Development of RT-PCR Based Diagnosis of SARS-CoV-2

Abstract

In the 2020, COVID-19 pandemic disease created an havoc situation world widely and mainly caused by Severe Acute Respiratory Syndrome Coronavirus-2 (SARS-CoV-2). It has been challenging task for researchers, scientists and medico-pharmaceutical organisations to find out rapid and reliable diagnosis methods. Among the all testing services, a Reverse Transcription Polymerase Chain Reaction (RT-PCR) is the more accurate, rapid and authenticated molecular technique used for most of the diagnosis of major diseases. It has been a global priority to fix the rapid diagnosis method to combat against the pandemic COVID-19. Thus, the present chapter mainly focussing on the progress of RT-PCR method development though various processes of data collection on isolation of whole genome sequence, its primer and method designing. In this scenario, India suddenly become the global leader for vaccine development and hence the challenges and RT-PCR kit development in India and rest of the world has been be discussed. World wide many Government and private agencies and industries have taken an initiative for diagnosis of SARS-CoV-2 hence this chapter also summarised the scope of RT-PCR to combat pandemic situation in future.

1. Introduction

Coronavirus outbreak first case found in Wuhan, China in December 2019 [1]. Further, it became a pandemic, affecting the whole world. On February 2020, World Health Organisation (WHO) announced an official name for Coronavirus spread disease as COVID-19 [2]. It primarily targets a respiratory system in humans, as the appearance of symptoms depends on the incubation period, which further relies on the patient’s age and the immune system [3].

SARS-CoV-2 as a public health emergency was declared by WHO and thereafter it became essential to find diagnostic tests for early detection and early treatment [4]. Normally the best way to detect any virus from the sample is its isolation and further confirmation by various molecular techniques. But Center for Diseases Control and Prevention (CDC) recommended not to isolate the SARS-CoV-2 as it is a new virus and this practices could be a risky approach and suggested to use patients sample directly for diagnosis [5]. Most of the diagnostic methods are molecular-based hence for diagnosis virus genome study become necessary. On January 2020 the ssRNA - 29870 bp whole sequence of SARS-CoV-2 was reported with GenBank accession number MN908947 [6, 7]. Thus, the basic information of genome sequence helpful for molecular based detection method development specially Polymerase chain reaction (PCR) based methods.

Main focused was on PCR as it is a rapid detection method. Among that Reverse Transcription Polymerase Chain Reaction (RT-PCR) is the most commonly used and still be using the method as it is exactly showing the positive results with great -sensitivity. RT-PCR was said to be a gold-standard for testing coronavirus [8]. RT-PCR can detect the virus from throat, nasopharyngeal swab as well as from stool sample [9]. Early detection using PCR prove to be most sensitive way as negative sample cannot be ruled out. One cohort study found that patients even if not having any symptoms still may be the carrier for viruses thus RT-PCR can detect those at genetic level. Thus, it helps in prevention of nosocomial infection and further spread unknowingly [10].

Sample collection methods also affect the diagnosis results. Thus, WHO and CDC recommended the use of nylon, rayon or any synthetic fibre swabs for sample collection. But shortage of such swabs hammered the testing numbers. Hence, some researchers decided to study the effect of cotton tipped plastic swabs on PCR results and it found that no inhibition effect was seen on PCR [11]. Another method related to heating of sample known as Loop-mediated Isothermal Amplification (LAMP) this works by skipping the RNA extraction process. RNA RT-LAMP sensitivity found to be 97%, while specificity was 99% [12]. Study tried the three viral transmission medium heating treatments named as directly without additives, in a formamide-EDTA buffer and in a RNAsnap™ buffer. Basically, this method skips the RNA extraction process of RT-qPCR by replacing it with heating treatments thus reduces the time for the test and also gives the same result as normal RT-PCR protocol [13]. Similarly, in one study RNA extraction process was skipped and on that place RT-qPCR master mixes were used. Now this helps under such situation where reagent shortage occurs in hospitals. It also expanded the testing capacities [14]. Similar way direct RT-qPCR was used in one of the study found to be an alternative for classical method without RNA extraction [15]. But there are certain limitations in remote areas and portable diagnosis will be preferable using mini PCR based diagnosis kits. One study combined the mini PCR and multi-well plate reader for convenient and portable diagnosis under pandemic situation [16].

As per the available RNA sequences and need of diagnosis method for COVID-19, several RNA extraction kits are available in the market. But due to pandemic situation and rising number of COVID patients, it was under shortage. Thus, magnetic beads base RNA extraction methods were used by various researchers. Silica beads were found to yields RNA and comparable with commercially available QIAcube viral RNA extraction kit which were determined by RT-qPCR and RT-LAMP [17]. Another study due to complexity of protocol was done, in which rather than using transport medium and RNA extraction it was decided to study the use of direct elution of swab and performing RT-qPCR. Elution of dry swabs were done directly in simple TE buffer and tested. Thus, this process simplifies the pre RT-qPCR preparation [18].

