Open access peer-reviewed chapter - ONLINE FIRST

Genetic Resources of The Universal Flavor, Vanilla

By Minoo Divakaran and N.T. Fathima Rafieah

Submitted: March 28th 2021Reviewed: June 24th 2021Published: August 26th 2021

DOI: 10.5772/intechopen.99043

Downloaded: 25

Abstract

Commercially cultivated vanilla (V. planifolia) is native to Mexico and its cultivation and breeding programmes face major bottlenecks. This study reports presence of important agronomic characters in two important and endangered species of Vanilla, V. aphylla and V. pilifera, indigenous to India. V. aphylla was tolerant to Fusarium wilt and had longer flower life than the cultivated vanilla. V. pilifera flowers were fragrant, showed signs of insect pollination and had large fruit size. The species were amenable to interspecific hybridization and successful reciprocal crosses were done. Sequence similarity studies indicated the clustering of leafy and leafless species separately.

Keywords

  • interspecific hybridization
  • V. apylla
  • V. pilifera
  • sequence similarity

1. Introduction

The genus Vanilla includes about 110 species and the species have been treated in various monographic works [1, 2] including the life history of V. planifolia[3]. Vanilla planifolia(Salisb.) Ames (syn. V. fragransAndrews.), is a tropical climbing orchid known for yielding the delicate popular flavor, vanilla [4] and is the second most expensive spice traded in the world market [5] (Spices Board 2000). The major vanilla producing countries are Madagascar, Comoro, Indonesia, Mexico and the Reunion, of which, Madagascar holds the prominent position.

Vanilla was introduced to Europe from Mexico, in about 1500 and its reputation of being an aphrodisiac followed it to countries where it was introduced. The importance of vanilla since early times in Mexico, is evident by the mention of offering vanilla as a medicinal beverage as part of a tribute during reign of Itzcóatl (Aztec Emperor) in 1427 and citing vanilla as a remedy for fatigue in Badianus manuscript in 1552 [6]. Vanilla planifolia, which yields the vanilla of commerce, is native to Mexico and parts of Central America and the history of origin of cultivated vanilla suggests that the entire stock outside Mexico may be from a single genetic source. For the last 400 years, humans have been playing important role in the dispersal and spread of vanilla in the New World.

Advertisement

2. Species of Vanilla

Studies of divergence among species of agronomic importance have been receiving greater attention. Genomics-based tools are efficient to characterize and identify genetic diversity in Vanilla and act as a significant tool for genomics-assisted plant breeding [7]. RAPD polymorphism was used to estimate the level of genetic diversity and interrelationships among few related species Vanilla planifolia, including both leafy and leafless types such as V. tahitensis, V. andamanica, V. piliferaand V. aphylla. Studies revealed that there is very limited variation within collections of V. planifolia, indicative of its narrow genetic base [8]. The British introduced Vanilla planifoliainto India about 200 years ago whereas five other species are native viz., V. piliferaHolt., V. andamanicaRolfe., V. aphyllaBlume., V. walkeriaeWight. and V. wightianaLindl.

V. piliferaoriginally described from Malaya, recorded in Thailand is found in the Mikir hills of Northeast India. V. aphylla, an endangered species, previously known from Thailand is found in South India [9]. V. andamanicais endemic to Andaman group of Islands and is believed to be same as V. albida[10]. V. tahitensis, which is commonly exploited throughout the tropics, is indigenous to the Tahiti Islands. The presence and absence of leaves, and floral characters (colors of flower, lip, hairs on lip and ovary-pedicel etc.,), morphologically distinguish these species (Table 1).

SpeciesLeaf typeInternodeMedian ridge
ShapeSize
V. aphyllaScale leaves to leafless2.1 cm in fresh shoots6.5 cmAbsent in fresh shoots
V. piliferaNarrow (intermediate to V. planifoliaand V. aphylla)L (8.5–16.5 cm)
B (1.6–3.1 cm)
7 cmPresent all along the stem

Table 1.

Vegetative characters of Vanilla aphyllaand V. pilifera.

