25], for instance, showed that it would be an empty attempt for organizational managers to try to intentionally manipulate the effects of these technologies, since there are many ways that diverse employees can configure a particular technology in different social environments.
Gopal and Prasad [31] also achieved similar results in their work on group support system (GSS), claiming that for researchers seeking fixed laws or regulations on how information technologies affect user behaviors, this would be an impossible goal to pursue. Conversely, the results of using information technologies depend on the symbolic meanings that information technologies have for a particular user. This work of Gopal and Prasad [31] expresses similar results with the work of Barley [26] and Robey and Sahay [25]. The authors stated that the symbolic meanings of certain technologies for users affect their perceptions of information technologies and their specific behaviors.
In the light of the above-mentioned approaches, arguments, and important studies in the literature, it will be useful to discuss some important points by deepening a little more and by emphasizing the key features related to the concepts of information, information technologies, and organizational culture.
First, organizational culture is a complex phenomenon that develops and changes in a historical process [32, 82, 83]. Thus, although it might seem like a plain and simple concept, organizational culture includes many subdimensions and processes. When considered as a complex pattern of these interactions of many factors with each other, it is also a difficult process to identify the direct and indirect effects of information technologies on organizational culture within this cluster of relationships and interactions. Moreover, culture is not a phenomenon that changes and develops in a short time and is therefore open to manipulations of managers. On the contrary, from this point of view, it is not possible to easily achieve control over cultural changes, and it is necessary to go much deeper [76]. So, it is not rational to expect that the rapid developments and changes in information technologies will cause changes in cultural characteristics at the same speed. In this sense, it could be inaccurate to seek direct relationships between two phenomena in question, whose rates of change are quite different.
Second, for cultural changes, there must also be changes in the basic assumptions, beliefs, and values on which the culture is built [84]. It would be misleading to expect little or intensive use of information technologies to cause changes in these rooted assumptions. For the desired changes in these basic assumptions, beliefs, and values, it is necessary to design the structure accordingly, to recruit employees who are qualified for the targeted culture, and to set ethical values and property rights to employees in accordance with this culture [15]. In this sense, information technologies may only catalyze the contribution of organizational structure to organizational culture.
Third, there are many and different types of hardware and software that fall under the scope of information technologies. It is not logical to accept all of them as homogeneous technologies in all aspects (with the same functions and features, similar usage areas, standard conditions they are applied, similar intentions, and behaviors of all users), and it can be, therefore, misleading to carry out research under a single “IT” concept from this perspective. The reason for this is that, as stated in the sections above, cultural features of each information technology application or product embedded in it might be different. The interactions between the cultural characteristics of the environment in which information technologies are applied and the unique cultural contents of information technologies may cause different results on the culture of the organization.
Fourth, contrary to what is believed, some of cultural features that we anticipate to support information technology applications and products may be interpreted otherwise by diverse people contingent on different assumptions, beliefs, and values. In fact, Robey et al. [24, 25] showed that managers cannot control the effects of these technologies, since different users can configure a particular technology in numerous ways in different social environments. Also, Gopal and Prasad [31] argued that this would be an impossible achievement for researchers looking for fixed laws or regulations on how information technologies affect user behaviors.
Fifth, information technologies were defined above as technologies that enable processing, storage, and sharing of information. The key concept in this definition is “knowledge-based” information and not the technology itself. Therefore, what makes information technologies essential and important is the information itself. According to the definition of knowledge, the most significant characteristic that differentiates it from information is its being a product of the human mind [37]. Because knowledge is the interpretation of information and expresses the value produced from it, qualifying information technologies as good-bad, useful-useless, and necessary-unnecessary can be a meaningless evaluation. So, the basic thing that creates value-added for organizations is not the technology used but the information itself, which is processed, stored, and shared on this technology. In this context, even if it is the latest, most advanced, and most expensive technology in the world, if the organization does not have a qualified human resource capable of producing knowledge that will create value-added, an appropriate organizational structure and culture that will activate this creative potential, and a management approach, all investments in these technologies will also be wasted.
This chapter has aimed to examine the impacts of information technologies on organizations’ cultures, and for this purpose, a special emphasis is given to the concept of “organizational structure” within the theoretical framework presented above. The most important reason for this is that relevant literature shows that organizational culture and organizational structure are in a very close relationship. Indeed, when the question items in the Denison organizational culture scale [85], which is the most frequently used in the literature, are examined, it is possible to see that most of these items point to many features of organizational structure concerning centralization, formalization, and differentiation dimensions. Therefore, it is a very rational approach to expect that information technologies can have direct and indirect effects on organizational cultures based on the influences of information technologies on structures of organizations. However, it should be underlined that different and controversial approaches and findings in the literature mentioned above on the relations between information technologies and organizational culture generate question marks in the minds as well.
In this regard, it is already quite difficult to draw a clear picture of the impacts of information technologies on cultural characteristics of organizations. The number of studies on the subject in the literature is still very limited. Accordingly, it is necessary to underline the great need for interdisciplinary studies in this field. But still, this study argues that the main factor that determines the actual impact and value of information technologies, which have become an integral part of human life in today’s world, is the information itself rather than technology, and it should be kept in mind that information technologies can only function as a means or tool in this knowledge-based social, economic, and cultural life. In other words, the determinant of the benefits, meaning, and importance of information technologies might be the conditions created by organizational factors such as cultural environment and organizational structure where knowledge is created, developed, and used and human resources have become the most important capital element and source of wealth.
The author declares no conflict of interest.
You have been successfully unsubscribed.