Commercial RT-PCR kits are already available in the market and few of them are manufactured by Altona Diagnostics (Hamburg, Germany), BGI (Shenzhen, China), CerTest Biotec (Zaragoza, Spain), KH Medical (Gyeonggi-do, Republic of Korea), Primer Design (Chandler’s Ford, UK), R-Biopharm AG (Darmstadt, Germany), and Seegene (Seoul, South Korea). All these kits are the best for detection without any cross-reactivity with another virus and hence can be used for regular diagnosis of SARS-CoV-2 [19]. But the limit of detection (LoD) of kits matters the quality. Earlier China National Medical Products Administration (NMPA) approved 6 PCR kits, but due to time shortage optimisation was not done so LoD might get affected. Thus examination of LoD of this 6 PCR kits with real RNA of the virus was carried. All kits showed different LoD and the poorest LoDs has high chances of giving false negative results. The lab should confirm the performance of the kits and the utilise [20]. Some of the primers and probes for CoV detection has been shown in Table 1.

Country	Target genes	Sequence	Reference
China	ORF1a	Forward primer: AGAAGATTGGTTAGATGATGATAGT; Reverse primer: TTCCATCTCTAATTGAGGTTGAACC; Probe:FAM-TCCTCACTGCCGTCTTGTTGACCA-BHQ1	[21]
Hong Kong	N gene	Forward primer: TAATCAGACAAGGAACTGATTA; Reverse primer: CGAAGGTGTGACTTCCATG; Probe: FAM/ZEN-GCAAATTGTGCAATTTGCGG-IBFQ	[22]
USA	N1 gene	Forward primer: GAC CCC AAA ATCAGCGAA AT; Reverse primer: TCTGGTTACTGCCAGTTGAATCTG; Probe: FAM-ACCCCGCATTACGTTTGGTGGACC-BHQ1	[23]
USA	N2 gene	Forward primer: TTACAA ACATTGGCCGCA AA; Reverse primer: GCGCGACATTCCGAAGAA; Probe: FAM-ACA ATTTGCCCCCAGCGTTAG-BHQ1	[24]
USA	N3 gene	Forward primer: GGGAGCCTTGAA TAC ACC AAA A; Reverse primer: TGTAGCACG ATTGCAGCATTG; Probe: FAM-AYCACATTGGCACCCGCA ATCCTG-BHQ1	[25]
Germany	E gene	Forward primer: ACAGGTACGTTAATAGTTAATAGCGT; Reverse primer: ATATTGCAGCAGTACGCACACA; Probe: FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ	[26]
China	Spike	Forward primer: CCTACTAAATTAAATGATCTCTGCTTTACT; Reverse primer: CAAGCTATAACGCAGCCTGTA	[27]

Table 1.

Primers and probes recorded for SARS-CoV-2 real-time reverse transcription PCR assays.

Currently, the RT-PCR test has a 95% specificity and 70% of the sensitivity rate [28, 29]. Self-collected saliva specimens was tested with 6 different molecular diagnostic tests like RTqPCR LDT, SARS-CoV-2 RAT, 3 direct RT-qPCR kits, and RT-LAMP and all tests showed a excellent results. Thus, based on these results, molecular diagnostic method has a great scope ahead [30]. Dr. Aneesh Mehta said that saliva test for coronavirus by PCR is the new type of diagnosis, as it is not invasive method but just spit is required as a sample [31]. This test is said to be a ‘SalivaDirect’ test developed by a scientist of the Yale School of Public Health, authorised by Food and Drug Administration (FDA) [32].

Most countries have been used Indian Council of Medical Research (ICMR, India) suggested Rapid Antigen Test (RAT) which was available as a kit and direct antigen identification from nasal swab [33]. However several countries found that the negative findings by RAT were shown to be positive by RT-PCR. Thus, according to Dr. Balram Bhargava, Director of ICMR, the RAT was found to offer false-negative outcomes. One of the reports says that around 11% of people found negative by RAT in Delhi, after testing with RT-PCR found to be positive [34]. The Indian Health Ministry and ICMR provided a guideline to re-test the RAT tested negative patients and those who develop symptoms after a few days of the test by RT-PCR [35]. Until now, RT-PCR is the recommended test for all organisations and has been followed. Still, many experts are trying to carry out a number of inventions and studies to make it simpler, more practical and more cost-effective for the whole planet. This book chapter summarised the upto date basics and applied study of PCR based diagnosis of SARs CoV-2 including current challenges of diagnosis, protocols and future prospects.