A preliminary analysis of the various characters of Vanilla species including the above species, showed presence and absence of leaves formed an important part in the classification of the genus which in general had the basic chromosome number x = 16. Most of the Indian species were leafless, except V. piliferawhich was intermediate in character, i.e., leafless in early stages and long narrow leaves at maturity and the chromosome number in V. aphyllais 2n = 64, whereas the cultivated vanilla and V. tahitensishad a somatic chromosome number of 2n = 32 [10, 11]. Differences in floral characters existed in flower color and lip characters (Table 2). In V. piliferavines, leaves developed as the vine grew with flowers that were narrower (2.8 x 0.8 cm) with distinct pure white ovary-pedicel (Figures 1 and 2), pale green tepals, purplish violet and longer (6 mm approx.) hairs on white lip. V. aphyllais leafless (with scales-1.8 cm) and yellowish-cream flowers (petal size 3 x 1.2 cm approx.) having tuft of hairs that are cream near tip, deep reddish inside (2–3 mm) and light green ovary-pedicel (Figures 3 and 4).

SpeciesPetal colorOvary-pedicelTuft of hair on the lipNatureFruit size after pollination – 4 weeks
V. aphyllaYellowish cream, L-3 cm, B-1.2 cmLight greenCream near tip, reddish brown inside (2–3 mm)Longer life14 cm (L)
3 cm (B)
V. piliferaPale green, narrower, L-2.8 cm, B-0.8 cmWhiteViolet and longer (6 mm)More brittle11.5 cm (L)
3.3 cm (B)

Table 2.

Variations in floral characters.

L, Length; B, Breadth.

Figure 1.

Members ofV. aphyllainflorescence arranged sequentially (Inset: Close-up of an opened flower).

Figure 2.

Members of V. pilifera inflorescence arranged sequentially (Inset: Close-up of an opened flower).

Figure 3.

L.S. of flowers ofV. aphylla(L) andV. pilifera(R).

Figure 4.

Comparison of dissected out flowers ofV. aphylla(L) andV. pilifera(R).

3. Biotechnological applications

Micropropagation and in vitroconservation techniques for the different species of Vanilla [12] and interspecific hybridization as a tool for gene flow of desirable characters from wild species into cultivated species, through pollen, have been reported [13]. Genetic interrelationships studies, using RAPD profiles [8], among different species revealed that the leafless forms of vanilla, V. aphyllaand V. piliferaformed a separate sub-cluster. All the other leafy vanilla types formed a separate sub-cluster. V. pilifera, which showed an intermediate leaf character, showed only 50–56.1% similarity to V. planifoliabut closely resembled V. aphylla(76.8%). Thus, the present study reveals the presence of important agronomic characters for introgression into cultivated vanilla and which can be utilized to overcome major bottlenecks in vanilla breeding. The presence of fragrance which attracts insects, coupled with signs of fruit set without hand pollination, holds V. piliferaas a potential candidate for breeding programmes, to overcome the problem of lack of natural seed set in vanilla. V. aphyllawhich was tolerant to Fusarium oxysporum[8] and its crossability to cultivated vanilla can be utilized as a bridging species and to help wipe out diseases arising out of monoculture. Interspecific hybridization has been reported and hence transfer of these desirable traits into cultivated vanilla, V. planifolia, may not be hindered. The advent of biotechnological tools, offers techniques for transfer of these characters into V. planifolia, thus making the dream of transforming vanilla into a fragrant, natural seed setting, disease tolerant commercially important orchid can be turned into a reality.

The identification of a hydratase/lyase type enzyme as being a vanillin synthase offers new opportunities for the Vanilla pod-based industries. The accumulation of vanillin glucoside in the capsules of cultivated vines in response to environmental challenges may now be assessed at the molecular level. Likewise, the basis for development of genetic markers for the selection of vanilla orchid varieties with improved aromatic properties has now been laid down. Vanillin produced biologically is termed ‘natural’ vanillin and has a high economic value compared with chemically synthesized vanillin. Likewise, in the transition towards a bio-based economy, it is important to develop sustainable production systems to replace those currently based on fossil fuels. The demonstration that a single enzyme in the vanilla pod catalyzes the conversion of ferulic acid and ferulic acid glucoside into vanillin and vanillin glucoside provides several options for biotechnological applications [14].

