Samples of the studied taxa of Asteraceae.
\\n\\n
Released this past November, the list is based on data collected from the Web of Science and highlights some of the world’s most influential scientific minds by naming the researchers whose publications over the previous decade have included a high number of Highly Cited Papers placing them among the top 1% most-cited.
\\n\\nWe wish to congratulate all of the researchers named and especially our authors on this amazing accomplishment! We are happy and proud to share in their success!
Note: Edited in March 2021
\\n"}]',published:!0,mainMedia:{caption:"Highly Cited",originalUrl:"/media/original/117"}},components:[{type:"htmlEditorComponent",content:'IntechOpen is proud to announce that 191 of our authors have made the Clarivate™ Highly Cited Researchers List for 2020, ranking them among the top 1% most-cited.
\n\nThroughout the years, the list has named a total of 261 IntechOpen authors as Highly Cited. Of those researchers, 69 have been featured on the list multiple times.
\n\n\n\nReleased this past November, the list is based on data collected from the Web of Science and highlights some of the world’s most influential scientific minds by naming the researchers whose publications over the previous decade have included a high number of Highly Cited Papers placing them among the top 1% most-cited.
\n\nWe wish to congratulate all of the researchers named and especially our authors on this amazing accomplishment! We are happy and proud to share in their success!
Note: Edited in March 2021
\n'}],latestNews:[{slug:"webinar-introduction-to-open-science-wednesday-18-may-1-pm-cest-20220518",title:"Webinar: Introduction to Open Science | Wednesday 18 May, 1 PM CEST"},{slug:"step-in-the-right-direction-intechopen-launches-a-portfolio-of-open-science-journals-20220414",title:"Step in the Right Direction: IntechOpen Launches a Portfolio of Open Science Journals"},{slug:"let-s-meet-at-london-book-fair-5-7-april-2022-olympia-london-20220321",title:"Let’s meet at London Book Fair, 5-7 April 2022, Olympia London"},{slug:"50-books-published-as-part-of-intechopen-and-knowledge-unlatched-ku-collaboration-20220316",title:"50 Books published as part of IntechOpen and Knowledge Unlatched (KU) Collaboration"},{slug:"intechopen-joins-the-united-nations-sustainable-development-goals-publishers-compact-20221702",title:"IntechOpen joins the United Nations Sustainable Development Goals Publishers Compact"},{slug:"intechopen-signs-exclusive-representation-agreement-with-lsr-libros-servicios-y-representaciones-s-a-de-c-v-20211123",title:"IntechOpen Signs Exclusive Representation Agreement with LSR Libros Servicios y Representaciones S.A. de C.V"},{slug:"intechopen-expands-partnership-with-research4life-20211110",title:"IntechOpen Expands Partnership with Research4Life"},{slug:"introducing-intechopen-book-series-a-new-publishing-format-for-oa-books-20210915",title:"Introducing IntechOpen Book Series - A New Publishing Format for OA Books"}]},book:{item:{type:"book",id:"6088",leadTitle:null,fullTitle:"Numerical Simulations in Engineering and Science",title:"Numerical Simulations in Engineering and Science",subtitle:null,reviewType:"peer-reviewed",abstract:"Computational science is one of the rapidly growing multidisciplinary fields. The high-performance computing capabilities are utilized to solve and understand complex problems. This book offers a detailed exposition of the numerical methods that are used in engineering and science. The chapters are arranged in such a way that the readers will be able to select the topics appropriate to their interest and need. The text features a broad array of applications of computational methods to science and technology. This book would be an interesting supplement for the practicing engineers, scientists, and graduate students.",isbn:"978-1-78923-451-0",printIsbn:"978-1-78923-450-3",pdfIsbn:"978-1-83881-283-6",doi:"10.5772/68125",price:139,priceEur:155,priceUsd:179,slug:"numerical-simulations-in-engineering-and-science",numberOfPages:404,isOpenForSubmission:!1,isInWos:null,isInBkci:!1,hash:"11db426df2f9acb7bb603b8a21d75049",bookSignature:"Srinivas P. Rao",publishedDate:"July 11th 2018",coverURL:"https://cdn.intechopen.com/books/images_new/6088.jpg",numberOfDownloads:18508,numberOfWosCitations:20,numberOfCrossrefCitations:20,numberOfCrossrefCitationsByBook:0,numberOfDimensionsCitations:36,numberOfDimensionsCitationsByBook:1,hasAltmetrics:1,numberOfTotalCitations:76,isAvailableForWebshopOrdering:!0,dateEndFirstStepPublish:"March 7th 2017",dateEndSecondStepPublish:"March 28th 2017",dateEndThirdStepPublish:"September 23rd 2017",dateEndFourthStepPublish:"October 23rd 2017",dateEndFifthStepPublish:"December 23rd 2017",currentStepOfPublishingProcess:5,indexedIn:"1,2,3,4,5,6,7",editedByType:"Edited by",kuFlag:!1,featuredMarkup:null,editors:[{id:"6897",title:"Dr.",name:"Srinivasa",middleName:"P",surname:"Rao",slug:"srinivasa-rao",fullName:"Srinivasa Rao",profilePictureURL:"https://mts.intechopen.com/storage/users/6897/images/system/6897.jpeg",biography:"Dr. P. Srinivasa Rao is presently working as a Professor and Head of the Department of Mechanical Engineering at Vardhaman College Engineering, Hyderabad. Dr. Rao earned his Ph.D. in Computational Fluid Dynamics (CFD) and IC Engine Combustion. He worked as a scientist in the Computational Fluid Dynamics division of the Scientific Engineering and Computing Group (SECG) at the Centre for Development of Advanced Computing (C-DAC), Pune. Dr. Rao has over 60 publications in refereed international journals and conferences and is an inventor of 4 patents. He acted as a facilitator for the learning process and organized 16 workshops/FDPs/SDPs, 3 international conferences, and 2 national conferences beneficial to faculty, researchers and industry and delivered 32 plenaries, keynote speeches, and invited talks. Dr. Rao has taught over 32 courses on CFD, turbulence modeling, and combustion. He has advised 4 doctoral research fellows and has been a research visitor for 39 graduate students. He has been the editor of international scientific journals and a reviewer for more than twenty journals from Asia, Europe, and the USA of repute like SAE. Dr. Rao’s research has involved applications of the CFD to the problems of mechanical and aerospace systems, computational physics, and turbulence modeling including biology and medicine.",institutionString:"Vardhaman College of Engineering",position:null,outsideEditionCount:0,totalCites:0,totalAuthoredChapters:"2",totalChapterViews:"0",totalEditedBooks:"2",institution:null}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,coeditorOne:null,coeditorTwo:null,coeditorThree:null,coeditorFour:null,coeditorFive:null,topics:[{id:"599",title:"Computer Simulation",slug:"numerical-analysis-and-scientific-computing-computer-simulation"}],chapters:[{id:"57308",title:"The Global Numerical Model of the Earth’s Upper Atmosphere",doi:"10.5772/intechopen.71139",slug:"the-global-numerical-model-of-the-earth-s-upper-atmosphere",totalDownloads:877,totalCrossrefCites:1,totalDimensionsCites:1,hasAltmetrics:0,abstract:"The global numerical first principle 3D model of the upper atmosphere (UAM) for the heights 60–100,000 km is presented. The physical continuity, motion, heat balance and electric potential equations for the neutral, ion and electron gases and their numerical solution method are described. The numerical grids, spatial and time integration steps are given together with the boundary and initial conditions and inputs. Testing and obtained geophysical results are given for many observed situations at various levels of solar, geomagnetic and seismic activity.",signatures:"Namgaladze Aleksandr, Knyazeva Maria, Karpov Mikhail, Zolotov\nOleg, Martynenko Oleg, Yurik Roman, Foerster Matthias and\nProkhorov