",metaTitle:"Unsubscribe Successful",metaDescription:"You have been successfully unsubscribed.",metaKeywords:null,canonicalURL:"/page/unsubscribe-successful",contentRaw:'[{"type":"htmlEditorComponent","content":""}]'},components:[{type:"htmlEditorComponent",content:""}]},successStories:{items:[]},authorsAndEditors:{filterParams:{sort:"featured,name"},profiles:[{id:"6700",title:"Dr.",name:"Abbass A.",middleName:null,surname:"Hashim",slug:"abbass-a.-hashim",fullName:"Abbass A. Hashim",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/6700/images/1864_n.jpg",biography:"Currently I am carrying out research in several areas of interest, mainly covering work on chemical and bio-sensors, semiconductor thin film device fabrication and characterisation.\nAt the moment I have very strong interest in radiation environmental pollution and bacteriology treatment. The teams of researchers are working very hard to bring novel results in this field. I am also a member of the team in charge for the supervision of Ph.D. students in the fields of development of silicon based planar waveguide sensor devices, study of inelastic electron tunnelling in planar tunnelling nanostructures for sensing applications and development of organotellurium(IV) compounds for semiconductor applications. I am a specialist in data analysis techniques and nanosurface structure. I have served as the editor for many books, been a member of the editorial board in science journals, have published many papers and hold many patents.",institutionString:null,institution:{name:"Sheffield Hallam University",country:{name:"United Kingdom"}}},{id:"54525",title:"Prof.",name:"Abdul Latif",middleName:null,surname:"Ahmad",slug:"abdul-latif-ahmad",fullName:"Abdul Latif Ahmad",position:null,profilePictureURL:"//cdnintech.com/web/frontend/www/assets/author.svg",biography:null,institutionString:null,institution:null},{id:"20567",title:"Prof.",name:"Ado",middleName:null,surname:"Jorio",slug:"ado-jorio",fullName:"Ado Jorio",position:null,profilePictureURL:"//cdnintech.com/web/frontend/www/assets/author.svg",biography:null,institutionString:null,institution:{name:"Universidade Federal de Minas Gerais",country:{name:"Brazil"}}},{id:"47940",title:"Dr.",name:"Alberto",middleName:null,surname:"Mantovani",slug:"alberto-mantovani",fullName:"Alberto Mantovani",position:null,profilePictureURL:"//cdnintech.com/web/frontend/www/assets/author.svg",biography:null,institutionString:null,institution:null},{id:"12392",title:"Mr.",name:"Alex",middleName:null,surname:"Lazinica",slug:"alex-lazinica",fullName:"Alex Lazinica",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/12392/images/7282_n.png",biography:"Alex Lazinica is the founder and CEO of IntechOpen. After obtaining a Master's degree in Mechanical Engineering, he continued his PhD studies in Robotics at the Vienna University of Technology. Here he worked as a robotic researcher with the university's Intelligent Manufacturing Systems Group as well as a guest researcher at various European universities, including the Swiss Federal Institute of Technology Lausanne (EPFL). During this time he published more than 20 scientific papers, gave presentations, served as a reviewer for major robotic journals and conferences and most importantly he co-founded and built the International Journal of Advanced Robotic Systems- world's first Open Access journal in the field of robotics. Starting this journal was a pivotal point in his career, since it was a pathway to founding IntechOpen - Open Access publisher focused on addressing academic researchers needs. Alex is a personification of IntechOpen key values being trusted, open and entrepreneurial. Today his focus is on defining the growth and development strategy for the company.",institutionString:null,institution:{name:"TU Wien",country:{name:"Austria"}}},{id:"19816",title:"Prof.",name:"Alexander",middleName:null,surname:"Kokorin",slug:"alexander-kokorin",fullName:"Alexander Kokorin",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/19816/images/1607_n.jpg",biography:"Alexander I. Kokorin: born: 1947, Moscow; DSc., PhD; Principal Research Fellow (Research Professor) of Department of Kinetics and Catalysis, N. Semenov Institute of Chemical Physics, Russian Academy of Sciences, Moscow.\r\nArea of research interests: physical chemistry of complex-organized molecular and nanosized systems, including polymer-metal complexes; the surface of doped oxide semiconductors. He is an expert in structural, absorptive, catalytic and photocatalytic properties, in structural organization and dynamic features of ionic liquids, in magnetic interactions between paramagnetic centers. The author or co-author of 3 books, over 200 articles and reviews in scientific journals and books. He is an actual member of the International EPR/ESR Society, European Society on Quantum Solar Energy Conversion, Moscow House of Scientists, of the Board of Moscow Physical Society.",institutionString:null,institution:{name:"Semenov Institute of Chemical Physics",country:{name:"Russia"}}},{id:"62389",title:"PhD.",name:"Ali Demir",middleName:null,surname:"Sezer",slug:"ali-demir-sezer",fullName:"Ali Demir Sezer",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/62389/images/3413_n.jpg",biography:"Dr. Ali Demir Sezer has a Ph.D. from Pharmaceutical Biotechnology at the Faculty of Pharmacy, University of Marmara (Turkey). He is the member of many Pharmaceutical Associations and acts as a reviewer of scientific journals and European projects under different research areas such as: drug delivery systems, nanotechnology and pharmaceutical biotechnology. Dr. Sezer is the author of many scientific publications in peer-reviewed journals and poster communications. Focus of his research activity is drug delivery, physico-chemical