4. Materials and methods

4.1 Genomic DNA isolation

Genomic DNA was isolated from approximately 100 mg fresh leaves by grinding in a pestle and mortar using liquid Nitrogen and following the procedure using DNeasy® Plant Mini Kit (Qiagen, USA). The ground sample powder (100 mg) was transferred to microfuge tubes. Followed by addition of 400 μl AP1 buffer and 4 μl RNase A and mixed by vortex. The tubes were incubated at 65°C for 10 min in a water bath with intermittent mixing 2–3 times by inverting the tubes. Added 130 μl buffer P3 to the tube, mixed and incubated for 5 min on ice. The lysate was centrifuged for 5 min at 14,000 rpm. The samples were then loaded onto the QIAshredder spin columns and centrifuged at 14,000 rmp for 2 min. The flow-through was transferred to a new tube without disturbing the pellet. Added 1.5 volume of buffer AW1 and mixed by pipetting. The contents were then loaded in 650 μl fractions onto the DNeasy mini spin column and centrifuged at 8000 rmp for 1 minute. The flow-through was discarded. The spin column was placed into a new 2 ml collection tube and added 500 μl buffer AW2, followed by centrifugation for 1 min at 8000 rpm. This last step with buffer AW2 step was repeated, with centrifugation at 14,000 rpm for 2 min. The spin columns were placed in fresh microfuge tubes and 100 μl AE buffer was added onto the membranes and incubated at room temperature for 5 min. The tubes were then centrifuged at 8000 rpm for 1 min. This step was repeated with another 100 μl of AE buffer. The eluted samples were stored at −20°C.

4.2 Measurement of purity and DNA concentration

Quality and quantity of genomic DNA was monitored by using UV/Vis. Spectrophotometry and quality was confirmed by using 0.8% Agarose Gel Electrophoresis. Each of the sample DNA was diluted to 5 ng/μL in double distilled water for use as a PCR template.

4.3 PCR amplification of DNA barcoding region and sequencing

PCR reactions were carried out using universal primers for the DNA barcode regions matK, nrDNA-ITS, rbcL and trnH-psbA. All the specific locus primers were purchased with universal M13 primer sequence at their 5′ ends, thus enabling the direct sequencing of the PCR products using the universal M13 primers. The PCR amplification was performed in a 20 μl reaction mixture, consisting of 1X PCR buffer (2 mM Mgcl2), 200 μM each of dATP, dCTP, dGTP, dTTP; 0.5 μM of each forward and reverse primers and 1 U of Taq polymerase (TakaRa-Taq), and (5–20 ng) DNA template. DNA amplification was performed in a thermal cycler (Eppendoff, Germany). When the reaction has finished, the tubes were stored at 4°C. PCR products were separated by agarose gel electrophoresis (1.8%). The list of primers, their nucleotide sequences, annealing temperature and the specific PCR cycling conditions are shown in Table 3. A large volume PCR reaction (100 μl) per sample loci was done and PCR purification was done using Nucleospin Gel and PCR Clean-up kit (Macherey-Nagel, Germany). The purified PCR products were sequenced using M13 universal primers (M13 forward and M13 reverse primers) on ABI 3730xl DNA sequencer at AgriGenome labs facility, Kochi, India. Each DNA barcode region was sequenced.

Table 3.

List of primers used for amplification of different loci and their PCR conditions.

The different universal primers used in this study for the amplification are shown in Table 4 along with the amplified product size.

S. NoPlant NameMatkITSrbcL PrimerstrnH-psbA
(product size)(product size)(product size)(product size)(product size)(product size)(product size)(product size)
1V1390F/1326R (1000 bp)ITS4/ITS5 (800 bp)rbcL_1F/rbcL_724R (NA*)rbcLa_f/rbcLa_r (700 bp)rbcLa_f/rbcLa_SI_Rev (600 bp)rbcLa_f/rbcLaj634R (650 bp)psbA3_f/trnHf_05 (750 bp)
2VG390F/1326R (1000 bp)ITS4/ITS5 (800 bp)ITS-P5/ITS-u4 (800 bp)rbcL_1F/rbcL_724R (NA*)rbcLa_f/rbcLa_r (NA*)rbcLa_f/rbcLa_SI_Rev (600 bp)rbcLa_f/rbcLaj634R (650 bp)psbA3_f/trnHf_05 (800 bp)
3VP390F/1326R (1000 bp)ITS4/ITS5 (800 bp)ITS-P5/ITS-u4 (800 bp)rbcL_1F/rbcL_724R (NA*)rbcLa_f/rbcLa_r (NA*)rbcLa_f/rbcLa_SI_Rev (600 bp)rbcLa_f/rbcLaj634R (650 bp)psbA3_f/trnHf_05 (800 bp)

Table 4.