Boris",downloadPdfUrl:"/chapter/pdf-download/57308",previewPdfUrl:"/chapter/pdf-preview/57308",authors:[{id:"207504",title:"Prof.",name:"Aleksandr",surname:"Namgaladze",slug:"aleksandr-namgaladze",fullName:"Aleksandr Namgaladze"},{id:"207508",title:"Dr.",name:"Maria",surname:"Knyazeva",slug:"maria-knyazeva",fullName:"Maria Knyazeva"},{id:"207510",title:"Dr.",name:"Mikhail",surname:"Karpov",slug:"mikhail-karpov",fullName:"Mikhail Karpov"},{id:"207514",title:"Dr.",name:"Oleg",surname:"Zolotov",slug:"oleg-zolotov",fullName:"Oleg Zolotov"},{id:"207515",title:"Dr.",name:"Roman",surname:"Yurik",slug:"roman-yurik",fullName:"Roman Yurik"},{id:"207516",title:"Dr.",name:"Matthias",surname:"Foerster",slug:"matthias-foerster",fullName:"Matthias Foerster"},{id:"207521",title:"Dr.",name:"Boris",surname:"Prokhorov",slug:"boris-prokhorov",fullName:"Boris Prokhorov"},{id:"207523",title:"Dr.",name:"Oleg",surname:"Martynenko",slug:"oleg-martynenko",fullName:"Oleg Martynenko"}],corrections:null},{id:"60092",title:"Numerical Simulation of Electronic Systems Based on Circuit- Block Partitioning Strategies",doi:"10.5772/intechopen.75490",slug:"numerical-simulation-of-electronic-systems-based-on-circuit-block-partitioning-strategies",totalDownloads:921,totalCrossrefCites:0,totalDimensionsCites:0,hasAltmetrics:0,abstract:"Numerical simulation of complex and heterogeneous electronic systems can be a very challenging issue. Circuits composed of a combination of analog, mixed-signal and digital blocks or even radio frequency (RF) blocks, integrated in the same substrate, are very difficult to simulate as a whole at the circuit level. The main reason is because they contain a lot of state variables presenting very distinct properties and evolving in very widely separated time scales. Examples of practical interest are systems-on-a-chip (SoCs), very common in mobile electronics applications, as well as in many other embedded electronic systems. This chapter is intended to briefly review some advanced circuit-level numerical simulation techniques based on circuit-block partitioning schemes, which were especially designed to address the simulation challenges brought by this kind of circuits into the computer-aided-design (CAD) field.",signatures:"Jorge dos Santos Freitas de Oliveira",downloadPdfUrl:"/chapter/pdf-download/60092",previewPdfUrl:"/chapter/pdf-preview/60092",authors:[{id:"180088",title:"Prof.",name:"Jorge",surname:"Oliveira",slug:"jorge-oliveira",fullName:"Jorge Oliveira"}],corrections:null},{id:"57443",title:"Numerical Simulation of Fission Product Behavior Inside the Reactor Containment Building Using MATLAB",doi:"10.5772/intechopen.70706",slug:"numerical-simulation-of-fission-product-behavior-inside-the-reactor-containment-building-using-matla",totalDownloads:1002,totalCrossrefCites:0,totalDimensionsCites:0,hasAltmetrics:0,abstract:"The aim of this work is to carry out the numerical simulation of fission product (FP) behavior inside the reactor building under loss of coolant accident (LOCA) using MATLAB. For this purpose, a kinetic model has been developed and implemented in MATLAB to study the behavior of in-containment FPs during postulated LOCA for typical 1000 MW pressurized water reactor (PWR). A continuous release of the FPs from the reactor pressure vessel (RPV) has been implemented with coolant retention. The in-containment FP behavior is influenced by containment atmosphere and containment safety systems. The sensitivity analysis and removal rate of airborne isotopes with the containment spray system have been studied for various spray activation time, spray failure time, droplet size and spray pH value. The droplet size and pH value of the spray system effectively remove the airborne isotopes. The alkaline (sodium thiosulfate, Na2S2O3) spray solution and spray with pH 9.5 have similar scrubbing properties for iodine. However, the removal rate from the containment spray system has been found an approximately inverse square of droplet diameter (1/d2).",signatures:"Khurram Mehboob and Mohammad Subian Aljohani",downloadPdfUrl:"/chapter/pdf-download/57443",previewPdfUrl:"/chapter/pdf-preview/57443",authors:[{id:"179439",title:"Dr.",name:"Khurram",surname:"Mehboob",slug:"khurram-mehboob",fullName:"Khurram Mehboob"},{id:"219212",title:"Dr.",name:"Mohammad",surname:"Aljohani",slug:"mohammad-aljohani",fullName:"Mohammad Aljohani"}],corrections:null},{id:"60679",title:"Study of the Numerical Diffusion in Computational Calculations",doi:"10.5772/intechopen.75660",slug:"study-of-the-numerical-diffusion-in-computational-calculations",totalDownloads:1052,totalCrossrefCites:0,totalDimensionsCites:0,hasAltmetrics:0,abstract:"The numerical simulation of fluid flow and heat/mass-transfer phenomena requires the numerical solution of the Navier-Stokes and energy-conservation equations coupled with the continuity equation. Numerical or false diffusion is the phenomenon of inserting errors in the calculations that compromise the accuracy of the computational solution. The Taylor series analysis that reveals the truncation/discretization errors of the differential equations terms should not be termed as false diffusion. Numerical diffusion appears in multi-dimensional flows when the differencing scheme fails to account for the true direction of the flow. Numerical errors associated with false diffusion are investigated via two- and three-dimensional problems. A numerical scheme must satisfy necessary criteria for the successful solution of the convection-diffusion formulations. The common practice of approximating the diffusion terms via the central-difference approximation is satisfactory. Attention is directed to the convection terms since these approximations induce false diffusion. The equations of all the conservation equations in this study are discretized by the finite volume method.",signatures:"Despoina P. Karadimou and Nikos-Christos Markatos",downloadPdfUrl:"/chapter/pdf-download/60679",previewPdfUrl:"/chapter/pdf-preview/60679",authors:[{id:"220427",title:"Dr.",name:"Despoina",surname:"Karadimou",slug:"despoina-karadimou",fullName:"Despoina Karadimou"},{id:"223243",title:"Prof.",name:"Nicolas",surname:"Markatos",slug:"nicolas-markatos",fullName:"Nicolas Markatos"}],corrections:null},{id:"57466",title:"Simulation of Natural Convection in Porous Media by Boundary Element Method",doi:"10.5772/intechopen.71230",slug:"simulation-of-natural-convection-in-porous-media-by-boundary-element-method",totalDownloads:1041,totalCrossrefCites:0,totalDimensionsCites:0,hasAltmetrics:0,abstract:"In this chapter, the boundary element method (BEM) is introduced for solving problems of transport phenomena in porous media domains, which is an important topic in many engineering and scientific branches as well as in fields of practical interest. The main objective of the present work is to find a numerical solution of the governing set of equations written for fluid flow in porous media domains, representing conservation of mass, momentum, and energy. The momentum equation is based on the macroscopic Navier-Stokes equations and is coupled with the energy equation. In order to use BEM for the solution of the obtained set, the governing equations are transformed by the velocity-vorticity formulation, which separates the computational scheme into kinematic and kinetic computational parts. A combination of single- and sub-domain BEM is used to solve the obtained set of partial differential equations. Solution to a problem of natural convection in porous media saturated with pure fluid and nanofluid, respectively, for examples of 2D and 3D geometries, is shown. Results are compared to published work in order to estimate the accuracy of developed numerical algorithm. Based on the results, the applicability of the BEM for solving wide range of various problems is stated.",signatures:"Janja Kramer Stajnko, Renata Jecl and Jure