2. Challenges for SARs CoV-2 diagnosis

For treatment of SARs CoV-2, no vaccines is available but it was only the option left out to healthcare sectors that to prevent transmission as soon as possible [26]. So most the countries invested in isolation and detection [26]. The diagnosis of COVID-19 was difficult as it shows symptoms similar to those of flu viruses, thus it was crucial to find the diagnosis as early as possible for management purpose [36]. One of the most important problems in analytical chemistry was highlighted by the COVID-19 pandemic outbreak: the discrepancies between the testing technique (TT) and the testing method (TM) are a common confusion in the clinical field. In addition to the research procedure, TT consists of many steps, such as the collection of specimens, their preservation, storage, transport, labelling and distribution. Pre-test planning procedures for patients are also part of the process. Previously, these procedures, also known as pre-analytical variables, have been identified as the key causes of laboratory testing errors. The most acceptable TT for the TM must be validated during the production of the TM for the identification of the target analyte; otherwise the analysis is performed within a wide range of analytical errors [37]. Successful detection of the virus also depends on time of testing, early or late detection, viral load, sample collection etc. [38].

Further challenge was during the false negative results. It is easy to understand and interpret a perfect test for a disease; the test would only be positive if the disease was present, and it would only be negative if it were absent. However, since all studies have false positives and false negative results, diagnostic tests are not flawless. Test results do not definitively state whether or not there is a disease (or virus). This does not mean that the test is not beneficial; it merely implies that the test results must be probabilistically tested on the basis of test output characteristics, patient data, and disease prevalence [39]. To interpret the results of incomplete tests, two main metrics that characterise the test are needed: diagnostic sensitivity and diagnosis specificity [40]. At present, for commonly used SARS-CoV-2 samples, there is minimal information on these values. To accurately interpret an incomplete test, the approximate probability that the person being evaluated has the disorder must also be considered [39].

The diagnosis was completely relied on two ways Molecular and serological testing as shown in Figure 1. Different test among these two categories was tried during a pandemic situation [41].

Figure 1.

Two ways of COVID-19 diagnosis.

Currently, RT-PCR is commonly used method by many laboratories due to specificity and fast detection [40]. Some test commonly use for CoV detection has been shown in Table 2.

Tests	Detection	Sample	Advantage	Disadvantage	Reference
Molecular
RT-PCR	Viral RNA	Nose, throat swab, sputum, stool	Specific Less time	False negative result if viral load is less or if sample is not collected properly.	[24]
Nested RT-PCR	Viral RNA	Nose, throat swab	Highly specific results even in low viral load sample	Cross contamination during protocol	[41]
RT-LAMP	Viral RNA	Nose, throat swab, sputum, stool	Specific Less time	Optimize reaction condition	[42]
CRISPR	Viral RNA	Nose, throat swab, Broncho alveolar; lavage fluid	Easy to use; Low cost	Can give false result	[8]
Viral sequencing	Viral RNA	Nose, throat swab	Sensitive, convenient	Costly, need trained person, sophisticated instrument	[43]
Serology
ELISA	Antibody	Blood	Simple and cost effective	Not established for SARS-CoV-2	[44]
Neutralization assay	Antibody	Whole blood, serum, plasma	Quantitative result,	Live virus hence safety required	[37]

Table 2.

Diagnostic testing for SARS-CoV-2.

3. Real-time RT-PCR basics

RT-PCR stands for real-time reverse transcription-polymerase chain reaction (RT-PCR). It is a technique use to determine the nucleic acid (DNA/RNA) from sample specifically from a virus or bacteria. Currently used for COVID-19 testing. It combines the reverse transcription of RNA into DNA It uses radioactive isotope marker or fluorescent dyes for detection of the targeted gene. It can detect genetic material from nose, throat, stool and sputum sample [45].

4. Real-time RT-PCR protocol

SARS-CoV-2 testing solely depends on patients’ health and concern, if the patient is getting some symptoms like cough, fever, headache or related, then the patient can personally take a test by visiting COVID center. If patient is already under medical treatment related to some other health issues, then doctor can recommend a COVID test to that patient for an early treatment. After that the most important part of RT-PCR covid testing is a collection of sample. It is most important as if the sample is not collected properly, it can affect the result as seen in many research [46, 47, 48]. CDC has provided the protocol for sample collection and all labs are following this same. Along with that, instruction regarding virus isolation has been given, it is not suppose to be done by an unless it is performed in the BSL-3 laboratory. Sample recommended for collection are nasopharyngeal (NP) and oropharyngeal (OP) swab for RT-PCR [49]. An expert technician can collect the sample from the nose and throat of patient separately by using swab which is individually wrapped. Swab has to be made up of synthetic fiber like plastic or wire shafts. Technician has to follow certain rules while collecting sample like 6 feet of separation, personal protective equipment (PPE) kit, proper gloves and faced covered lid. The sample is to be collected deeply. Once collected it has to be transferred to viral transport medium (VTM). VTM is made up of 2% FBS, 100 μg/mL Gentamicin and 0.5 μg/mL Amphotericin B. Among this 3 ml of media is transferred to sterile screwed capped bottles in which swab is put and stored before further testing [50]. Sample can be stored at 2–8 °C for 72 hours only. If the sample has to be transported for a long distance, then it should be carried in icepack [51].