characterization and biological evaluation of biopolymers micro and nanoparticles as modified drug delivery system, and colloidal drug carriers (liposomes, nanoparticles etc.).",institutionString:null,institution:{name:"Marmara University",country:{name:"Turkey"}}},{id:"61051",title:"Prof.",name:"Andrea",middleName:null,surname:"Natale",slug:"andrea-natale",fullName:"Andrea Natale",position:null,profilePictureURL:"//cdnintech.com/web/frontend/www/assets/author.svg",biography:null,institutionString:null,institution:null},{id:"100762",title:"Prof.",name:"Andrea",middleName:null,surname:"Natale",slug:"andrea-natale",fullName:"Andrea Natale",position:null,profilePictureURL:"//cdnintech.com/web/frontend/www/assets/author.svg",biography:null,institutionString:null,institution:{name:"St David's Medical Center",country:{name:"United States of America"}}},{id:"107416",title:"Dr.",name:"Andrea",middleName:null,surname:"Natale",slug:"andrea-natale",fullName:"Andrea Natale",position:null,profilePictureURL:"//cdnintech.com/web/frontend/www/assets/author.svg",biography:null,institutionString:null,institution:{name:"Texas Cardiac Arrhythmia",country:{name:"United States of America"}}},{id:"64434",title:"Dr.",name:"Angkoon",middleName:null,surname:"Phinyomark",slug:"angkoon-phinyomark",fullName:"Angkoon Phinyomark",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/64434/images/2619_n.jpg",biography:"My name is Angkoon Phinyomark. I received a B.Eng. degree in Computer Engineering with First Class Honors in 2008 from Prince of Songkla University, Songkhla, Thailand, where I received a Ph.D. degree in Electrical Engineering. My research interests are primarily in the area of biomedical signal processing and classification notably EMG (electromyography signal), EOG (electrooculography signal), and EEG (electroencephalography signal), image analysis notably breast cancer analysis and optical coherence tomography, and rehabilitation engineering. I became a student member of IEEE in 2008. During October 2011-March 2012, I had worked at School of Computer Science and Electronic Engineering, University of Essex, Colchester, Essex, United Kingdom. In addition, during a B.Eng. I had been a visiting research student at Faculty of Computer Science, University of Murcia, Murcia, Spain for three months.\n\nI have published over 40 papers during 5 years in refereed journals, books, and conference proceedings in the areas of electro-physiological signals processing and classification, notably EMG and EOG signals, fractal analysis, wavelet analysis, texture analysis, feature extraction and machine learning algorithms, and assistive and rehabilitative devices. I have several computer programming language certificates, i.e. Sun Certified Programmer for the Java 2 Platform 1.4 (SCJP), Microsoft Certified Professional Developer, Web Developer (MCPD), Microsoft Certified Technology Specialist, .NET Framework 2.0 Web (MCTS). I am a Reviewer for several refereed journals and international conferences, such as IEEE Transactions on Biomedical Engineering, IEEE Transactions on Industrial Electronics, Optic Letters, Measurement Science Review, and also a member of the International Advisory Committee for 2012 IEEE Business Engineering and Industrial Applications and 2012 IEEE Symposium on Business, Engineering and Industrial Applications.",institutionString:null,institution:{name:"Joseph Fourier University",country:{name:"France"}}},{id:"55578",title:"Dr.",name:"Antonio",middleName:null,surname:"Jurado-Navas",slug:"antonio-jurado-navas",fullName:"Antonio Jurado-Navas",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/55578/images/4574_n.png",biography:"Antonio Jurado-Navas received the M.S. degree (2002) and the Ph.D. degree (2009) in Telecommunication Engineering, both from the University of Málaga (Spain). He first worked as a consultant at Vodafone-Spain. From 2004 to 2011, he was a Research Assistant with the Communications Engineering Department at the University of Málaga. In 2011, he became an Assistant Professor in the same department. From 2012 to 2015, he was with Ericsson Spain, where he was working on geo-location\ntools for third generation mobile networks. Since 2015, he is a Marie-Curie fellow at the Denmark Technical University. His current research interests include the areas of mobile communication systems and channel modeling in addition to atmospheric optical communications, adaptive optics and statistics",institutionString:null,institution:{name:"University of Malaga",country:{name:"Spain"}}}],filtersByRegion:[{group:"region",caption:"North America",value:1,count:5681},{group:"region",caption:"Middle and South America",value:2,count:5161},{group:"region",caption:"Africa",value:3,count:1683},{group:"region",caption:"Asia",value:4,count:10200},{group:"region",caption:"Australia and Oceania",value:5,count:886},{group:"region",caption:"Europe",value:6,count:15610}],offset:12,limit:12,total:117096},chapterEmbeded:{data:{}},editorApplication:{success:null,errors:{}},ofsBooks:{filterParams:{sort:"dateendthirdsteppublish"},books:[],filtersByTopic:[{group:"topic",caption:"Agricultural and Biological Sciences",value:5,count:9},{group:"topic",caption:"Biochemistry, Genetics and Molecular Biology",value:6,count:18},{group:"topic",caption:"Business, Management and Economics",value:7,count:2},{group:"topic",caption:"Chemistry",value:8,count:7},{group:"topic",caption:"Computer and Information Science",value:9,count:10},{group:"topic",caption:"Earth and Planetary Sciences",value:10,count:5},{group:"topic",caption:"Engineering",value:11,count:14},{group:"topic",caption:"Environmental Sciences",value:12,count:2},{group:"topic",caption:"Immunology and Microbiology",value:13,count:5},{group:"topic",caption:"Materials