Ravnik",downloadPdfUrl:"/chapter/pdf-download/57466",previewPdfUrl:"/chapter/pdf-preview/57466",authors:[{id:"220494",title:"Dr.",name:"Janja",surname:"Kramer Stajnko",slug:"janja-kramer-stajnko",fullName:"Janja Kramer Stajnko"},{id:"222673",title:"Prof.",name:"Renata",surname:"Jecl",slug:"renata-jecl",fullName:"Renata Jecl"},{id:"222674",title:"Prof.",name:"Jure",surname:"Ravnik",slug:"jure-ravnik",fullName:"Jure Ravnik"}],corrections:null},{id:"58947",title:"Numerical Simulations of a High-Resolution RANS-FVDM Scheme for the Design of a Gas Turbine Centrifugal Compressor",doi:"10.5772/intechopen.72098",slug:"numerical-simulations-of-a-high-resolution-rans-fvdm-scheme-for-the-design-of-a-gas-turbine-centrifu",totalDownloads:788,totalCrossrefCites:0,totalDimensionsCites:0,hasAltmetrics:0,abstract:"The aero-thermodynamic design and performance of a compressor need to conquer many vital challenges like it is a gas-driven turbo-machinery component, involvement of extensive iterative process for the convergence of the design, enormous design complexity due to three-dimensional flow phenomena, and multiflow physics embedded within a dynamic state-of-the-art. In this chapter, a strong attempt is made to address the above-cited technical issues to achieve an optimized design and performance of a centrifugal compressor with backward swept blade profile producing total pressure ratio of 5.4 with an ingested mass flow rate of 5.73 kg/s. A mean-line design methodology was implemented to configure sizing of the compressor. An optimum grid size was well validated by carrying out computational analysis with three different mesh sizes within the same framework. Finally, a detailed three-dimensional numerical simulation was performed using Reynolds-averaged Navier-Stokes equations based on finite volume discretization method (RANS-FVDM) scheme. Consequently, the polytropic efficiency, total-to-total efficiency, stagnation pressure ratio at a fixed rotational speed, and the overall design and aero-thermodynamic performance of the centrifugal compressor are validated.",signatures:"Chellapilla V K N S N Moorthy and Vadapalli Srinivas",downloadPdfUrl:"/chapter/pdf-download/58947",previewPdfUrl:"/chapter/pdf-preview/58947",authors:[{id:"221828",title:"Dr.",name:".",surname:"Ch V K N S N Moorthy",slug:".-ch-v-k-n-s-n-moorthy",fullName:". Ch V K N S N Moorthy"},{id:"222474",title:"Dr.",name:"V Srinivas",surname:".",slug:"v-srinivas-.",fullName:"V Srinivas ."}],corrections:null},{id:"57564",title:"Susceptibility of Group-IV and III-V Semiconductor-Based Electronics to Atmospheric Neutrons Explored by Geant4 Numerical Simulations",doi:"10.5772/intechopen.71528",slug:"susceptibility-of-group-iv-and-iii-v-semiconductor-based-electronics-to-atmospheric-neutrons-explore",totalDownloads:930,totalCrossrefCites:5,totalDimensionsCites:10,hasAltmetrics:1,abstract:"New semiconductor materials are envisaged in numerous high-performance applications for which the expected device or circuit performances cannot be achieved with silicon. In this context of growing use of new and specific semiconductors, the question of their susceptibility to natural radiation, primarily to atmospheric neutrons, is posed for high-reliability-level application domains. This numerical simulation work precisely examines nuclear events resulting from the interaction of atmospheric neutrons at the terrestrial level with a target layer composed of various group-IV and III-V semiconductor materials including silicon, germanium, silicon carbide, carbon-diamond, gallium arsenide, and gallium nitride materials. Using extensive Geant4 simulations and in-depth data analysis, this study provides an accurate and fine comparison between the neutron interaction responses of these different semiconductors in terms of nuclear processes, recoil products, secondary ion production, and fragment energy distributions. Implications of these results on the rate of single-event transient effects at the device or circuit level are also discussed.",signatures:"Daniela Munteanu and Jean-Luc Autran",downloadPdfUrl:"/chapter/pdf-download/57564",previewPdfUrl:"/chapter/pdf-preview/57564",authors:[{id:"14152",title:"Prof.",name:"Jean-Luc",surname:"Autran",slug:"jean-luc-autran",fullName:"Jean-Luc Autran"},{id:"14602",title:"Dr.",name:"Daniela",surname:"Munteanu",slug:"daniela-munteanu",fullName:"Daniela Munteanu"}],corrections:null},{id:"59245",title:"Ultrashort Pulse Generation in Ce:LiCAF Ultraviolet Laser",doi:"10.5772/intechopen.73501",slug:"ultrashort-pulse-generation-in-ce-licaf-ultraviolet-laser",totalDownloads:842,totalCrossrefCites:0,totalDimensionsCites:1,hasAltmetrics:0,abstract:"Transient cavity method used to generate ultrashort laser pulses in dye lasers is extended to a solid-state gain medium. Numerical simulations are performed to investigate the spectro-temporal evolution of broadband ultraviolet (UV) laser emission from Ce3+-doped LiCaAlF6 (Ce:LiCAF), which is represented as a system of two homogeneous broadened singlet states. By solving the rate equations extended to multiple wavelengths, the appropriate cavity length and Q-factor for optimal photon cavity decay time and pumping energy that will generate resonator transients is determined. Formation of resonator transients could generate picosecond UV laser pulses from a Ce:LiCAF crystal pumped by the fourth harmonics (266 nm) of a Nd:YAG laser. Numerical simulations indicate that a 1-mol% Ce3+-doped LiCAF crystal that is 1-mm long can generate a single picosecond pulse. This is accomplished by using a low Q (output coupler reflectivity of 10%), short cavity (cavity length of 2 mm) laser oscillator. Ultrashort pulses can also be generated using other rare earth-doped fluoride laser materials using this technique.",signatures:"Marilou Cadatal-Raduban, Minh Hong Pham, Luong Viet Mui,\nNguyen Dai Hung and Nobuhiko Sarukura",downloadPdfUrl:"/chapter/pdf-download/59245",previewPdfUrl:"/chapter/pdf-preview/59245",authors:[{id:"27822",title:"Prof.",name:"Nobuhiko",surname:"Sarukura",slug:"nobuhiko-sarukura",fullName:"Nobuhiko Sarukura"},{id:"216224",title:"Dr.",name:"Marilou",surname:"Cadatal-Raduban",slug:"marilou-cadatal-raduban",fullName:"Marilou Cadatal-Raduban"},{id:"221003",title:"Dr.",name:"Pham Hong",surname:"Minh",slug:"pham-hong-minh",fullName:"Pham Hong Minh"},{id:"221004",title:"Dr.",name:"Luong Viet",surname:"Mui",slug:"luong-viet-mui",fullName:"Luong Viet Mui"},{id:"222356",title:"Prof.",name:"Nguyen Dai",surname:"Hung",slug:"nguyen-dai-hung",fullName:"Nguyen Dai Hung"}],corrections:null},{id:"58079",title:"Exact Finite Differences for Quantum Mechanics",doi:"10.5772/intechopen.71956",slug:"exact-finite-differences-for-quantum-mechanics",totalDownloads:830,totalCrossrefCites:0,totalDimensionsCites:1,hasAltmetrics:0,abstract:"We introduce a finite difference derivative, on a non-uniform partition, with the characteristic that the derivative of the exponential function is the exponential function itself, times a constant, which is similar to what happens in the continuous variable case. Aside from its application to perform numerical computations, this is particularly useful in defining a quantum mechanical discrete momentum operator.",signatures:"Armando Martínez-Pérez and Gabino Torres-Vega",downloadPdfUrl:"/chapter/pdf-download/58079",previewPdfUrl:"/chapter/pdf-preview/58079",authors:[{id:"93519",title:"Dr.",name:"Gabino",surname:"Torres-Vega",slug:"gabino-torres-vega",fullName:"Gabino Torres-Vega"},{id:"219225",title:"MSc.",name:"Armando",surname:"Martínez-Pérez",slug:"armando-martinez-perez",fullName:"Armando Martínez-Pérez"}],corrections:null},{id:"60128",title:"Twin-Grating Fiber Optic Sensors Applied on Wavelength- Division Multiplexing and Its Numerical Resolution",doi:"10.5772/intechopen.75586",slug:"twin-grating-fiber-optic-sensors-applied-on-wavelength-division-multiplexing-and-its-numerical-resol",totalDownloads:902,totalCrossrefCites:1,totalDimensionsCites:1,hasAltmetrics:0,abstract:"In