Once the sample has been collected, then next important and time consuming process is RNA extraction means purification of RNA samples. Most of RNA extraction kits are available in the market shown in Table 3, which can be used directly contain lysis buffer and other chemicals which will lyse the virus and RNA will get into solution. First, in order to release the genetic material, the patient’s sample is mixed with a solution which lyses the cells. In order to purify RNA, inactivation of RNA activity, denaturation of nucleoprotein complexes and elimination of contaminating DNA and proteins must take place by (phenol which will attract the other protein and break it down, guanidine isothyocynate is also a protein denaturant, RNase inhibitors to inactivate the ribonuclease enzyme) [52]. The resulting cellular debris will then proceed to the RT-PCR stage with the extracted RNA. Further RNA purification is carried by using kit or by centrifugation and solid phase extraction by using column Centrifuge and spin column, which is to be placed in a clean collection tube to collect the supernatant and filtrate is discarded. Again, it has to be washed and centrifuge. Further by using elution buffer RNA is purified.

Kits	Company	Country
Virus RNA Extraction kit
QIAamp DSP Viral RNA Mini Kit	Qiagen	Hong Kong, Japan, USA
QIAamp Viral RNA Mini Kit
Chemagic Viral DNA/RNA 300 Kit H96	PerkinElmer chemagen Technologie GmbH	Germany
SARS-CoV-2 Nucleic Acid Kit (RUO)
MagNA Pure 96 System	Roche	Germany
ANDiS Viral Nucleic RNA Auto Extraction & Purification Kit	3Dmed	China
NucleoMag Dx Pathogen Kit	Macherey-Nagel	France, USA, Switzerland
NucleoSpin RNA Virus
NucleoMag Virus kit
Detection kit
SuperScript III One-Step RT-PCR System with Platinum Taq DNA Polymerase	ThermoFisher	USA
TaqMan Fast Virus 1-Step Master Mix
SuperScript III Platinum One-Step qRT-PCR Kit
TaqPath 1-Step RT-qPCR Master Mix, CG
QuantiTect Probe RT-PCR Kit	Qiagen	Japan
New Coronavirus Nucleic Acid Detection Kit	PerkinElmer chemagen Technologie GmbH	Germany
Respiratory SARS-CoV-2 RT-PCR Panel Assay
SARS-CoV-2 Real-time RT-PCR Assay
EURORealTime™ SARS-CoV-2

Table 3.

Virus extraction and detection kits.

After purification of viral RNA, the next step is the preparation of the reaction mixture for PCR amplification. In this step master mix has to be used which is premixed concentrated solution that consists of buffer, Reverse transcriptase enzyme nucleotide, forward primer, reverse primer, TaqMan probe, DNA polymerase. Finally, the RNA template to be added and mixed by pulse vortexing. Then load the reaction mixture into a PCR plate which generally contain 96 wells, allowing analysis of several samples at a time. Then place this plate in PCR machine (thermal cycler). Real time RT-PCR is used for detection of new Coronavirus 2019 by amplification of target sequences in Rdrp genes, E gene and N gene. The choice of the target depends on primers and the probe sequences. The first step in RT-PCR is reverse transcription. The first strand complementary DNA synthesis is primed with the PCR reverse primer which hybridizes the complementary part of the virus RNA genome. Reverse transcriptase then add DNA nucleotides onto the 3-prime end of the primer synthesizing DNA complementary of the viral RNA. Then denaturation takes place. Thus PCR consists of a series of cycles consisting of Denaturation, annealing and elongation. In cycle 1, DNA denaturation at 95 °C occurs. The next step at 58 °C allows the annealing of forward primer to complementary part of DNA. In elongation step, DNA polymerase synthesize a new strand complementary to the DNA template by adding nucleotides from the reaction mixture. In 2nd cycle, DNA denaturation form ssDNA, then annealing of primers and Taq-man probe to its complementary part of the target DNA. Taq-man probe consist of a fluorophore covalentaly attached to the 5′ end of oligonucleotide probe, the fluorescence is emitted by the fluorophore when is excited by the cyclers light source. Also, this probe consists of quencher at 3′ end. The close proximity of the reporter to the quencher prevents detection of its fluorescence. When polymerase reaches the Taqman probe its endogenous 5′ nuclease activity cleaves the probe, separating the dye from the quencher, with each cycle of PCR more dyes are released, resulting in an increase in fluorescence intensity proportionately to the amount of amplicon synthesized. For the fluorescence signal a tungsten-halogen lamp, an excitation filter, lens, emission filter and charged coupled device (CCD) camera are use which converts light into digital data. A flowchart of the protocol has shown in Figure 2 [24].