Science",value:14,count:4},{group:"topic",caption:"Mathematics",value:15,count:1},{group:"topic",caption:"Medicine",value:16,count:63},{group:"topic",caption:"Nanotechnology and Nanomaterials",value:17,count:1},{group:"topic",caption:"Neuroscience",value:18,count:1},{group:"topic",caption:"Pharmacology, Toxicology and Pharmaceutical Science",value:19,count:6},{group:"topic",caption:"Physics",value:20,count:2},{group:"topic",caption:"Psychology",value:21,count:3},{group:"topic",caption:"Robotics",value:22,count:1},{group:"topic",caption:"Social Sciences",value:23,count:3},{group:"topic",caption:"Technology",value:24,count:1},{group:"topic",caption:"Veterinary Medicine and Science",value:25,count:2}],offset:0,limit:12,total:null},popularBooks:{featuredBooks:[{type:"book",id:"9208",title:"Welding",subtitle:"Modern Topics",isOpenForSubmission:!1,hash:"7d6be076ccf3a3f8bd2ca52d86d4506b",slug:"welding-modern-topics",bookSignature:"Sadek Crisóstomo Absi Alfaro, Wojciech Borek and Błażej Tomiczek",coverURL:"https://cdn.intechopen.com/books/images_new/9208.jpg",editors:[{id:"65292",title:"Prof.",name:"Sadek Crisostomo Absi",middleName:"C. Absi",surname:"Alfaro",slug:"sadek-crisostomo-absi-alfaro",fullName:"Sadek Crisostomo Absi Alfaro"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"9139",title:"Topics in Primary Care Medicine",subtitle:null,isOpenForSubmission:!1,hash:"ea774a4d4c1179da92a782e0ae9cde92",slug:"topics-in-primary-care-medicine",bookSignature:"Thomas F. Heston",coverURL:"https://cdn.intechopen.com/books/images_new/9139.jpg",editors:[{id:"217926",title:"Dr.",name:"Thomas F.",middleName:null,surname:"Heston",slug:"thomas-f.-heston",fullName:"Thomas F. Heston"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"8697",title:"Virtual Reality and Its Application in Education",subtitle:null,isOpenForSubmission:!1,hash:"ee01b5e387ba0062c6b0d1e9227bda05",slug:"virtual-reality-and-its-application-in-education",bookSignature:"Dragan Cvetković",coverURL:"https://cdn.intechopen.com/books/images_new/8697.jpg",editors:[{id:"101330",title:"Dr.",name:"Dragan",middleName:"Mladen",surname:"Cvetković",slug:"dragan-cvetkovic",fullName:"Dragan Cvetković"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"9785",title:"Endometriosis",subtitle:null,isOpenForSubmission:!1,hash:"f457ca61f29cf7e8bc191732c50bb0ce",slug:"endometriosis",bookSignature:"Courtney Marsh",coverURL:"https://cdn.intechopen.com/books/images_new/9785.jpg",editors:[{id:"255491",title:"Dr.",name:"Courtney",middleName:null,surname:"Marsh",slug:"courtney-marsh",fullName:"Courtney Marsh"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"9343",title:"Trace Metals in the Environment",subtitle:"New Approaches and Recent Advances",isOpenForSubmission:!1,hash:"ae07e345bc2ce1ebbda9f70c5cd12141",slug:"trace-metals-in-the-environment-new-approaches-and-recent-advances",bookSignature:"Mario Alfonso Murillo-Tovar, Hugo Saldarriaga-Noreña and Agnieszka Saeid",coverURL:"https://cdn.intechopen.com/books/images_new/9343.jpg",editors:[{id:"255959",title:"Dr.",name:"Mario Alfonso",middleName:null,surname:"Murillo-Tovar",slug:"mario-alfonso-murillo-tovar",fullName:"Mario Alfonso Murillo-Tovar"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"7831",title:"Sustainability in Urban Planning and Design",subtitle:null,isOpenForSubmission:!1,hash:"c924420492c8c2c9751e178d025f4066",slug:"sustainability-in-urban-planning-and-design",bookSignature:"Amjad Almusaed, Asaad Almssad and Linh Truong - Hong",coverURL:"https://cdn.intechopen.com/books/images_new/7831.jpg",editors:[{id:"110471",title:"Dr.",name:"Amjad",middleName:"Zaki",surname:"Almusaed",slug:"amjad-almusaed",fullName:"Amjad Almusaed"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"8468",title:"Sheep Farming",subtitle:"An Approach to Feed, Growth and Sanity",isOpenForSubmission:!1,hash:"838f08594850bc04aa14ec873ed1b96f",slug:"sheep-farming-an-approach-to-feed-growth-and-sanity",bookSignature:"António Monteiro",coverURL:"https://cdn.intechopen.com/books/images_new/8468.jpg",editors:[{id:"190314",title:"Prof.",name:"António",middleName:"Cardoso",surname:"Monteiro",slug:"antonio-monteiro",fullName:"António Monteiro"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"8816",title:"Financial Crises",subtitle:"A Selection of Readings",isOpenForSubmission:!1,hash:"6f2f49fb903656e4e54280c79fabd10c",slug:"financial-crises-a-selection-of-readings",bookSignature:"Stelios Markoulis",coverURL:"https://cdn.intechopen.com/books/images_new/8816.jpg",editors:[{id:"237863",title:"Dr.",name:"Stelios",middleName:null,surname:"Markoulis",slug:"stelios-markoulis",fullName:"Stelios Markoulis"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"9376",title:"Contemporary Developments and Perspectives in International Health Security",subtitle:"Volume 1",isOpenForSubmission:!1,hash:"b9a00b84cd04aae458fb1d6c65795601",slug:"contemporary-developments-and-perspectives-in-international-health-security-volume-1",bookSignature:"Stanislaw P. Stawicki, Michael S. Firstenberg, Sagar C. Galwankar, Ricardo Izurieta and Thomas Papadimos",coverURL:"https://cdn.intechopen.com/books/images_new/9376.jpg",editors:[{id:"181694",title:"Dr.",name:"Stanislaw P.",middleName:null,surname:"Stawicki",slug:"stanislaw-p.