this work, the twin-grating fiber optic sensor has been applied on wavelength-division multiplexing. A quasi-distributed sensor formed by three local twin-grating sensors, is numerically simulated. The wavelength channels were 1531.5, 1535.5, and 1539.5 nm. The numerical simulation shows the resolution vs. signal-to-noise rate. Three local twin-grating sensors have approximately the same resolution because all local sensors have the same cavity length and the wavelength channels are very close. All local sensors have two numerical resolutions because the Fourier domain phase analysis algorithm makes two evaluations of the Bragg wavelength shift. The transition between both resolutions can be calculated with the parameters: cavity length, Bragg wavelength channel, refraction index, and enveloped resolution. This transition depends on the noise system, demodulation algorithm, instrumentation, and local sensor properties. A very important point is, a theoretical analysis will permit to know the exact resolution for each local twin-grating sensor.",signatures:"José Trinidad Guillen Bonilla, Héctor Guillen Bonilla, Antonio\nCasillas Zamora, Gustavo Adolfo Vega Gómez, Nancy Elizabeth\nFranco Rodríguez, Alex Guillen Bonilla and Juan Reyes Gómez",downloadPdfUrl:"/chapter/pdf-download/60128",previewPdfUrl:"/chapter/pdf-preview/60128",authors:[{id:"85834",title:"Dr.",name:"Juan",surname:"Reyes",slug:"juan-reyes",fullName:"Juan Reyes"},{id:"196421",title:"Dr.",name:"Héctor",surname:"Guillén-Bonilla",slug:"hector-guillen-bonilla",fullName:"Héctor Guillén-Bonilla"},{id:"220284",title:"Ph.D.",name:"José Trinidad",surname:"Guillen Bonilla",slug:"jose-trinidad-guillen-bonilla",fullName:"José Trinidad Guillen Bonilla"},{id:"222315",title:"MSc.",name:"Antonio",surname:"Casillas Zamora",slug:"antonio-casillas-zamora",fullName:"Antonio Casillas Zamora"},{id:"222316",title:"MSc.",name:"Gustavo Adolfo",surname:"Vega Gómez",slug:"gustavo-adolfo-vega-gomez",fullName:"Gustavo Adolfo Vega Gómez"},{id:"222317",title:"Dr.",name:"Nancy Elizabeth",surname:"Franco Rodríguez",slug:"nancy-elizabeth-franco-rodriguez",fullName:"Nancy Elizabeth Franco Rodríguez"},{id:"222318",title:"Dr.",name:"Alex",surname:"Guillen Bonilla",slug:"alex-guillen-bonilla",fullName:"Alex Guillen Bonilla"}],corrections:null},{id:"61690",title:"Numerical Modeling of Chemical Compounds’ Fate and Kinetics in Living Organisms: An Inverse Numerical Method for Rate Estimation from Concentration",doi:"10.5772/intechopen.76611",slug:"numerical-modeling-of-chemical-compounds-fate-and-kinetics-in-living-organisms-an-inverse-numerical-",totalDownloads:871,totalCrossrefCites:0,totalDimensionsCites:0,hasAltmetrics:0,abstract:"Emerging chemical compounds are ubiquitous in all environmental compartments and may pose a risk to biota ecosystems. The quantification and prediction of environmental partitioning of these chemicals in various environmental compartment systems (water, sediments, soil, air, biota) is an important step in the comprehensive assessment of their sources, fates, and not finally of their uptake potential by various living organisms of ecosystems.",signatures:"Kovacs Emoke Dalma and Kovacs Melinda Haydee",downloadPdfUrl:"/chapter/pdf-download/61690",previewPdfUrl:"/chapter/pdf-preview/61690",authors:[{id:"197543",title:"Dr.",name:"Melinda",surname:"Kovacs",slug:"melinda-kovacs",fullName:"Melinda Kovacs"},{id:"199573",title:"MSc.",name:"Emoke Dalma",surname:"Kovacs",slug:"emoke-dalma-kovacs",fullName:"Emoke Dalma Kovacs"}],corrections:null},{id:"61648",title:"Benchmarks for Non-Ideal Magnetohydrodynamics",doi:"10.5772/intechopen.75713",slug:"benchmarks-for-non-ideal-magnetohydrodynamics",totalDownloads:1004,totalCrossrefCites:0,totalDimensionsCites:0,hasAltmetrics:0,abstract:"The paper presents an overview of benchmarks for non-ideal magnetohydrodynamics. These benchmarks include dissipative processes in the form of heat conduction, magnetic diffusion, and the Hall effect.",signatures:"Sofronov Vasily, Zhmailo Vadim and Yanilkin Yury",downloadPdfUrl:"/chapter/pdf-download/61648",previewPdfUrl:"/chapter/pdf-preview/61648",authors:[{id:"181004",title:"Prof.",name:"Yury",surname:"Yanilkin",slug:"yury-yanilkin",fullName:"Yury Yanilkin"},{id:"208276",title:"Dr.",name:"Vasiliy",surname:"Sofronov",slug:"vasiliy-sofronov",fullName:"Vasiliy Sofronov"},{id:"258681",title:"Dr.",name:"Zhmailo",surname:"Vadim",slug:"zhmailo-vadim",fullName:"Zhmailo Vadim"}],corrections:null},{id:"57222",title:"A Numerical Simulation of the Shallow Water Flow on a Complex Topography",doi:"10.5772/intechopen.71026",slug:"a-numerical-simulation-of-the-shallow-water-flow-on-a-complex-topography",totalDownloads:1036,totalCrossrefCites:5,totalDimensionsCites:8,hasAltmetrics:0,abstract:"In current chapter, we have thoroughly described a numerical integration scheme of nonstationary 2D equations of shallow water. The scheme combines the smoothed particle hydrodynamics (SPH) and the total variation diminishing (TVD) methods, which are sequentially used at various steps of the combined SPH-TVD algorithm. The method is conservative and well balanced. It provides stable through calculations in presence of nonstationary “water-dry bottom” boundaries on complex irregular bottom topography including the transition of such a boundary between wet and dry bottom through the computational boundary. Multifarious tests demonstrate the effectiveness of the combined SPH-TVD scheme application for a solution of diverse problems of the engineering hydrology.",signatures:"Alexander Khoperskov and Sergey Khrapov",downloadPdfUrl:"/chapter/pdf-download/57222",previewPdfUrl:"/chapter/pdf-preview/57222",authors:[{id:"206590",title:"Prof.",name:"Alexander",surname:"Khoperskov",slug:"alexander-khoperskov",fullName:"Alexander Khoperskov"},{id:"207663",title:"Dr.",name:"Sergey",surname:"Khrapov",slug:"sergey-khrapov",fullName:"Sergey Khrapov"}],corrections:null},{id:"57207",title:"Failure Analysis of a High-Pressure Natural Gas Heat Exchanger and its Modified Design",doi:"10.5772/intechopen.71202",slug:"failure-analysis-of-a-high-pressure-natural-gas-heat-exchanger-and-its-modified-design",totalDownloads:865,totalCrossrefCites:0,totalDimensionsCites:0,hasAltmetrics:0,abstract:"The beauty of numerical simulations is its ability to reveal the physics or nature of practical engineering problems in detail, and then, to identify adequate solutions. In this chapter, an excellent example is demonstrated. The rupture of a heavy-duty, high-pressure natural gas heat exchanger is numerically investigated, and the importance of gravity effect is identified, which is often considered as a trivial factor. For the original design, the natural convection in the flow field of the heat exchanger is comparable with the forced convection at the designed operating conditions. These two convections are perpendicular and compete with each other, the flow field is highly unsteady, and high-temperature natural gas is trapped in the upper portion of the vessel, which causes the damage of the exchanger. By vertically mounting the exchanger assembly and locating the outlet pipe on top of the exchanger, the flow parameters become rather uniform at each vertical cross section and the wall temperature of the heat exchanger remains more or less the same as the heated natural gas. The proposed design has been successfully used up to now.",signatures:"Lei-Yong Jiang, Yinghua Han, Michele Capurro and Mike Benner",downloadPdfUrl:"/chapter/pdf-download/57207",previewPdfUrl:"/chapter/pdf-preview/57207",authors:[{id:"197918",title:"Dr.",name:"Lei-Yong",surname:"Jiang",slug:"lei-yong-jiang",fullName:"Lei-Yong Jiang"}],corrections:null},{id:"57262",title:"Numerical Simulation of Nanoparticles with Variable Viscosity over a