Figure 2.

RT-PCR methodological performance flowchart.

5. Recent development of RT-PCR for SARS-CoV-2 diagnosis

In addition to prevention methods (e.g., hygiene, social distance, isolation of infected individuals, and travel restriction), rigorous community infection testing is essential to track the transmission of the disease as well as educating public policies [53]. Nations that have implemented large research strategies at an early stage like South Korea, Vietnam, and New Zealand have been better able to restrict the spread of the disease. Tests should ideally be simple to sample and evaluate, precise, reliable, scalable and inexpensive. Often, point-of-care tests (POCT) based on antibodies match this definition. However, rapidly emerging epidemics due to novel viruses do not allow antibody-based tests to evolve in a timely manner [54]. Because of the simple adaptability to the nucleotide sequence of the target, viral load tests based on real-time, quantitative RT-PCR (referred to as RTqPCR) are thus an ideal test [55]. This RT-qPCR is currently a reliable test commonly used for the diagnosis of SARS-CoV-2 infected symptomatic and asymptomatic patients [56]. Several scientific and clinical institutions around the world have produced molecular assays to diagnose SARS-CoV-2 and have made RT-qPCR primers and sample sets available to the public [57].

As the genetic code of coronaviruses consists of RNA, its purification of the test samples is a crucial step in RT-qPCR protocols. Officially, institutions in some countries have suggested unique RNA isolation kits for SARSCoV-2 detection [57]. Various virus extraction and detections kits are available in market as shown in Table 3. The qRT-PCR has the benefits of high sensitivity, high precision, and a wide variety of sample types that can be use but there are however several factors that influence qRT-PCR outcomes, such as repeated washing, purification and separation of viral nucleic acids, which cause a substantial loss of nucleic acid and increase the risk of fragmentation and hydrolysis of nucleic acid; the number of virus replications below the qRT-PCR detection threshold would also cause false negative effects on the early stage of SARS-CoV-2 infection. So this problem was faced by many laboratories [58]. Some started focusing on RT-LAMP—reverse transcriptase loop-mediated isothermal amplification [59]. Other PCR, which was found to be more potent to detect low viral load was digital droplet PCR (ddPCR) as compared to qRT-PCR but due to limited availability ddPCR instrumentation and lab expertise mostly qRT-PCR is being used [60]. At this point, superior resources are concentrated in all parts of the country to reinforce scientific research. It is assumed that our ability to diagnose and treat patients with new coronavirus pneumonia will develop further with the enhancement and advancement of detection technology.

6. Status in India

Collection of data at one place so that whole country population can refer this data at such a tough situation was a necessity so the Government of India has open an website -https://covid19cc.nic.in/ICMR/login.aspx, which has lots of information regarding testing centers, counting of RT-PCR tests and other antibody–antigen tests, current positive cases, available collection centers with their address contacts etc. Also aligned with ICMR, said to be Covid-19 sample collection management system for rapid antigen, antibody and RT-PCR tests. Lots of RT-PCR kits with variations, are manufactured in India has been shown in Table 4.

Kit	Company	Sample required	Website
Fluidigm’s Advanta Dx SARS-CoV-2 RT-PCR kit	Fluidigm’s Corporation	Saliva	https://www.fluidigm.com/
R-Green kit (SARS COV2-real-time PCR)	Reliance Life Sciences	Throat, nose swab	https://rellife.com/
Dry Swab-Direct RT-PCR test	Centre for Cellular and Molecular Biology (CCMB)	Dry Nasal swab	https://www.ccmb.res.in/
RT-PCR testing kits	iGenetic Diagnostics and BioGenomics	Throat, nose swab	https://www.igenetic.com/
Mylab PathoDetect COVID-19 Qualitative PCR kit	Mylab Discovery Solutions Pvt. Ltd	Throat, nose swab	https://mylabdiscoverysolutions.com/
Real Time PCR kits	Genome Diagnostics Pvt. Ltd.	Nasopharyngeal swab	http://www.genomediagnostics.co.in/about-us.html
GlobalTM diagnostic kit	Equine Biotech	Nasopharyngeal swab	https://covid19.iisc.ac.in/covid-19-rt-pcr-kit/
Corosure Covid-19 diagnostic kit	IIT Delhi	Throat, nose swab	https://home.iitd.ac.in/news-tea-haritaki.php
RT-PCR kit	CSIR-IICT	Throat, nose swab	https://iictindia.org/

Table 4.