List of primers pairs used for amplification of different barcode loci and its estimated product sizes in agarose gel, for the Vanillaspecies under study.

NA, No amplification.


The Bold text indicates successful sequencing was done for these samples.

The ITS region was very problematic while sequencing and only V1 was completed, while sequencing is pending for VG and VP samples.

Loci rbcL and trnH-psbA has been successfully amplified but has not yet been sent for sequencing.

The final edited sequences are provided in FASTA format below for each of the successful sequencing reactions:

>Vanilla S matk.

TCTCACATTTAAATTATGTGTCAGATCTACTAATACCCTATCCCATACATCTGGAAATCTTAGTTCAAATTCTTCAATGCTGGGTCAAAGATGTTCTTTCTTTGCATTTATTGCGATTGTTTTTTCACGAATATCATAATTTGAATAGTCTCGTTACTTCAAAGAAATCTATTTATGTCTTTTCAAAAATAAATAAAAGATTTTTTTTATTCCTACATAATTTTTATGTATATGAATCCGAATATCTATTCCTGTTTCTTCGTAAACAGTCTTCTTATTTACGATCAACATCTTCTGGAGTGTTTCTTGAACAAACACATTTCTATGTAAAAATAGAACATATTCATCTTATAGTAGTAGTGTGTTGTAATTCTTTCAAAAGGGACCTATGGTTTCTCGAAGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGCTATTCTGGGTTCAAAAGGAACTCTTATTCTGGTGAATAAATGGAAATATTATCTTATTAATTTTTGGCAATCTTATTTTCACTTTTGGTCTCAACCAGATAGGATCTATAGAAAGCAATTCTCCGACTATTCCTTTTCTTTCCTGGGGTATTTTTCAAGTGTATTAAAAAATACTTTGGTAGTCAGAAATCAAATGCTAGAGAATTGCTTTCTCATAAATACTCCGACTCAGAAATTAGATACCATAGCCCCGGTTATTTCTCTTATTGGATCCTTGTCGAAGGCAAAATTTTGTACGTTAATGGGTCATCCCATTAGTAAACCGATCTGGACCGATTTATCGGATTCTGAGATTATTGATCGATTTTGTCGAATATGTAGAAATCTTTGTCGTTATCACAGTGGATCCTCAAAAAAACAGGTTT.

>VG matk.

TTCTCACATTTAAATTATGTGTCAGATCTACTAATACCCTATCCCATACATCTGGAAATCTTAGTTCAAATTCTTCAATGCTGGGTCAAAGATGTTCTTTCTTTGCATTTATTGCGATTGTTTTTTCACGAATATCAGAATTTGAATAGTCTCGTTACTTCAAAGAAATCTATTTATGTCTTTTCAAAAAAAAATAAAAGATTCTTTTTATTCCTACATAATTTTTATGTATATGAATTCGAATATCTATTCATGTTTCTTCGTAAACAGTCTTCTTATTTACGATCAACATCTTCTGGAGTGTTTCTTGAACAAACACATTTTTATGGAAAAATAGAACATATTCATCTTATAGTAGTAGTGTGTTTTAATTCTTTAAAAAGCGACCTATGGTTTCTCGAAGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGCTATTCTGGGTTCAAAAGGAACTCTTATTCTGTTGAATAAATGGAAATATTATATTATTTATTTTTTGCAATCTTATTTTCACTTTTGGTCTCAACCAGATAGGATCTATAGAAAGCAATTCTCTGACTATTCCTTTTCTTTCCTGGGGTATTTTTCAAGTGTATTAAAAAATACTTTGGTAGTCAGAAATCAAATGCTAGGGAATTGCTTTCTCATAAATATTCCGATTCAGAAATTAGATACCACAGCCCCGGTGATTTCTCTTATTGGATCCTTGTCGAAGGCAAAATTTTGTACGTTAATGGGTCATCCCATTAGTAAACCGATCTGGACTGATTTATCGGATTCTGAGATTATTGATCGATTTTGTCGAATATGTAGAAATCTTTGTCGTTATCACAGTGGA.