-stawicki",fullName:"Stanislaw P. Stawicki"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"7769",title:"Medical Isotopes",subtitle:null,isOpenForSubmission:!1,hash:"f8d3c5a6c9a42398e56b4e82264753f7",slug:"medical-isotopes",bookSignature:"Syed Ali Raza Naqvi and Muhammad Babar Imrani",coverURL:"https://cdn.intechopen.com/books/images_new/7769.jpg",editors:[{id:"259190",title:"Dr.",name:"Syed Ali Raza",middleName:null,surname:"Naqvi",slug:"syed-ali-raza-naqvi",fullName:"Syed Ali Raza Naqvi"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"9279",title:"Concepts, Applications and Emerging Opportunities in Industrial Engineering",subtitle:null,isOpenForSubmission:!1,hash:"9bfa87f9b627a5468b7c1e30b0eea07a",slug:"concepts-applications-and-emerging-opportunities-in-industrial-engineering",bookSignature:"Gary Moynihan",coverURL:"https://cdn.intechopen.com/books/images_new/9279.jpg",editors:[{id:"16974",title:"Dr.",name:"Gary",middleName:null,surname:"Moynihan",slug:"gary-moynihan",fullName:"Gary Moynihan"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"7807",title:"A Closer Look at Organizational Culture in Action",subtitle:null,isOpenForSubmission:!1,hash:"05c608b9271cc2bc711f4b28748b247b",slug:"a-closer-look-at-organizational-culture-in-action",bookSignature:"Süleyman Davut Göker",coverURL:"https://cdn.intechopen.com/books/images_new/7807.jpg",editors:[{id:"190035",title:"Associate Prof.",name:"Süleyman Davut",middleName:null,surname:"Göker",slug:"suleyman-davut-goker",fullName:"Süleyman Davut Göker"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}}],offset:12,limit:12,total:5126},hotBookTopics:{hotBooks:[],offset:0,limit:12,total:null},publish:{},publishingProposal:{success:null,errors:{}},books:{featuredBooks:[{type:"book",id:"9208",title:"Welding",subtitle:"Modern Topics",isOpenForSubmission:!1,hash:"7d6be076ccf3a3f8bd2ca52d86d4506b",slug:"welding-modern-topics",bookSignature:"Sadek Crisóstomo Absi Alfaro, Wojciech Borek and Błażej Tomiczek",coverURL:"https://cdn.intechopen.com/books/images_new/9208.jpg",editors:[{id:"65292",title:"Prof.",name:"Sadek Crisostomo Absi",middleName:"C. Absi",surname:"Alfaro",slug:"sadek-crisostomo-absi-alfaro",fullName:"Sadek Crisostomo Absi Alfaro"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"9139",title:"Topics in Primary Care Medicine",subtitle:null,isOpenForSubmission:!1,hash:"ea774a4d4c1179da92a782e0ae9cde92",slug:"topics-in-primary-care-medicine",bookSignature:"Thomas F. Heston",coverURL:"https://cdn.intechopen.com/books/images_new/9139.jpg",editors:[{id:"217926",title:"Dr.",name:"Thomas F.",middleName:null,surname:"Heston",slug:"thomas-f.-heston",fullName:"Thomas F. Heston"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"8697",title:"Virtual Reality and Its Application in Education",subtitle:null,isOpenForSubmission:!1,hash:"ee01b5e387ba0062c6b0d1e9227bda05",slug:"virtual-reality-and-its-application-in-education",bookSignature:"Dragan Cvetković",coverURL:"https://cdn.intechopen.com/books/images_new/8697.jpg",editors:[{id:"101330",title:"Dr.",name:"Dragan",middleName:"Mladen",surname:"Cvetković",slug:"dragan-cvetkovic",fullName:"Dragan Cvetković"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"9785",title:"Endometriosis",subtitle:null,isOpenForSubmission:!1,hash:"f457ca61f29cf7e8bc191732c50bb0ce",slug:"endometriosis",bookSignature:"Courtney Marsh",coverURL:"https://cdn.intechopen.com/books/images_new/9785.jpg",editors:[{id:"255491",title:"Dr.",name:"Courtney",middleName:null,surname:"Marsh",slug:"courtney-marsh",fullName:"Courtney Marsh"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"9343",title:"Trace Metals in the Environment",subtitle:"New Approaches and Recent Advances",isOpenForSubmission:!1,hash:"ae07e345bc2ce1ebbda9f70c5cd12141",slug:"trace-metals-in-the-environment-new-approaches-and-recent-advances",bookSignature:"Mario Alfonso Murillo-Tovar, Hugo Saldarriaga-Noreña and Agnieszka Saeid",coverURL:"https://cdn.intechopen.com/books/images_new/9343.jpg",editors:[{id:"255959",title:"Dr.",name:"Mario Alfonso",middleName:null,surname:"Murillo-Tovar",slug:"mario-alfonso-murillo-tovar",fullName:"Mario Alfonso Murillo-Tovar"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"8468",title:"Sheep Farming",subtitle:"An Approach to Feed, Growth and Sanity",isOpenForSubmission:!1,hash:"838f08594850bc04aa14ec873ed1b96f",slug:"sheep-farming-an-approach-to-feed-growth-and-sanity",bookSignature:"António Monteiro",coverURL:"https://cdn.intechopen.com/books/images_new/8468.jpg",editors:[{id:"190314",title:"Prof.",name:"António",middleName:"Cardoso",surname:"Monteiro",slug:"antonio-monteiro",fullName:"António Monteiro"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"8816",title:"Financial Crises",subtitle:"A Selection of Readings",isOpenForSubmission:!1,hash:"6f2f49fb903656e4e54280c79fabd10c",slug:"financial-crises-a-selection-of-readings",bookSignature:"Stelios Markoulis",coverURL:"https://cdn.intechopen.com/books/images_new/8816.jpg",editors:[{id:"237863",title:"Dr.",name:"Stelios",middleName:null,surname:"Markoulis",slug:"stelios-markoulis",fullName:"Stelios Markoulis"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"7831",title:"Sustainability in Urban Planning and Design",subtitle:null,isOpenForSubmission:!1,hash:"c924420492c8c2c9751e178d025f4066",slug:"sustainability-in-urban-planning-and-design",bookSignature:"Amjad Almusaed, Asaad Almssad and Linh Truong - Hong",coverURL:"https://cdn.intechopen.com/books/images_new/7831.jpg",editors:[{id:"110471",title:"Dr.",name:"Amjad",middleName:"Zaki",surname:"Almusaed",slug:"amjad-almusaed",fullName:"Amjad Almusaed"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"9376",title:"Contemporary Developments and Perspectives in International Health Security",subtitle:"Volume 1",isOpenForSubmission:!1,hash:"b9a00b84cd04aae458fb1d6c65795601",slug:"contemporary-developments-and-perspectives-in-international-health-security-volume-1",bookSignature:"Stanislaw P. Stawicki, Michael S. Firstenberg, Sagar C. Galwankar, Ricardo Izurieta and Thomas Papadimos",coverURL:"https://cdn.intechopen.com/books/images_new/9376.jpg",editors:[{id:"181694",title:"Dr.",name:"Stanislaw P.",middleName:null,surname:"Stawicki",slug:"stanislaw-p.