Stretching Sheet",doi:"10.5772/intechopen.71224",slug:"numerical-simulation-of-nanoparticles-with-variable-viscosity-over-a-stretching-sheet",totalDownloads:1045,totalCrossrefCites:3,totalDimensionsCites:6,hasAltmetrics:0,abstract:"The effects of different types of base fluids on carbon nanotube (CNT) nanofluids flow over a circular stretching sheet are numerically analyzed. The nonlinear variation of radial velocity in radial direction is assumed at surface of stretching sheet. The temperature dependent fluid viscosity is taken into consideration. Two different types of flows (assisting flow and opposing flow) are discussed under the buoyant force effects. Single walled CNT and multi walled CNT are considered as nanoparticles for better thermal conductivity of the nanofluids. A set of similarity transformations to convert the partial differential equations into ordinary differential equations is hired. The non-linear ODEs are numerically solved by employing fourth order Runge-Kutta method. Discussions of numerical simulations for flow characteristics have been made appropriately. A comparative study for various type of base fluids like kerosene, engine oil and ethylene glycol is also presented. From the predicted simulation, it is observed that the variation in Nusselt number is maximum for engine oil and minimum for kerosene oil however, the variation in skin friction coefficient is largest for kerosene oil and least for engine oil. Furthermore, numerical results are also validated with achieving a good correlation with existing results.",signatures:"Noreen Sher Akbar, Dharmendra Tripathi and Zafar Hayat Khan",downloadPdfUrl:"/chapter/pdf-download/57262",previewPdfUrl:"/chapter/pdf-preview/57262",authors:[{id:"184401",title:"Dr.",name:"Noreen",surname:"Sher Akbar",slug:"noreen-sher-akbar",fullName:"Noreen Sher Akbar"},{id:"188538",title:"Dr.",name:"Z.H",surname:"Khan",slug:"z.h-khan",fullName:"Z.H Khan"},{id:"213081",title:"Dr.",name:"D",surname:"Tripathi",slug:"d-tripathi",fullName:"D Tripathi"}],corrections:null},{id:"60404",title:"Numerical Study of Turbulent Flows and Heat Transfer in Coupled Industrial-Scale Tundish of a Continuous Casting Material in Steel Production",doi:"10.5772/intechopen.75935",slug:"numerical-study-of-turbulent-flows-and-heat-transfer-in-coupled-industrial-scale-tundish-of-a-contin",totalDownloads:874,totalCrossrefCites:1,totalDimensionsCites:1,hasAltmetrics:0,abstract:"This chapter describes the numerical simulations of a coupled industrial scale of the tundish and continuous casting process. The governing equations are presented, and the numerical procedure is discussed in a common framework. The coupled solutions are presented for the transient turbulent flows within the tundish, solidifying zone and extracting regions with the coupling phenomena of heat and mass transfer. The tundish region flow and refractory are calculated using the inlet and outlet boundary conditions in order to estimate the filling phenomena. The transitions and cooling zones for the thin slab continuous casting process are designed to account for the control of the solidified skin in order to avoid breakout. We compared the numerical predictions of the temperatures with industrial monitoring data for a reference case in order to verify the consistence of the model predictions. A parallel version of the numerical code is proposed aiming to improve the computation time keeping numerical accuracy.",signatures:"Jose Adilson de Castro, Bruno Amaral Pereira, Roan Sampaio de\nSouza, Elizabeth Mendes de Oliveira and Ivaldo Leão Ferreira",downloadPdfUrl:"/chapter/pdf-download/60404",previewPdfUrl:"/chapter/pdf-preview/60404",authors:[{id:"219198",title:"Prof.",name:"José Adilson",surname:"de Castro",slug:"jose-adilson-de-castro",fullName:"José Adilson de Castro"},{id:"219201",title:"Dr.",name:"Bruno Amaral",surname:"Pereira",slug:"bruno-amaral-pereira",fullName:"Bruno Amaral Pereira"},{id:"219202",title:"MSc.",name:"Roan Sampaio",surname:"Souza",slug:"roan-sampaio-souza",fullName:"Roan Sampaio Souza"},{id:"219204",title:"Prof.",name:"Elizabeth Mendes",surname:"Oliveira",slug:"elizabeth-mendes-oliveira",fullName:"Elizabeth Mendes Oliveira"},{id:"225272",title:"Prof.",name:"Ivaldo",surname:"Leão Ferreira",slug:"ivaldo-leao-ferreira",fullName:"Ivaldo Leão Ferreira"}],corrections:null},{id:"57631",title:"Modeling of the Temperature Field in the Magnetic Hyperthermia",doi:"10.5772/intechopen.71364",slug:"modeling-of-the-temperature-field-in-the-magnetic-hyperthermia",totalDownloads:952,totalCrossrefCites:2,totalDimensionsCites:4,hasAltmetrics:0,abstract:"The numerical and/or analytical modeling of the temperature field developed by the magnetic systems in the external alternating magnetic fields is essential in the Magnetic Hyperthermia. Optimization of the all parameters involved in the burning process of the malignant tissues can be realized more efficiently using a mathematical model. The analytical models can be used for the validation of any numerical complex models of the heating processes. This work focuses on the parameters which influences the therapeutic temperature field developed by the magnetic systems within the malignant tissues when the magnetic field is applied. An analytical model was developed to predict and control the bioheat transport within a malignant tissue. This model was compared with a numerical model which was developed in the same conditions of the thermal analysis. Infusion of a diluted suspension of magnetic nanoparticles (MNP) into liver tissue was modeled using the Darcy’s equation. The MNP concentration and the temperature field were computed for different parameters as: (i) ferrofluid infusion rates, (ii) particle zeta potential and (iii) magnetic field parameters. The convection-diffusion-deposition of the particles within tissues was considered in this analysis. This study indicates the essential role of these parameters to predict accurately the hyperthermic temperature field. The model presented in this paper predicts the optimum MNP dosage and the temperature at every point within the malignant tissue.",signatures:"Iordana Astefanoaei and Alexandru Stancu",downloadPdfUrl:"/chapter/pdf-download/57631",previewPdfUrl:"/chapter/pdf-preview/57631",authors:[{id:"221694",title:"Dr.",name:"Iordana",surname:"Astefanoaei",slug:"iordana-astefanoaei",fullName:"Iordana Astefanoaei"},{id:"221701",title:"Prof.",name:"Alexandru",surname:"Stancu",slug:"alexandru-stancu",fullName:"Alexandru Stancu"}],corrections:null},{id:"57111",title:"Direct and Hybrid Aeroacoustic Simulations Around a Rectangular Cylinder",doi:"10.5772/intechopen.70810",slug:"direct-and-hybrid-aeroacoustic-simulations-around-a-rectangular-cylinder",totalDownloads:899,totalCrossrefCites:0,totalDimensionsCites:1,hasAltmetrics:0,abstract:"Aeroacoustic simulations are divided into hybrid and direct simulations. In this chapter, the effects of freestream Mach number on flow and acoustic fields around a two-dimensional square cylinder in a uniform flow are focused on using direct and hybrid simulations of flow and acoustic fields are performed. These results indicate the effectiveness and limit of the hybrid simulations. The Mach number M is varied from 0.2 to 0.6. The propagation angle of the acoustic waves for a high Mach number such as M = 0.6 greatly differs from that predicted by modified Curle’s equation, which assumes the scattered sound to be dominant and takes the Doppler effects into consideration. This is because the acoustic field is affected by the direct sound, which is generated by quadrupoles in the original Curle’s equation. To clarify the effects of the direct sound on the acoustic field, the scattered and direct sounds are decomposed. The results show that the direct sound is too intense to neglect for M ≥ 0.4. Moreover, acoustic simulations are performed using the