RT-PCR kit developed by Indian companies and sample requirement.

7. International status

RT-qPCR assays were already known, but development can lead to better results. Thus, one study was done by targeting two monoplex assays recommended by WHO that was targeted on the envelope gene (E-Sarbeco) and RNA-Dependant RNA Polymerase coding genes (RdRp-IP4). This was combined and test named as ‘Duo SARS-CoV-2 RT-qPCR assay’. As already lots of duo assays are commercially available, but this study was done to combine in-house assays. Can be used to reduce the chances of false negative results as it is dual assay [60]. As dual target assays are commercially available, developed specifically to target multiple sites in the viral genome, but mutation rates in virus found to be moderate which can cause problem with respect to results. Some of the tests were done by using ‘cobas SARS-CoV-2 E gene qRT-PCR’ but some failures were seen due to change in nucleotide at position 26340 of the SARS-CoV-2 gene. So the study was done to identify single nucleotide polymorphism in E gene of the virus. This includes the importance of study regarding mutations in the virus and thus to prevent false negative results [61]. The protocol provided by WHO mention the three assay that is to be performed: First line screening assay - E gene assay, Confirmatory assay - RdRp gene assay, and Additional confirmatory assay - N gene assay [24]. ‘Multiplex Real Time PCR’ was also use to find its efficacy for SARS-CoV-2 detection. Found to be rapid and accurate method for viral detection [62]. ‘Aus Diagnostics respiratory MT-PCR assay’ was also found to be reliable and sensitive [63]. Two ‘Single-tube nested (STN) real-time RT-PCR assays’ specifically targets RdRp/Hel and N genes, found to be 100% specific for detection of SARS-CoV-2 [64]. Even high cost assays were given preference during a pandemic situation like TaqMan-based real-time RT-qPCR which was not even accessible to lots of laboratories. So it was performed by using 2 methods that are SYBR green RT-qPCR and conventional PCR basically standardisation was done of this 2 methods which is cost effective methods and found to give equal results as that of TaqMan-based real-time RT-qPCR [65].

COVID-19 diagnosis now done by one step RT-qPCR by using primers and probes which were developed at different institutes like China CDC, Charite (Germany), The University of Hong Kong, National Institute of Infectious Diseases in Japan (Japan NIID), National Institute of Health in Thailand (Thailand NIH) and US CDC which was announced by WHO [2, 24]. One study performed the analysis of primer-probe sets specifically targeting the N region and RdRp/Orf1 of SARS-CoV-2 by N-assay and RdRp/Orf1 Assays. Primer probe set for N-assay was N (China CDC), HKU-N (HKU), NIID_2019-nCOV_N (Japan NIID), WH-NIC N (Thailand NIH), and 2019-nCoV_N1, -N2, and -N3 (US CDC) and for RdRp/Orf1 Assay RdRp_SARSr (Charite), HKU-ORF1b-nsp14 (HKU), and ORF1ab (China CDC) primer probe set was studied. Results says that NIID_2019-nCOV_N” from the Japan NIID and “ORF1ab” from China CDC gave a good performance for RT-qPCR analysis without any cross-reactivity and non-specific amplifications. This can be used for further diagnosis [66]. Sensitivity of PCR also depends on primer concentration, degeneration and multi target detection. Initial concentration of primer was 300-900 nM but as its concentration rises sensitivity also improves [67]. One study found that concentration upto 400 nM rise the sensitivity [68]. Degenerate primers plays an important role with respect to diversity of SARS-CoV-2. While screening assays with a single target area are more prone to sequence differences than dual or triple-target assays for multi-target identification [67]. Other than this primer length, melting temperature, GC content and annealing temperature also affects the sensitivity of PCR assay [67]. One study attempted to deduce the specific patterns among SARS-CoV-2 isolates and accordingly primers were design targeted to nsp2 gene and further use for diagnosis of probe free real-time RT-PCR. Sensitive and rapid SARS-CoV-2-specific real-time RT-PCR assay COVID-19-nsp2 has therefore been developed [69]. In one research, the efficiency of three novel real-time reverse transcription-PCR (RT-PCR) assays targeting RNA-dependent RNA polymerase (RdRp)/helicase (Hel), spike (S) and nucleocapsid (N) SARS-CoV-2 genes was developed and compared. RNA polymerase (RdRp)/(Hel) assay found to be effective with no cross reactivity with other viruses among samples [27]. Some of the RT-PCR kits manufactured at International level along with sample requirement has been shown in Table 5.