>VP matk.

TTCTCACATTTAAATTATGTGTCAGATCTACTAATACCCTATCCCATACATCTGGAAATCTTAGTTCAAATTCTTCAATGCTGGGTCAAAGATGTTCTTTCTTTGCATTTATTGCGATTGTTTTTTCACGAATATCAGAATTTGAATAGTCTCGTTACTTCAAAGAAATCTATTTATGTCTTTTCAAAAAAAAATAAAAGATTCTTTTTATTCCTACATAATTTTTATGTATATGAATTCGAATATCTATTCATGTTTCTTCGTAAACAGTCTTCTTATTTACGATCAACATCTTCTGGAGTGTTTCTTGAACAAACACATTTTTATGGAAAAATAGAACATATTCATCTTATAGTAGTAGTGTGTTTTAATTCTTTAAAAAGCGACCTATGGTTTCTCGAAGATCCTTTCATGCATTATGTTCGATATCAAGGAAAAGCTATTCTGGGTTCAAAAGGAACTCTTATTCTGTTGAATAAATGGAAATATTATATTATTTATTTTTTGCAATCTTATTTTCACTTTTGGTCTCAACCAGATAGGATCTATAGAAAGCAATTCTCTGACTATTCCTTTTCTTTCCTGGGGTATTTTTCAAGTGTATTAAAAAATACTTTGGTAGTCAGAAATCAAATGCTAGGGAATTGCTTTCTCATAAATATTCCGATTCAGAAATTAGATACCACAGCCCCGGTGATTTCTCTTATTGGATCCTTGTCGAAGGCAAAATTTTGTACGTTAATGGGTCATCCCATTAGTAAACCGATCTGGACTGATTTATCGGATTCTGAGATTATTGATCGATTTTGTCGAATATGTAGAAATCTTTGTCGTTATCACAGTGGA.

>VS ITS.

AGTGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGACGAGAGCTATGACTGATCGAGTGATCTGTGCAACCTGTGGGGGTGCGACGGCTGTTTGATGTCGCATTCTTCCATCGCAGAGCTCCTGCTTCCAGGGGGAGCTCGATGCTGTGGGGGGATAAACAACAGCCTATGGGCGTGGTCATACGCCAAGGGAGAGCAAATGTTAAGCCGCCAACGGGTGTGTTGTGCGTCGCCAGGCCCAGTGGGGTATGGCAAACGAACACTGAACGACTCTCGACAACGGATATCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTGTTGTGAATTGTAGAATCCCGTGAACCATCCATTTTTTGAACGCAAGTTGCGCCCGAGGATGCAAGCCGAGGGCACTCCTGCATGGGTGTAATGCGTTCTGTCGCTCCTCGCGCAGGCATGGAATCGTTGGTTTAGATCAGCGGCCCCTCGCCAGGATGCGATCGATGGCACCCTGTGCTACGGCATGGCGTGTTCAAGCGTTGGGCGATGGTCGGCTGTAGACACGGCAAGAGGTGGATGCCACCGAGTGTTGTGGTGTTGGCCAGTAGGAACCGATGTTGCAGTGCGACAAGGTGATGCCCCTTGCAAATCCAACTCCATGCTCCATGGTGTGGAATCGTGACCCCATGTTAGGTGAGGCTACCCGCTGAGTTTAAGCATATCAATAAGCGGA.

5. Result and discussion

5.1 Presence of important agronomic characters

Among the different species of vanilla studied Vanilla aphyllaBlume and V. piliferaHoltt., flowered synchronously (Figure 5). V. aphyllaoccurs naturally in South India (Figure 6) and V. pilifera(Figure 7) in Assam, Northeast India. Flowers of both the species opened sequentially and lasted for one day in V. pilifera, whereas it lasted for 2 days in V. aphylla. In the former, signs of fruit set were observed even without pollination (Figures 1 and 8) whereas V. apyllaflowers did not set fruit (Figure 3), ruling out the possibility of natural fruit set in this species, which is thus similar to V. planifolia(Table 5).