Lighthill’s acoustic sources.",signatures:"Hiroshi Yokoyama and Akiyoshi Iida",downloadPdfUrl:"/chapter/pdf-download/57111",previewPdfUrl:"/chapter/pdf-preview/57111",authors:[{id:"207412",title:"Dr.",name:"Hiroshi",surname:"Yokoyama",slug:"hiroshi-yokoyama",fullName:"Hiroshi Yokoyama"},{id:"212456",title:"Prof.",name:"Akiyoshi",surname:"Iida",slug:"akiyoshi-iida",fullName:"Akiyoshi Iida"}],corrections:null},{id:"60320",title:"Analytical and Mathematical Analysis of the Vibration of Structural Systems Considering Geometric Stiffness and Viscoelasticity",doi:"10.5772/intechopen.75615",slug:"analytical-and-mathematical-analysis-of-the-vibration-of-structural-systems-considering-geometric-st",totalDownloads:904,totalCrossrefCites:2,totalDimensionsCites:2,hasAltmetrics:0,abstract:"For a complete analysis of vibration, the stiffness of a structure must have two characteristics: one corresponding to conventional stiffness and the other to the geometric stiffness. Thus, the total stiffness takes form where the model to be used to represent any behavior of the material is introduced to the first part via the modulus of elasticity. The second is the geometric stiffness, through which it is possible to linearize a geometric nonlinear problem. To consider both aspects, a mathematical model based on the Rayleigh method has been elaborated. Two systems were numerically studied. First, the occurrence of resonance in the vibration of a prestressed reinforced concrete beam has been investigated. The results indicated resonant and non-resonant schemes between the natural frequency of the beam and the frequency of the engine. To the second system, the first natural frequency of a slender, 40-m-high concrete mobile phone mast, was calculated, and an evaluation of the structural collapse was performed. To the both systems, the cross section of reinforced concrete was treated by the theory for the homogenized section in order to consider the presence of the steel, and the viscoelasticity of the concrete was taken into account through a three-parameter rheological model.",signatures:"Alexandre de M. Wahrhaftig, Reyolando M. L. R. F. Brasil and Lázaro\nS. M. S. C. Nascimento",downloadPdfUrl:"/chapter/pdf-download/60320",previewPdfUrl:"/chapter/pdf-preview/60320",authors:[{id:"224580",title:"Prof.",name:"Alexandre de Macêdo",surname:"Wahrhaftig",slug:"alexandre-de-macedo-wahrhaftig",fullName:"Alexandre de Macêdo Wahrhaftig"},{id:"224588",title:"Prof.",name:"Reyolando M. L. R. F.",surname:"Brasil",slug:"reyolando-m.-l.-r.-f.-brasil",fullName:"Reyolando M. L. R. F. Brasil"},{id:"230666",title:"BSc.",name:"Lázaro S. M. S. C.",surname:"Nascimento",slug:"lazaro-s.-m.-s.-c.-nascimento",fullName:"Lázaro S. M. S. C. Nascimento"}],corrections:null},{id:"58298",title:"Collapse Load for Thin-Walled Rectangular Tubes",doi:"10.5772/intechopen.71226",slug:"collapse-load-for-thin-walled-rectangular-tubes",totalDownloads:878,totalCrossrefCites:0,totalDimensionsCites:0,hasAltmetrics:0,abstract:"In this chapter, thin-walled rectangular tubes under pure bending are considered, by performing a series of FEM numerical studies. In the simulation, a homogeneous and isotropic elastic perfectly plastic material was employed for the tube material. A commonly used method for predicting the collapse load of rectangular tubes subjected to pure bending was proposed by Kecman. Kecman’s method focuses on a slenderness of the flange. When buckling occurs in the flange, this method uses a collapse load corresponding to the post buckling strength of the flange. When buckling does not occur at the flange, this method used a relation of the flange slenderness to the cross-sectional fully plastic yielding. This method for predicting the collapse loads is effective when the aspect ratio of web to flange is not large. However, for large aspect ratios, there is a large discrepancy between the values of maximum moment corresponding to the collapse loads obtained from this method and the FEM numerical results due to an effect of web slenderness. A new method is proposed to predict the maximum moment considering the effect of web slenderness. The validity of the collapse load estimation is checked by the results of FEM numerical simulation.",signatures:"Kenichi Masuda and Dai-Heng Chen",downloadPdfUrl:"/chapter/pdf-download/58298",previewPdfUrl:"/chapter/pdf-preview/58298",authors:[{id:"207579",title:"Dr.",name:"Kenichi",surname:"Masuda",slug:"kenichi-masuda",fullName:"Kenichi Masuda"},{id:"218986",title:"Prof.",name:"Dai-Heng",surname:"Chen",slug:"dai-heng-chen",fullName:"Dai-Heng Chen"}],corrections:null}],productType:{id:"1",title:"Edited Volume",chapterContentType:"chapter",authoredCaption:"Edited by"},subseries:null,tags:null},relatedBooks:[{type:"book",id:"9386",title:"Direct Numerical Simulations",subtitle:"An Introduction and Applications",isOpenForSubmission:!1,hash:"158a3a0fdba295d21ff23326f5a072d5",slug:"direct-numerical-simulations-an-introduction-and-applications",bookSignature:"Srinivasa Rao",coverURL:"https://cdn.intechopen.com/books/images_new/9386.jpg",editedByType:"Edited by",editors:[{id:"6897",title:"Dr.",name:"Srinivasa",surname:"Rao",slug:"srinivasa-rao",fullName:"Srinivasa Rao"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"2160",title:"MATLAB",subtitle:"A Fundamental Tool for Scientific Computing and Engineering Applications - Volume 1",isOpenForSubmission:!1,hash:"dd9c658341fbd264ed4f8d9e6aa8ca29",slug:"matlab-a-fundamental-tool-for-scientific-computing-and-engineering-applications-volume-1",bookSignature:"Vasilios N. Katsikis",coverURL:"https://cdn.intechopen.com/books/images_new/2160.jpg",editedByType:"Edited by",editors:[{id:"12289",title:"Prof.",name:"Vasilios",surname:"Katsikis",slug:"vasilios-katsikis",fullName:"Vasilios Katsikis"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"3036",title:"MATLAB",subtitle:"A Fundamental Tool for Scientific Computing and Engineering Applications - Volume 2",isOpenForSubmission:!1,hash:"39d85d5d566c24744e4ac69fc297bb36",slug:"matlab-a-fundamental-tool-for-scientific-computing-and-engineering-applications-volume-2",bookSignature:"Vasilios N. Katsikis",coverURL:"https://cdn.intechopen.com/books/images_new/3036.jpg",editedByType:"Edited by",editors:[{id:"12289",title:"Prof.",name:"Vasilios",surname:"Katsikis",slug:"vasilios-katsikis",fullName:"Vasilios Katsikis"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"3037",title:"MATLAB",subtitle:"A Fundamental Tool for Scientific Computing and Engineering Applications - Volume 3",isOpenForSubmission:!1,hash:"1de63ac4f2c398a1304a7c08ee883655",slug:"matlab-a-fundamental-tool-for-scientific-computing-and-engineering-applications-volume-3",bookSignature:"Vasilios N. Katsikis",coverURL:"https://cdn.intechopen.com/books/images_new/3037.jpg",editedByType:"Edited by",editors:[{id:"12289",title:"Prof.",name:"Vasilios",surname:"Katsikis",slug:"vasilios-katsikis",fullName:"Vasilios Katsikis"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"1485",title:"Applications of Monte Carlo Method in Science and Engineering",subtitle:null,isOpenForSubmission:!1,hash:"08abe20f1549c83cfb208c83e12ee7df",slug:"applications-of-monte-carlo-method-in-science-and-engineering",bookSignature:"Shaul Mordechai",coverURL:"https://cdn.intechopen.com/books/images_new/1485.jpg",editedByType:"Edited by",editors:[{id:"21994",title:"Prof.",name:"Shaul",surname:"Mordechai",slug:"shaul-mordechai",fullName:"Shaul Mordechai"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"1025",title:"Engineering Education and Research Using MATLAB",subtitle:null,isOpenForSubmission:!1,hash:"6e4cf9f0e6d7dccba13bc8edc4bf8e70",slug:"engineering-education-and-research-using-matlab",bookSignature:"Ali H. Assi",coverURL:"https://cdn.intechopen.com/books/images_new/1025.jpg",editedByType:"Edited by",editors:[{id:"12279",title:"Dr.",name:"Ali",surname:"Assi",slug:"ali-assi",fullName:"Ali