-stawicki",fullName:"Stanislaw P. Stawicki"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"7769",title:"Medical Isotopes",subtitle:null,isOpenForSubmission:!1,hash:"f8d3c5a6c9a42398e56b4e82264753f7",slug:"medical-isotopes",bookSignature:"Syed Ali Raza Naqvi and Muhammad Babar Imrani",coverURL:"https://cdn.intechopen.com/books/images_new/7769.jpg",editors:[{id:"259190",title:"Dr.",name:"Syed Ali Raza",middleName:null,surname:"Naqvi",slug:"syed-ali-raza-naqvi",fullName:"Syed Ali Raza Naqvi"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}}],latestBooks:[{type:"book",id:"8468",title:"Sheep Farming",subtitle:"An Approach to Feed, Growth and Health",isOpenForSubmission:!1,hash:"838f08594850bc04aa14ec873ed1b96f",slug:"sheep-farming-an-approach-to-feed-growth-and-health",bookSignature:"António Monteiro",coverURL:"https://cdn.intechopen.com/books/images_new/8468.jpg",editedByType:"Edited by",editors:[{id:"190314",title:"Prof.",name:"António",middleName:"Cardoso",surname:"Monteiro",slug:"antonio-monteiro",fullName:"António Monteiro"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"9523",title:"Oral and Maxillofacial Surgery",subtitle:null,isOpenForSubmission:!1,hash:"5eb6ec2db961a6c8965d11180a58d5c1",slug:"oral-and-maxillofacial-surgery",bookSignature:"Gokul Sridharan",coverURL:"https://cdn.intechopen.com/books/images_new/9523.jpg",editedByType:"Edited by",editors:[{id:"82453",title:"Dr.",name:"Gokul",middleName:null,surname:"Sridharan",slug:"gokul-sridharan",fullName:"Gokul Sridharan"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"9785",title:"Endometriosis",subtitle:null,isOpenForSubmission:!1,hash:"f457ca61f29cf7e8bc191732c50bb0ce",slug:"endometriosis",bookSignature:"Courtney Marsh",coverURL:"https://cdn.intechopen.com/books/images_new/9785.jpg",editedByType:"Edited by",editors:[{id:"255491",title:"Dr.",name:"Courtney",middleName:null,surname:"Marsh",slug:"courtney-marsh",fullName:"Courtney Marsh"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"9018",title:"Some RNA Viruses",subtitle:null,isOpenForSubmission:!1,hash:"a5cae846dbe3692495fc4add2f60fd84",slug:"some-rna-viruses",bookSignature:"Yogendra Shah and Eltayb Abuelzein",coverURL:"https://cdn.intechopen.com/books/images_new/9018.jpg",editedByType:"Edited by",editors:[{id:"278914",title:"Ph.D.",name:"Yogendra",middleName:null,surname:"Shah",slug:"yogendra-shah",fullName:"Yogendra Shah"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"8816",title:"Financial Crises",subtitle:"A Selection of Readings",isOpenForSubmission:!1,hash:"6f2f49fb903656e4e54280c79fabd10c",slug:"financial-crises-a-selection-of-readings",bookSignature:"Stelios Markoulis",coverURL:"https://cdn.intechopen.com/books/images_new/8816.jpg",editedByType:"Edited by",editors:[{id:"237863",title:"Dr.",name:"Stelios",middleName:null,surname:"Markoulis",slug:"stelios-markoulis",fullName:"Stelios Markoulis"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"9585",title:"Advances in Complex Valvular Disease",subtitle:null,isOpenForSubmission:!1,hash:"ef64f11e211621ecfe69c46e60e7ca3d",slug:"advances-in-complex-valvular-disease",bookSignature:"Michael S. Firstenberg and Imran Khan",coverURL:"https://cdn.intechopen.com/books/images_new/9585.jpg",editedByType:"Edited by",editors:[{id:"64343",title:null,name:"Michael S.",middleName:"S",surname:"Firstenberg",slug:"michael-s.-firstenberg",fullName:"Michael S. Firstenberg"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"10150",title:"Smart Manufacturing",subtitle:"When Artificial Intelligence Meets the Internet of Things",isOpenForSubmission:!1,hash:"87004a19de13702d042f8ff96d454698",slug:"smart-manufacturing-when-artificial-intelligence-meets-the-internet-of-things",bookSignature:"Tan Yen Kheng",coverURL:"https://cdn.intechopen.com/books/images_new/10150.jpg",editedByType:"Edited by",editors:[{id:"78857",title:"Dr.",name:"Tan Yen",middleName:null,surname:"Kheng",slug:"tan-yen-kheng",fullName:"Tan Yen Kheng"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"9386",title:"Direct Numerical Simulations",subtitle:"An Introduction and Applications",isOpenForSubmission:!1,hash:"158a3a0fdba295d21ff23326f5a072d5",slug:"direct-numerical-simulations-an-introduction-and-applications",bookSignature:"Srinivasa Rao",coverURL:"https://cdn.intechopen.com/books/images_new/9386.jpg",editedByType:"Edited by",editors:[{id:"6897",title:"Dr.",name:"Srinivasa",middleName:"P",surname:"Rao",slug:"srinivasa-rao",fullName:"Srinivasa Rao"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"9139",title:"Topics in Primary Care Medicine",subtitle:null,isOpenForSubmission:!1,hash:"ea774a4d4c1179da92a782e0ae9cde92",slug:"topics-in-primary-care-medicine",bookSignature:"Thomas F. Heston",coverURL:"https://cdn.intechopen.com/books/images_new/9139.jpg",editedByType:"Edited by",editors:[{id:"217926",title:"Dr.",name:"Thomas F.",middleName:null,surname:"Heston",slug:"thomas-f.-heston",fullName:"Thomas F. Heston"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"9208",title:"Welding",subtitle:"Modern Topics",isOpenForSubmission:!1,hash:"7d6be076ccf3a3f8bd2ca52d86d4506b",slug:"welding-modern-topics",bookSignature:"Sadek Crisóstomo Absi Alfaro, Wojciech Borek and Błażej Tomiczek",coverURL:"https://cdn.intechopen.com/books/images_new/9208.jpg",editedByType:"Edited by",editors:[{id:"65292",title:"Prof.",name:"Sadek Crisostomo Absi",middleName:"C. Absi",surname:"Alfaro",slug:"sadek-crisostomo-absi-alfaro",fullName:"Sadek Crisostomo Absi Alfaro"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}}]},subject:{topic:{id:"527",title:"System Automation",slug:"system-automation",parent:{title:"Artificial Intelligence",slug:"computer-and-information-science-artificial-intelligence"},numberOfBooks:1,numberOfAuthorsAndEditors:31,numberOfWosCitations:6,numberOfCrossrefCitations:9,numberOfDimensionsCitations:14,videoUrl:null,fallbackUrl:null,description:null},booksByTopicFilter:{topicSlug:"system-automation",sort:"-publishedDate",limit:12,offset:0},booksByTopicCollection:[{type:"book",id:"2046",title:"Machine