Figure 5.

V. pilifera(T) inflorescence in comparison with that ofV. aphylla(B). Arrow Indicates signs of natural fruit set without pollination inV. pilifera.

Figure 6.

V. piliferaflower with a leaf (which develops at maturity).

Figure 7.

Vine ofV. aphyllain bloom.

Figure 8.

Cross section of the ovary pedicel ofV. aphyllawithout pollination, and after 24 hrs.

SpeciesDisease resistanceFragranceNatural seed setCrossabilityFruit sizeFlower life (hours)
V. aphyllaTolerant to Fusarium oxysporumNot seenCrossable to V. piliferaand V. planifolia> 36
V. piliferaHighly fragrantSymptoms seenCrossable to V. aphyllaLarger∼24
V. planifoliaSusceptibleNot seenCrossable to V. aphylla< 24

Table 5.

Important agronomic characters.

Cross sections of the ovary pedicel were observed after closing of the flowers. Persistent perianth is characteristic to the genus and also indicative of effective pollination. In flowers where pollination is not effected, the perianth is shed after the flower closes. Perianth in V. piliferawere found to persist even without pollination and the cross sections indicated initiation of seed set (Figures 9 and 10), whereas V. apyhlladid not show any indications (Figures 11 and 12). Since rostellum is present in both the species, natural pollination without an aid is ruled out. It can be suspected, that the fragrance of the V. piliferaflowers attracts insects (which were found to frequent the flowers often) to visit them and bring about effective pollination.

Figure 9.

Cross section of the ovary pedicel ofV. aphyllawithout pollination, and after 24 hrs.

Figure 10.

C.S. of ovary-pedicel ofV. piliferawithout pollination, showing indications of seed set.

Figure 11.

C.S. of ovary-pedicel ofV. piliferawithout pollination, showing indications of seed set.

Figure 12.

Flowers ofV. piliferain comparison withV. aphylla.

Pollinations both self and interspecific hybridizations between the two species were done and fruits set was observed (Figure 13).

Figure 13.

V. aphyllainflorescence with fruit set after interspecific hybridization.

5.2 Sequence analysis

General observations from the experiment

  1. The matK sequences of VG and VP are identical.

  2. The matK sequence of V1 was different from VG/VP at 21 nucleotide positions as shown in Table 6 below.

  3. Blast search of the matk sequences of VG/VP in the NCBI blast search gave 100% match with Vanilla planifolia(Accession No. KJ566306.1), as in the NCBI search results shown below.

    DescriptionMax scoreTotal scoreQuery coverE valueIdentAccession
    Vanilla planifoliachloroplast, complete genome15631563100%0.0100.00%KJ566306.1
    Vanilla planifolia chloroplast, complete genome15461546100%0,099.65%MF197310.1
    Vanilla planifolia tRNA-Lys (trnK) gene, partial sequence; and maturase K (matK) gene, compl15241524100%0.099.17%JN181462.1
    Vanilla planifolia maturase K (matK) chloroplast pseudogene, partial sequence15071507100%0.098.82%AF263687.1
    Vanilla planifolia chloroplast matK pseudogene15071507100%0.098.82%AJ310079.1
    Vanilla planifolia plastid partial matK gene for maturase K, specimen voucher Chase O-199 K1423142395%0.098.40%AJ581443.1
    Vanilla somae voucher KFBG290 maturase K (matK) gene, partial cds: plastid14191419100%0.096.93%KY966974.1
    Vanilla aphylla chloroplast DNA, complete genome1419141999%0.097.03%LC085348.1
    Vanilla pilifera voucher V5 maturase K (matK) gene, partial cds: chloroplast1354135499%0,095.64%FJ816099.1
    Vanilla siamensis voucher V2 maturase K (matK) gene, partial cds: chloroplast1315131597%0,095.23%FJ816097.1
    Vanilla planifolia voucher SBB-0324 maturase K (matK) gene, partial cds: chloroplast1314131484%0.0100.00%JN004635.1
    Vanilla planifolia isolate AD7LN25 maturase K (matK) qene. Partial cds: chloroplast1284128489%0.097.11%MF349972.1

  • Blast search of the matk sequences of VS in the NCBI blast search gave maximum identity with Vanilla somae(Accession No.KY966974.1). See the NCBI search results below.