Assi"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"1027",title:"Applications of MATLAB in Science and Engineering",subtitle:null,isOpenForSubmission:!1,hash:"64f208a73ca0da9038418788e86dfe28",slug:"applications-of-matlab-in-science-and-engineering",bookSignature:"Tadeusz Michałowski",coverURL:"https://cdn.intechopen.com/books/images_new/1027.jpg",editedByType:"Edited by",editors:[{id:"35273",title:"Prof.",name:"Tadeusz",surname:"Michalowski",slug:"tadeusz-michalowski",fullName:"Tadeusz Michalowski"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"405",title:"Computational Simulations and Applications",subtitle:null,isOpenForSubmission:!1,hash:"84a582eb7ec291ae468bc75d0fc9a101",slug:"computational-simulations-and-applications",bookSignature:"Jianping Zhu",coverURL:"https://cdn.intechopen.com/books/images_new/405.jpg",editedByType:"Edited by",editors:[{id:"62225",title:"Dr.",name:"Jianping",surname:"Zhu",slug:"jianping-zhu",fullName:"Jianping Zhu"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"5323",title:"Modeling and Simulation in Engineering Sciences",subtitle:null,isOpenForSubmission:!1,hash:"684a6db4422b067b280c33faf661d747",slug:"modeling-and-simulation-in-engineering-sciences",bookSignature:"Noreen Sher Akbar and O. Anwar Beg",coverURL:"https://cdn.intechopen.com/books/images_new/5323.jpg",editedByType:"Edited by",editors:[{id:"184401",title:"Dr.",name:"Noreen",surname:"Sher Akbar",slug:"noreen-sher-akbar",fullName:"Noreen Sher Akbar"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"2830",title:"Advances in Modeling of Fluid Dynamics",subtitle:null,isOpenForSubmission:!1,hash:"63b0031c4189b213e315fe50e17bab66",slug:"advances-in-modeling-of-fluid-dynamics",bookSignature:"Chaoqun Liu",coverURL:"https://cdn.intechopen.com/books/images_new/2830.jpg",editedByType:"Edited by",editors:[{id:"143219",title:"Dr.",name:"Chaoqun",surname:"Liu",slug:"chaoqun-liu",fullName:"Chaoqun Liu"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}}],ofsBooks:[]},correction:{item:{id:"66300",slug:"corrigendum-to-recovery-intervention-to-promote-social-connectedness-through-social-recreational-pro",title:"Corrigendum to: Recovery Intervention to Promote Social Connectedness through Social Recreational Programs for Persons with Dementia: A Critical Analysis",doi:null,correctionPDFUrl:"https://cdn.intechopen.com/pdfs/66300.pdf",downloadPdfUrl:"/chapter/pdf-download/66300",previewPdfUrl:"/chapter/pdf-preview/66300",totalDownloads:null,totalCrossrefCites:null,bibtexUrl:"/chapter/bibtex/66300",risUrl:"/chapter/ris/66300",chapter:{id:"65375",slug:"recovery-intervention-to-promote-social-connectedness-through-social-recreational-programs-for-perso",signatures:"Winnie Sun, Shelby-Lynne Clarke, Hanaan Madahey and Ping Zou",dateSubmitted:"November 12th 2018",dateReviewed:"December 22nd 2018",datePrePublished:"January 28th 2019",datePublished:"April 10th 2019",book:{id:"8268",title:"Advances in Dementia Research",subtitle:null,fullTitle:"Advances in Dementia Research",slug:"advances-in-dementia-research",publishedDate:"April 10th 2019",bookSignature:"Ghulam Md. Ashraf",coverURL:"https://cdn.intechopen.com/books/images_new/8268.jpg",licenceType:"CC BY 3.0",editedByType:"Edited by",editors:[{id:"199287",title:"Dr.",name:"Ghulam Md",middleName:null,surname:"Ashraf",slug:"ghulam-md-ashraf",fullName:"Ghulam Md Ashraf"}],productType:{id:"1",title:"Edited Volume",chapterContentType:"chapter",authoredCaption:"Edited by"}},authors:[{id:"219759",title:"Dr.",name:"Winnie",middleName:null,surname:"Sun",fullName:"Winnie Sun",slug:"winnie-sun",email:"winnie.sun@uoit.ca",position:null,institution:{name:"University of Ontario Institute of Technology",institutionURL:null,country:{name:"Canada"}}},{id:"284558",title:"Dr.",name:"Shelby-Lynne",middleName:null,surname:"Clarke",fullName:"Shelby-Lynne Clarke",slug:"shelby-lynne-clarke",email:"shelbylynne.clarke@gmail.com",position:null,institution:null},{id:"284561",title:"Dr.",name:"Hanaan",middleName:null,surname:"Madahey",fullName:"Hanaan Madahey",slug:"hanaan-madahey",email:"hanaan.madahey@uoit.net",position:null,institution:null},{id:"284562",title:"Dr.",name:"Ping",middleName:null,surname:"Zou",fullName:"Ping Zou",slug:"ping-zou",email:"pingz@nipissingu.ca",position:null,institution:null}]}},chapter:{id:"65375",slug:"recovery-intervention-to-promote-social-connectedness-through-social-recreational-programs-for-perso",signatures:"Winnie Sun, Shelby-Lynne Clarke, Hanaan Madahey and Ping Zou",dateSubmitted:"November 12th 2018",dateReviewed:"December 22nd 2018",datePrePublished:"January 28th 2019",datePublished:"April 10th 2019",book:{id:"8268",title:"Advances in Dementia Research",subtitle:null,fullTitle:"Advances in Dementia Research",slug:"advances-in-dementia-research",publishedDate:"April 10th 2019",bookSignature:"Ghulam Md. Ashraf",coverURL:"https://cdn.intechopen.com/books/images_new/8268.jpg",licenceType:"CC BY 3.0",editedByType:"Edited by",editors:[{id:"199287",title:"Dr.",name:"Ghulam Md",middleName:null,surname:"Ashraf",slug:"ghulam-md-ashraf",fullName:"Ghulam Md Ashraf"}],productType:{id:"1",title:"Edited Volume",chapterContentType:"chapter",authoredCaption:"Edited by"}},authors:[{id:"219759",title:"Dr.",name:"Winnie",middleName:null,surname:"Sun",fullName:"Winnie Sun",slug:"winnie-sun",email:"winnie.sun@uoit.ca",position:null,institution:{name:"University of Ontario Institute of Technology",institutionURL:null,country:{name:"Canada"}}},{id:"284558",title:"Dr.",name:"Shelby-Lynne",middleName:null,surname:"Clarke",fullName:"Shelby-Lynne Clarke",slug:"shelby-lynne-clarke",email:"shelbylynne.clarke@gmail.com",position:null,institution:null},{id:"284561",title:"Dr.",name:"Hanaan",middleName:null,surname:"Madahey",fullName:"Hanaan Madahey",slug:"hanaan-madahey",email:"hanaan.madahey@uoit.net",position:null,institution:null},{id:"284562",title:"Dr.",name:"Ping",middleName:null,surname:"Zou",fullName:"Ping Zou",slug:"ping-zou",email:"pingz@nipissingu.ca",position:null,institution:null}]},book:{id:"8268",title:"Advances in Dementia Research",subtitle:null,fullTitle:"Advances in Dementia Research",slug:"advances-in-dementia-research",publishedDate:"April 10th 2019",bookSignature:"Ghulam Md. Ashraf",coverURL:"https://cdn.intechopen.com/books/images_new/8268.jpg",licenceType:"CC BY 3.0",editedByType:"Edited by",editors:[{id:"199287",title:"Dr.",name:"Ghulam Md",middleName:null,surname:"Ashraf",slug:"ghulam-md-ashraf",fullName:"Ghulam Md Ashraf"}],productType:{id:"1",title:"Edited Volume",chapterContentType:"chapter",authoredCaption:"Edited by"}}},ofsBook:{item:{type:"book",id:"11800",leadTitle:null,title:"Cyanobacteria - Recent Advances and New Perspectives",subtitle:null,reviewType:"peer-reviewed",abstract:"\r\n\tCyanobacteria have an enormous ecological role ranging from harmful algal blooms to carbon dioxide mitigation. Their extraordinary metabolic machinery enables them to flourish in diverse habitats. The valorization of biomass can yield a plethora of high-value products. The secondary metabolites that are produced by cyanobacteria include pigments, polysaccharides, phenols, hydrogen, and many more. The biofuels like hydrogen, bioethanol, syngas, and many more can be produced which find applications as alternate energy sources and address vital environmental issues related to non-renewable energy sources. These biofuels are very sustainable and eliminating the research gaps can further lead to the commercial production of cyanobacterial biofuels in the market across the world. The range of metabolic products is tremendously valuable as antimicrobial, anticancer, anti-inflammatory, antitumor, antioxidative in nature, which has excellent therapeutic applications.
\r\n\r\n\tThis book envisions elaborating on the recent advancements and the new perspectives in the area of cyanobacterial research on the global platform.