Vision",subtitle:"Applications and Systems",isOpenForSubmission:!1,hash:"a5e8fcd36ede802fd6462fb9fa996838",slug:"machine-vision-applications-and-systems",bookSignature:"Fabio Solari, Manuela Chessa and Silvio P. Sabatini",coverURL:"https://cdn.intechopen.com/books/images_new/2046.jpg",editedByType:"Edited by",editors:[{id:"13366",title:"Dr.",name:"Fabio",middleName:null,surname:"Solari",slug:"fabio-solari",fullName:"Fabio Solari"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}}],booksByTopicTotal:1,mostCitedChapters:[{id:"33564",doi:"10.5772/34023",title:"Towards the Optimal Hardware Architecture for Computer Vision",slug:"towards-the-optimal-hardware-architecture-for-computer-vision",totalDownloads:2053,totalCrossrefCites:4,totalDimensionsCites:5,book:{slug:"machine-vision-applications-and-systems",title:"Machine Vision",fullTitle:"Machine Vision - Applications and Systems"},signatures:"Alejandro Nieto, David López Vilarino and Víctor Brea Sánchez",authors:[{id:"2541",title:"Mr.",name:"Alejandro",middleName:null,surname:"Nieto",slug:"alejandro-nieto",fullName:"Alejandro Nieto"},{id:"103915",title:"Dr.",name:"David",middleName:null,surname:"López Vilariño",slug:"david-lopez-vilarino",fullName:"David López Vilariño"},{id:"103916",title:"Dr.",name:"Víctor M.",middleName:null,surname:"Brea Sánchez",slug:"victor-m.-brea-sanchez",fullName:"Víctor M. Brea Sánchez"}]},{id:"33559",doi:"10.5772/35150",title:"Methods for Ellipse Detection from Edge Maps of Real Images",slug:"methods-for-ellipse-detection-from-edge-maps-of-real-images",totalDownloads:2491,totalCrossrefCites:1,totalDimensionsCites:3,book:{slug:"machine-vision-applications-and-systems",title:"Machine Vision",fullTitle:"Machine Vision - Applications and Systems"},signatures:"Dilip K. Prasad and Maylor K.H. Leung",authors:[{id:"103174",title:"Dr.",name:"Dilip",middleName:"Kumar",surname:"Prasad",slug:"dilip-prasad",fullName:"Dilip Prasad"}]},{id:"33556",doi:"10.5772/34160",title:"Real-Time Processing of 3D-TOF Data in Machine Vision Applications",slug:"real-time-processing-of-3d-tof-data-in-machine-vision-applications",totalDownloads:2672,totalCrossrefCites:0,totalDimensionsCites:2,book:{slug:"machine-vision-applications-and-systems",title:"Machine Vision",fullTitle:"Machine Vision - Applications and Systems"},signatures:"Stephan Hussmann, Torsten Edeler and Alexander Hermanski",authors:[{id:"6250",title:"Prof. Dr.-Ing.",name:"Stephan",middleName:null,surname:"Hussmann",slug:"stephan-hussmann",fullName:"Stephan Hussmann"}]}],mostDownloadedChaptersLast30Days:[{id:"33553",title:"Bio-Inspired Active Vision Paradigms in Surveillance Applications",slug:"bio-inspired-active-vision-paradigms-in-surveillance-applications",totalDownloads:1868,totalCrossrefCites:0,totalDimensionsCites:1,book:{slug:"machine-vision-applications-and-systems",title:"Machine Vision",fullTitle:"Machine Vision - Applications and Systems"},signatures:"Mauricio Vanegas, Manuela Chessa, Fabio Solari and Silvio Sabatini",authors:[{id:"13366",title:"Dr.",name:"Fabio",middleName:null,surname:"Solari",slug:"fabio-solari",fullName:"Fabio Solari"}]},{id:"33556",title:"Real-Time Processing of 3D-TOF Data in Machine Vision Applications",slug:"real-time-processing-of-3d-tof-data-in-machine-vision-applications",totalDownloads:2672,totalCrossrefCites:0,totalDimensionsCites:2,book:{slug:"machine-vision-applications-and-systems",title:"Machine Vision",fullTitle:"Machine Vision - Applications and Systems"},signatures:"Stephan Hussmann, Torsten Edeler and Alexander Hermanski",authors:[{id:"6250",title:"Prof. Dr.-Ing.",name:"Stephan",middleName:null,surname:"Hussmann",slug:"stephan-hussmann",fullName:"Stephan Hussmann"}]},{id:"33562",title:"Discontinuity Detection from Inflection of Otsu’s Threshold in Derivative of Scale-Space",slug:"discontinuity-detection-from-inflection-of-otsu-s-threshold-in-the-derivative-of-scale-space",totalDownloads:1714,totalCrossrefCites:0,totalDimensionsCites:0,book:{slug:"machine-vision-applications-and-systems",title:"Machine Vision",fullTitle:"Machine Vision - Applications and Systems"},signatures:"Rahul Walia, David Suter and Raymond A. Jarvis",authors:[{id:"70415",title:"Mr.",name:"Rahul",middleName:null,surname:"Walia",slug:"rahul-walia",fullName:"Rahul Walia"},{id:"119864",title:"Prof.",name:"Raymond A",middleName:null,surname:"Jarvis",slug:"raymond-a-jarvis",fullName:"Raymond A Jarvis"},{id:"119865",title:"Prof.",name:"David",middleName:null,surname:"Suter",slug:"david-suter",fullName:"David Suter"}]},{id:"33558",title:"Characterization of the Surface Finish of Machined Parts Using Artificial Vision and Hough Transform",slug:"characterization-of-surface-finish-of-machined-parts-using-artificial-vision-and-hough-transform",totalDownloads:2501,totalCrossrefCites:0,totalDimensionsCites:0,book:{slug:"machine-vision-applications-and-systems",title:"Machine Vision",fullTitle:"Machine Vision - Applications and Systems"},signatures:"Alberto Rosales Silva, Angel Xeque-Morales, L.A. Morales -Hernandez and Francisco Gallegos Funes",authors:[{id:"2941",title:"Dr.",name:"Alberto",middleName:"Jorge",surname:"Rosales-Silva",slug:"alberto-rosales-silva",fullName:"Alberto Rosales-Silva"},{id:"11317",title:"Dr.",name:"Francisco J.",middleName:null,surname:"Gallegos-Funes",slug:"francisco-j.