    DescriptionMax scoreTotal scoreQuery coverE valueIdentAccession
    Vanilla somae voucher KFBG290 maturase K (matK) gene, partial cds: plastid1570157099%0.099.54%KY966974.1
    Vanilla aphylla chloroplast DNA, complete genome1570157099%0.099.54%LC085348.1
    Vanilla pilifera voucher V5 maturase K (matK) gene, partial cds: chloroplast14891489100%0.097.81%FJ816099.1
    Vanilla pomponachloroplast. Complete genome14741474100%0,097.45%MF197310.1
    Vanilla planifolia chloroplast. Complete genome14691469100%0.097.34%KJ566306.1
    Vanilla planifolia tRNA-Lys (trnK) gene, partial sequence: and maturase K (matK) gene, complel14521452100%0.096.99%JN181462.1
    Vanilla siamensis voucher V2 maturase K (matK) gene, partial cds: chloroplast1447144798%0.097.33%FJ816097.1
    Vanilla planifolia maturase K (matK) chloroplast pseudogene, partial sequence14351435100%0.096.64%AF263687.1
    Vanilla planifolia chloroplast matK pseudogene14351435100%0.096.64%AJ310079.1
    Vanilla planifolia isolate AD7LN25 maturase K (matK) gene, partial cds: chloroplast1408140890%0.099.23%MF349972.1
    Vanilla roscheri voucher NMK:838.10216 maturase K (matK) gene, partial cds: chloroplast1395139593%0.097.89%KU748308.1
    Vanilla aphylla voucher V1 maturase K (matK) gene, partial cds: chloroplast1391139196%0.096.79%FJ816096.1

  • Blast search of the ITS sequences of VS in the NCBI blast search gave maximum identity with Vanilla shenzhenica (Accession No. JF796930.1). See the NCBI search results below.

    DescriptionMax scoreTotal scoreQuery coverE valueIdentAccession
    Vanilla somae voucher KFBG290 maturase K (matK) gene, partial cds: plastid1570157099%0.099.54%KY966974.1
    Vanilla aphylla chloroplast DNA, complete genome1570157099%0.099.54%LC085348.1
    Vanilla pilifera voucher V5 maturase K (matK) gene, partial cds: chloroplast14891489100%0.097.81%FJ816099.1
    Vanilla pompona chloroplast. Complete genome14741474100%0,097.45%MF197310.1
    Vanilla planifolia chloroplast. Complete genome14691469100%0.097.34%KJ566306.1
    Vanilla planifolia tRNA-Lys (trnK) gene, partial sequence: and maturase K (matK) gene, complel14521452100%0.096.99%JN181462.1
    Vanilla siamensis voucher V2 maturase K (matK) gene, partial cds: chloroplast1447144798%0.097.33%FJ816097.1
    Vanilla planifolia maturase K (matK) chloroplast pseudogene, partial sequence14351435100%0.096.64%AF263687.1
    Vanilla planifolia chloroplast matK pseudogene14351435100%0.096.64%AJ310079.1
    Vanilla planifolia isolate AD7LN25 maturase K (matK) gene, partial cds: chloroplast1408140890%0.099.23%MF349972.1
    Vanilla roscheri voucher NMK:838.10216 maturase K (matK) gene, partial cds: chloroplast1395139593%0.097.89%KU748308.1
    Vanilla aphylla voucher V1 maturase K (matK) gene, partial cds: chloroplast1391139196%0.096.79%FJ816096.1

  • The ITS sequences matching with different Vanilla sp. were downloaded and subjected to analysis using MEGA7.0 software (Table 7).

  • Nucleotide position112223333344455666667
    390352267879906466897
    703823877312853017553
    VS matkTTTCCCTGCGGCAGCACCTTC
    VG matkGACTATGTACTATTTGTTCGT
    VP matkGACTATGTACTATTTGTTCGT

    Table 6.

    Matk sequence analysis.