Kit Name	Company	Country	Sample required	Website
1copy™ COVID-19 qPCR Multi Kit	1drop Inc.	Korea	Nasal swab	http://www.1drop.co.kr/
ANDiS® SARS-CoV-2 RT-qPCR Detection Kit	3D Medicines	United state	Nasopharyngeal swab	https://www.3dmedcare.com/covid/
CareStart™ COVID-19 MDx RT-PCR	Access Bio, Inc.	United state	Nasopharyngeal swab, Oropharyngeal swab	https://carestart.com/
MOLgen SARSCoV2 Real Time RT PCR	Adaltis S.r.l.	Italy	Nasopharyngeal swabs, oropharyngeal swabs, sputum and bronchoalveolar lavage fluid (BALF).	http://www.adaltis.net/products/molecular-diagnostic-tests/sars-cov2-covid-19/sars-cov2-covid-19/
LyteStar 2019-nCoV RT-PCR Kit 1.0	ADT Biotech	Malaysia	Nasopharyngeal swab, Oropharyngeal swab	http://adt-biotech.com/lytestartm-detection-kits/
AccuPower® SARS-CoV-2 Real-Time RT-PCR kit	BIONEER Corporation	Philippines	Sputum, nasopharyngeal swab, oropharyngeal swab	https://eng.bioneer.com/20-scv-2122.html
VIASURE SARS-CoV-2 S gene Real Time PCR Detection Kit adapted for BD MAX™ System	CerTest Biotec, S.L.	Spain	Respiratory samples	https://www.certest.es/
Simplexa™ COVID-19 Direct RT-PCR Kit	DiaSorin Molecular, LLC	United state	Nasal swab, nasopharyngeal swab, nasal wash/aspirate, and BAL specimens	https://molecular.diasorin.com/us/kit/simplexa-covid-19-direct-kit/
Quick SARS-CoV-2 rRT-PCR Kit	Zymo Research Corp.	United state	Upper respiratory and lower respiratory sample	https://www.zymoresearch.com/
SARS-CoV-2 Nucleic Acid Detection Kit (PCR-Fluorescent Probe Method)	Zybio, Inc.	Philippines	Nasal/throat swab, bronchoalveolar lavage fluids, stool	https://m.zybio.com/en/Product/Molecule/2020-03-24/316.html
Novel Coronavirus (2019-nCoV)/Flu A/Flu B Real-time Multiplex RT-PCR Kit	Zhuhai Haitai Biological Pharmaceutical Co., Ltd	China	Upper respiratory and lower respiratory sample	http://www.zhhaitai.com/
MolecuTech® Real-Time COVID-19	YD Diagnostics Corp.	Korea	Respiratory specimens	http://www.yd-diagnostics.com/2012/eng/channel_02/prt_list.php?selID=37
COVID-19 ORF1ab/N Gene PCR Detection Kit	Xi’an Tianlong Science and Technology Co., Ltd	China	Upper respiratory and lower respiratory sample	https://xi-an-tianlong.abraa.com/
Real time RT-PCR Kit for the detection of SARS-CoV-2	Suzhou BTA Biotech Co. Ltd	China	Nasal swab, nasopharyngeal swab, nasal wash/aspirate, and BAL specimens	http://vosunbio.com/
LyoDx® A Freeze-Dried Real-Time RT-PCR Detection Reagent for SARS-CoV-2	SignalDT Biotechnologies (SZ), Inc.	Alameda	Respiratory samples	https://signaldt-biosystems-llc.hub.biz/
SBC SARS-CoV-2 Convective PCR Diagnostic Device/Kit	Schweitzer Biotech Company Ltd	Taiwan	Nasopharyngeal or oropharyngeal swabs	http://covid19.sbc-biotech.com/
RainSure COVID-19 dPCR Detection Kit (lab-based)	RainSure Scientific Co., Ltd	China	Respiratory samples	http://en.rainsurebio.com/
COVID-19 One-Step COVID-19 RT-PCR Kit	Pishtaz Teb Diagnostics	Iran	Nasopharyngeal or oropharyngeal swabs	https://pishtazteb.com/en/pcr/
PerkinElmer® SARS-CoV-2 Realtime RT-PCR Assay	PerkinElmer Inc.	United state	Nasopharyngeal or oropharyngeal swabs	https://www.perkinelmer.com/
SARS-CoV-2 One-Step RT-PCR Kit, RdRp and N Genes, CE-IVD	NZYTech	Portugal	Nasal swab, nasopharyngeal swab, nasal wash/aspirate, and BAL specimens	https://www.nzytech.com/products-services/molecular-diagnostics/sars-cov-2/sars-cov-2-one-step-rt-pcr-kit-rdrp-and-n-genes-ce-ivd/
COVID-19 TaqMan RT-PCR Kit (E/RdRP genes) Dx	Norgen Biotek Corp	Canada	Saliva & Swab Samples	https://norgenbiotek.com/

Table 5.