-gallegos-funes",fullName:"Francisco J. Gallegos-Funes"},{id:"103334",title:"MSc.",name:"Angel",middleName:null,surname:"Xeque",slug:"angel-xeque",fullName:"Angel Xeque"},{id:"103340",title:"Dr.",name:"Luis",middleName:null,surname:"Morales",slug:"luis-morales",fullName:"Luis Morales"}]},{id:"33559",title:"Methods for Ellipse Detection from Edge Maps of Real Images",slug:"methods-for-ellipse-detection-from-edge-maps-of-real-images",totalDownloads:2491,totalCrossrefCites:1,totalDimensionsCites:3,book:{slug:"machine-vision-applications-and-systems",title:"Machine Vision",fullTitle:"Machine Vision - Applications and Systems"},signatures:"Dilip K. Prasad and Maylor K.H. Leung",authors:[{id:"103174",title:"Dr.",name:"Dilip",middleName:"Kumar",surname:"Prasad",slug:"dilip-prasad",fullName:"Dilip Prasad"}]},{id:"33563",title:"Reflectance Modeling in Machine Vision: Applications in Image Analysis and Synthesis",slug:"reflectance-modeling-in-machine-vision-applications-in-image-analysis-and-synthesis",totalDownloads:2107,totalCrossrefCites:2,totalDimensionsCites:1,book:{slug:"machine-vision-applications-and-systems",title:"Machine Vision",fullTitle:"Machine Vision - Applications and Systems"},signatures:"Robin Gruna and Stephan Irgenfried",authors:[{id:"67059",title:"Mr.",name:"Robin",middleName:null,surname:"Gruna",slug:"robin-gruna",fullName:"Robin Gruna"},{id:"74290",title:"MSc.",name:"Stephan",middleName:null,surname:"Irgenfried",slug:"stephan-irgenfried",fullName:"Stephan Irgenfried"}]},{id:"33557",title:"Rotation Angle Estimation Algorithms for Textures and Their Implementations on Real Time Systems",slug:"rotation-angle-estimation-algorithms-for-textures-and-their-real-time-implementation-",totalDownloads:1958,totalCrossrefCites:0,totalDimensionsCites:1,book:{slug:"machine-vision-applications-and-systems",title:"Machine Vision",fullTitle:"Machine Vision - Applications and Systems"},signatures:"Cihan Ulas, Onur Toker and Kemal Fidanboylu",authors:[{id:"67465",title:"Mr.",name:"Cihan",middleName:null,surname:"Ulas",slug:"cihan-ulas",fullName:"Cihan Ulas"},{id:"127960",title:"Dr.",name:"Onur",middleName:null,surname:"Toker",slug:"onur-toker",fullName:"Onur Toker"},{id:"127961",title:"Prof.",name:"Kemal",middleName:null,surname:"Fidanboylu",slug:"kemal-fidanboylu",fullName:"Kemal Fidanboylu"}]},{id:"33555",title:"Fast Computation of Dense and Reliable Depth Maps from Stereo Images",slug:"fast-computation-of-dense-and-reliable-depth-maps-from-stereo-images",totalDownloads:2653,totalCrossrefCites:1,totalDimensionsCites:0,book:{slug:"machine-vision-applications-and-systems",title:"Machine Vision",fullTitle:"Machine Vision - Applications and Systems"},signatures:"M. Tornow, M. Grasshoff, N. Nguyen, A. Al-Hamadi and B. Michaelis",authors:[{id:"102462",title:"Dr.",name:"Michael",middleName:null,surname:"Tornow",slug:"michael-tornow",fullName:"Michael Tornow"},{id:"103726",title:"MSc.",name:"Thien-Nghia",middleName:null,surname:"Nguyen",slug:"thien-nghia-nguyen",fullName:"Thien-Nghia Nguyen"},{id:"103727",title:"Prof.",name:"Bernd",middleName:null,surname:"Michaelis",slug:"bernd-michaelis",fullName:"Bernd Michaelis"},{id:"137516",title:"MSc.",name:"Michael",middleName:null,surname:"Grasshoff",slug:"michael-grasshoff",fullName:"Michael Grasshoff"}]},{id:"33560",title:"Detection and Pose Estimation of Piled Objects Using Ensemble of Tree Classifiers",slug:"detection-and-pose-estimation-of-piled-objects-using-ensemble-of-tree-classifiers",totalDownloads:2112,totalCrossrefCites:0,totalDimensionsCites:0,book:{slug:"machine-vision-applications-and-systems",title:"Machine Vision",fullTitle:"Machine Vision - Applications and Systems"},signatures:"Masakazu Matsugu, Katsuhiko Mori, Yusuke Mitarai and Hiroto Yoshii",authors:[{id:"96123",title:"Dr.",name:"Masakazu",middleName:null,surname:"Matsugu",slug:"masakazu-matsugu",fullName:"Masakazu Matsugu"},{id:"100026",title:"Mr.",name:"Katsuhiko",middleName:null,surname:"Mori",slug:"katsuhiko-mori",fullName:"Katsuhiko Mori"},{id:"100027",title:"Mr.",name:"Yusuke",middleName:null,surname:"Mitarai",slug:"yusuke-mitarai",fullName:"Yusuke Mitarai"},{id:"100034",title:"Mr.",name:"Hiroto",middleName:null,surname:"Yoshii",slug:"hiroto-yoshii",fullName:"Hiroto Yoshii"}]},{id:"33554",title:"Stereo Matching Method and Height Estimation for Unmanned Helicopter",slug:"stereo-matching-method-and-height-estimation-for-unmanned-helicopter",totalDownloads:1663,totalCrossrefCites:1,totalDimensionsCites:1,book:{slug:"machine-vision-applications-and-systems",title:"Machine Vision",fullTitle:"Machine Vision - Applications and Systems"},signatures:"Kuo-Hsien Hsia, Shao-Fan Lien and Juhng-Perng Su",authors:[{id:"78819",title:"Dr.",name:"Kuo-Hsien",middleName:null,surname:"Hsia",slug:"kuo-hsien-hsia",fullName:"Kuo-Hsien Hsia"},{id:"85733",title:"Prof.",name:"Juhng-Perng",middleName:null,surname:"Su",slug:"juhng-perng-su",fullName:"Juhng-Perng Su"},{id:"85735",title:"MSc.",name:"Shao-Fan",middleName:null,surname:"Lien",slug:"shao-fan-lien",fullName:"Shao-Fan Lien"}]}],onlineFirstChaptersFilter:{topicSlug:"system-automation",limit:3,offset:0},onlineFirstChaptersCollection:[],onlineFirstChaptersTotal:0},preDownload:{success:null,errors:{}},aboutIntechopen:{},privacyPolicy:{},peerReviewing:{},howOpenAccessPublishingWithIntechopenWorks:{},sponsorshipBooks:{sponsorshipBooks:[{type:"book",id:"10176",title:"Microgrids and Local Energy Systems",subtitle:null,isOpenForSubmission:!0,hash:"c32b4a5351a88f263074b0d0ca813a9c",slug:null,bookSignature:"Prof. Nick Jenkins",coverURL:"https://cdn.intechopen.com/books/images_new/10176.jpg",editedByType:null,editors:[{id:"55219",title:"Prof.",name:"Nick",middleName:null,surname:"Jenkins",slug:"nick-jenkins",fullName:"Nick Jenkins"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}}],offset:8,limit:8,total:1},route:{name:"profile.detail",path:"/profiles/60398/valesca-pandolfi",hash:"",query:{},params:{id:"60398",slug:"valesca-pandolfi"},fullPath:"/profiles/60398/valesca-pandolfi",meta:{},from:{name:null,path:"/",hash:"",query:{},params:{},fullPath:"/",meta:{}}}},function(){var e;(e=document.currentScript||document.scripts[document.scripts.length-1]).parentNode.removeChild(e)}()