    VS ITSJF796930.1_Vanilla_shenzhenicaKY966687.1_Vanilla_somaeAF151006.1_Vanilla_aphyllaJF825978.1_Vanilla_siamensisFJ425830.1_Vanilla_imperialisFJ425840.1_Vanilla_roscheriFJ425835.1_Vanilla_barbellataFJ425834.1_Vanilla_africanaEU498163.1_Vanilla_bahianaGQ867241.1_Vanilla_planifoliaGQ867237.1_Vanilla_pomponaAF391785.1_Vanilla_hirsutaEU498165.1_Vanilla_edwallii
    VS ITS0
    JF796930.1_Vanilla_shenzhenica200
    KY966687.1_Vanilla_somae2000
    AF151006.1_Vanilla_aphylla2719190
    JF825978.1_Vanilla_siamensis423939410
    FJ425830.1_Vanilla_imperialis40333341470
    FJ425840.1_Vanilla_roscheri4134344553400
    FJ425835.1_Vanilla_barbellata554848556657580
    FJ425834.1_Vanilla_africana63515156665660760
    EU498163.1_Vanilla_bahiana9689899610197991071000
    GQ867241.1_Vanilla_planifolia107100100107119106113110110450
    GQ867237.1_Vanilla_pompona999292991049810310710420450
    AF391785.1_Vanilla_hirsuta10192921021141011021081003931430
    EU498165.1_Vanilla_edwallii1321331331361431361431411461391501361460

    Table 7.

    Estimates of evolutionary divergence between sequences.

    The number of base differences per sequence from between sequences are shown. The analysis involved 14 nucleotide sequences. All ambiguous positions were removed for each sequence pair. There was a total of 657 positions in the final dataset. Evolutionary analyses were conducted in MEGA7 (Figure 14).

    Figure 14.

    Phylogenic analysis of the ITS sequences inferred using the neighbor-joining method, computed using the Kimura 2-parameter method and are in the units of the number of base substitutions per site. The analysis involved 14 nucleotide sequences. All ambiguous positions were removed for each sequence pair. There was a total of 657 positions in the final dataset. The analyses were conducted in MEGA7.

    Advertisement

    6. Conclusions

    The analysis involved 14 nucleotide sequences. All ambiguous positions were removed for each sequence pair. There was a total of 657 positions in the final dataset. The analyses were conducted in MEGA7. The phylogeny analysis also revealed the separate clustering offer leafy and leafless species. Vanilla siamensis, a leafy species, indicating signs of self-pollination in its wild, in Thailand, clustered with leafless V. aphyllaspecies.

    The studies further reveal the complexity of the biosynthesis of the natural vanillin synthesis. However, it is to be further analyzed whether leafy character is associated with enhanced photosynthetic products that indirectly affect the vanillin synthesis too. This reiterates the need for conservation of the genetic resources [12] of Vanilla across the continents, for implementing meaningful breeding programs, to enhance vanillin productivity in addition to disease resistance and reproductive behavior.

    Acknowledgments

    The first author acknowledges the former Directors of Indian Institute of Spices Research, Kozhikode, Kerala from where she initiated these studies. The authors are thankful for the financial support rendered by University Grants Commission (MRP and CPE funds), DST-FIST funds, for taking up these research initiatives, in their laboratory and express gratitude to Scientists at Centre for Medicinal Plant Research, Kottakkal, Malappuram, for support in Sequencing work.

    DOWNLOAD FOR FREE

    chapter PDF

    © 2021 The Author(s). Licensee IntechOpen. This chapter is distributed under the terms of the Creative Commons Attribution 3.0 License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

    How to cite and reference

    Link to this chapter Copy to clipboard

    Cite this chapter Copy to clipboard

    Minoo Divakaran and N.T. Fathima Rafieah (August 26th 2021). Genetic Resources of The Universal Flavor, Vanilla [Online First], IntechOpen, DOI: 10.5772/intechopen.99043. Available from:

    chapter statistics

    25total chapter downloads

    More statistics for editors and authors

    Login to your personal dashboard for more detailed statistics on your publications.

    Access personal reporting

    We are IntechOpen, the world's leading publisher of Open Access books. Built by scientists, for scientists. Our readership spans scientists, professors, researchers, librarians, and students, as well as business professionals. We share our knowledge and peer-reveiwed research papers with libraries, scientific and engineering societies, and also work with corporate R&D departments and government entities.

    More About Us