RT-PCR kits developed by International companies and sample requirement.

8. Future prospects of RT-PCR

PCR method was discovered in 1986 and since then the method is serving medical sectors. In the future, as potential molecular diagnostic methods, PCR will play a significant role. Lots of PCR methods are already used in various research and medical fields, but as we know currently under this pandemic situation RT-PCR has turned out to be a boon in healthcare sectors. Lots of kits have been manufactured throughout the world with some or little variation, thus making it more sensitive, specific and less time consuming. One factor which essential under pandemic situation was a multiple sample analysis in one go [5]. Thus more focus on using portable POC systems, we can imagine the use of micro-fluidics doing concurrent multiple sample analysis. It is possible to analyse immunomagnetic exosomal RNA by using micro-fluidic systems RT-PCR said to be a Chip-based integrated real-time reverse transcription PCR platform [70]. Similar way chip-based RT-PCR digitally can quantify the mRNA in single cell [71].

Scalable, quick, and inexpensive diagnostics of COVID-19 by RT-PCR could help restrict the spread of SARS-CoV-2, saving lives as a result. RNA extraction, however, constitutes an obstacle to the scale-up of experiments. Thus, one research was done directly using the RT-PCR and heat inactivated sample and efficacy was tested. The study proved that is not necessary to carry RNA extraction testing. The study also suggests the use of standard protocols for RT-PCR and transport media by the whole world so the it will become easier to deal with future epidemics. Such RT-PCR said to be an hid RT-PCR (heat-inactivated direct RT-PCR). Sample collection and rather than using transport media, usage of lysis buffer is found to be more efficient as it will directly lys the sample and can be used in RT-PCR without a need of any RNA extraction kit [72].

As Coronaviridae family consist many RNA viruses which not only infect the humans but also animals, birds etc. [73]. If we look at the history of this family will see that it has been always serious when it started infecting like in 2002, Severe acute respiratory syndrome coronavirus (SARS-CoV) emerged, in 2012, Middle East respiratory syndrome coronavirus (MERS-CoV), in 2016, swine acute diarrhoea syndrome coronavirus (SADS-CoV) and the latest one which cause pandemic in 2019, severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) [74]. Among this SADS-CoV infects pigs while other infect humans [75]. This all was controlled well but current 2019 epidemic was beyond control due to lack of diagnosis, medicines and vaccine. For now after all efforts diagnosis for SARS-CoV-2 has been found but as lots of virus under this family can emerge in future and which has already spread in past needed to be studied [76]. So one research was completely done to make a molecular diagnostic kit which can identify almost all CoVs, thus to diagnose easily any virus among this family in future [77]. They designed a semi-nested RT-PCR based upon 38 genome sequences that has been recorded from human and animal CoVs. Thus proved to be a great finding which can diagnose all available CoVs or which can emerge in future too [77].

Lots of research regarding RT-PCR has been done, PCR like nested PCR, ddPCR, two step RT-PCR is an advance and gives more accurate results but labs were not that equipped and it was not possible to set up everything under such pandemic situation. Hence if we think about future this all equipments and facilities have to be adopted by laboratory to deal with emerging epidemics [57].

9. Conclusion

SARs-CoV-2, originated from Wuhan, China and spread all over world, causing a pandemic situation which affected the whole world badly at economic, social, medical level also. Initially it was very difficult to deal with virus as no diagnosis, treatment or vaccine was available, but after lots of efforts of researchers now we have a good diagnosis and control condition in regards spread of infection. Even vaccination has been started in almost all countries. As in the earlier period of pandemic, the diagnosis was the main factor to prevent the spread of the virus. So main focus was on a diagnostic that to on molecular diagnosis as it is more efficient and accurate way of detection. Currently use molecular method is RT-PCR also said to be a gold standard detection method. Lots of RT-PCR kits are now available in most of the countries with little modifications and approvals. The key point to be noticed before the laboratory experiments is the right reliable sampling. Nasopharyngeal and oropharyngeal swabs, which are safer for collection are recommended for screening or early detection. If we talk about a future of RT-PCR advancement in methods like nested PCR, ddPCR, two step RT-PCR have been already done, which is found to be more accurate, but lack of instrumentation and expertise have put it behind, but in future this thing has to be focused and implemented so that the world can deal with any future epidemic.