",isbn:"978-1-80356-462-3",printIsbn:"978-1-80356-461-6",pdfIsbn:"978-1-80356-463-0",doi:null,price:0,priceEur:0,priceUsd:0,slug:null,numberOfPages:0,isOpenForSubmission:!1,isSalesforceBook:!1,isNomenclature:!1,hash:"645b037b086ec8c36af614326dce9804",bookSignature:"Dr. Archana Tiwari",publishedDate:null,coverURL:"https://cdn.intechopen.com/books/images_new/11800.jpg",keywords:"Algae, Cyanobacteria, Ecological Impact, Carbon Dioxide Mitigation, Biofuels, Hydrogen, Ethanol, Sustainability, Applications, Biomass Valorization, Metabolites, Bioactive Compounds",numberOfDownloads:null,numberOfWosCitations:0,numberOfCrossrefCitations:null,numberOfDimensionsCitations:null,numberOfTotalCitations:null,isAvailableForWebshopOrdering:!0,dateEndFirstStepPublish:"March 2nd 2022",dateEndSecondStepPublish:"May 3rd 2022",dateEndThirdStepPublish:"July 2nd 2022",dateEndFourthStepPublish:"September 20th 2022",dateEndFifthStepPublish:"November 19th 2022",dateConfirmationOfParticipation:null,remainingDaysToSecondStep:"2 months",secondStepPassed:!0,areRegistrationsClosed:!0,currentStepOfPublishingProcess:4,editedByType:null,kuFlag:!1,biosketch:"A Gold medalist and distinction holder in Botany and her research interests include Phycoprospecting Diatoms for wastewater remediation and high-value products.",coeditorOneBiosketch:null,coeditorTwoBiosketch:null,coeditorThreeBiosketch:null,coeditorFourBiosketch:null,coeditorFiveBiosketch:null,editors:[{id:"186791",title:"Dr.",name:"Archana",middleName:null,surname:"Tiwari",slug:"archana-tiwari",fullName:"Archana Tiwari",profilePictureURL:"https://mts.intechopen.com/storage/users/186791/images/system/186791.jpg",biography:"Dr. Archana Tiwari is Associate Professor at Amity University, India. Her research interests include renewable sources of energy from microalgae and further utilizing the residual biomass for the generation of value-added products, bioremediation through microalgae and microbial consortium, antioxidative enzymes and stress, and nutraceuticals from microalgae. She has been working on algal biotechnology for the last two decades. She has published her research in many international journals and has authored many books and chapters with renowned publishing houses. She has also delivered talks as an invited speaker at many national and international conferences. Dr. Tiwari is the recipient of several awards including Researcher of the Year and Distinguished Scientist.",institutionString:"Amity University",position:null,outsideEditionCount:0,totalCites:0,totalAuthoredChapters:"3",totalChapterViews:"0",totalEditedBooks:"1",institution:{name:"Amity University",institutionURL:null,country:{name:"India"}}}],coeditorOne:null,coeditorTwo:null,coeditorThree:null,coeditorFour:null,coeditorFive:null,topics:[{id:"13",title:"Immunology and Microbiology",slug:"immunology-and-microbiology"}],chapters:null,productType:{id:"1",title:"Edited Volume",chapterContentType:"chapter",authoredCaption:"Edited by"},personalPublishingAssistant:{id:"453624",firstName:"Martina",lastName:"Scerbe",middleName:null,title:"Ms.",imageUrl:"https://mts.intechopen.com/storage/users/453624/images/20399_n.jpg",email:"martina.s@intechopen.com",biography:null}},relatedBooks:[{type:"book",id:"6764",title:"Cyanobacteria",subtitle:null,isOpenForSubmission:!1,hash:"87c7d8f86f7c1185aa4dd47c6492951a",slug:"cyanobacteria",bookSignature:"Archana Tiwari",coverURL:"https://cdn.intechopen.com/books/images_new/6764.jpg",editedByType:"Edited by",editors:[{id:"186791",title:"Dr.",name:"Archana",surname:"Tiwari",slug:"archana-tiwari",fullName:"Archana Tiwari"}],productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"1591",title:"Infrared Spectroscopy",subtitle:"Materials Science, Engineering and Technology",isOpenForSubmission:!1,hash:"99b4b7b71a8caeb693ed762b40b017f4",slug:"infrared-spectroscopy-materials-science-engineering-and-technology",bookSignature:"Theophile Theophanides",coverURL:"https://cdn.intechopen.com/books/images_new/1591.jpg",editedByType:"Edited by",editors:[{id:"37194",title:"Dr.",name:"Theophile",surname:"Theophanides",slug:"theophile-theophanides",fullName:"Theophile Theophanides"}],productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"3161",title:"Frontiers in Guided Wave Optics and Optoelectronics",subtitle:null,isOpenForSubmission:!1,hash:"deb44e9c99f82bbce1083abea743146c",slug:"frontiers-in-guided-wave-optics-and-optoelectronics",bookSignature:"Bishnu Pal",coverURL:"https://cdn.intechopen.com/books/images_new/3161.jpg",editedByType:"Edited by",editors:[{id:"4782",title:"Prof.",name:"Bishnu",surname:"Pal",slug:"bishnu-pal",fullName:"Bishnu Pal"}],productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"3092",title:"Anopheles mosquitoes",subtitle:"New insights into malaria vectors",isOpenForSubmission:!1,hash:"c9e622485316d5e296288bf24d2b0d64",slug:"anopheles-mosquitoes-new-insights-into-malaria-vectors",bookSignature:"Sylvie Manguin",coverURL:"https://cdn.intechopen.com/books/images_new/3092.jpg",editedByType:"Edited by",editors:[{id:"50017",title:"Prof.",name:"Sylvie",surname:"Manguin",slug:"sylvie-manguin",fullName:"Sylvie Manguin"}],productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"371",title:"Abiotic Stress in Plants",subtitle:"Mechanisms and Adaptations",isOpenForSubmission:!1,hash:"588466f487e307619849d72389178a74",slug:"abiotic-stress-in-plants-mechanisms-and-adaptations",bookSignature:"Arun Shanker and B. Venkateswarlu",coverURL:"https://cdn.intechopen.com/books/images_new/371.jpg",editedByType:"Edited by",editors:[{id:"58592",title:"Dr.",name:"Arun",surname:"Shanker",slug:"arun-shanker",fullName:"Arun Shanker"}],productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"72",title:"Ionic Liquids",subtitle:"Theory, Properties, New Approaches",isOpenForSubmission:!1,hash:"d94ffa3cfa10505e3b1d676d46fcd3f5",slug:"ionic-liquids-theory-properties-new-approaches",bookSignature:"Alexander Kokorin",coverURL:"https://cdn.intechopen.com/books/images_new/72.jpg",editedByType:"Edited by",editors:[{id:"19816",title:"Prof.",name:"Alexander",surname:"Kokorin",slug:"alexander-kokorin",fullName:"Alexander Kokorin"}],productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"314",title:"Regenerative Medicine and Tissue Engineering",subtitle:"Cells and Biomaterials",isOpenForSubmission:!1,hash:"bb67e80e480c86bb8315458012d65686",slug:"regenerative-medicine-and-tissue-engineering-cells-and-biomaterials",bookSignature:"Daniel Eberli",coverURL:"https://cdn.intechopen.com/books/images_new/314.jpg",editedByType:"Edited by",editors:[{id:"6495",title:"Dr.",name:"Daniel",surname:"Eberli",slug:"daniel-eberli",fullName:"Daniel Eberli"}],productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"57",title:"Physics and Applications of Graphene",subtitle:"Experiments",isOpenForSubmission:!1,hash:"0e6622a71cf4f02f45bfdd5691e1189a",slug:"physics-and-applications-of-graphene-experiments",bookSignature:"Sergey Mikhailov",coverURL:"https://cdn.intechopen.com/books/images_new/57.jpg",editedByType:"Edited by",editors:[{id:"16042",title:"Dr.",name:"Sergey",surname:"Mikhailov",slug:"sergey-mikhailov",fullName:"Sergey Mikhailov"}],productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"1373",title:"Ionic Liquids",subtitle:"Applications and Perspectives",isOpenForSubmission:!1,hash:"5e9ae5ae9167cde4b344e499a792c41c",slug:"ionic-liquids-applications-and-perspectives",bookSignature:"Alexander Kokorin",coverURL:"https://cdn.intechopen.com/books/images_new/1373.jpg",editedByType:"Edited by",editors:[{id:"19816",title:"Prof.",name:"Alexander",surname:"Kokorin",slug:"alexander-kokorin",fullName:"Alexander Kokorin"}],productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"2270",title:"Fourier Transform",subtitle:"Materials Analysis",isOpenForSubmission:!1,hash:"5e094b066da527193e878e160b4772af",slug:"fourier-transform-materials-analysis",bookSignature:"Salih Mohammed Salih",coverURL:"https://cdn.intechopen.com/books/images_new/2270.jpg",editedByType:"Edited by",editors:[{id:"111691",title:"Dr.Ing.",name:"Salih",surname:"Salih",slug:"salih-salih",fullName:"Salih Salih"}],productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}}]},chapter:{item:{type:"chapter",id:"72826",title:"Interlinking Industry 4.0 and Academia through Robotics and Automation: An Indian Perspective",doi:"10.5772/intechopen.92608",slug:"interlinking-industry-4-0-and-academia-through-robotics-and-automation-an-indian-perspective",body:'With the advent of industrial development, humans have witnessed its four phases starting from mechanized processes, mass production using electricity, assembly lines and now finally culminating to Industry 4.0. It is also commonly referred as Smart factory where the physical processes of factory are monitored by decentralized cyber-physical systems to take autonomous and individual decisions. The physical systems i.e. machines are configured with the Internet of Things (IoT), communicating in real time to each other and with human operators over the web representing another vital component called interoperability. Indian Institute of Science (IISc) has been developing a “Smart Factory called I4.0India@IISc” that will act as a Common Engineering Facility Centre (CEFC) at the Centre for Product Design and Manufacturing (CPDM), under the SAMARTH Udyog Bharat 4.0 program of the Department of Heavy Industries (DHI), Gol in [1].
The CEFC builds on the earlier work at IISc that initiated India’s first smart factory R&D platform with seed collaboration fund from the various multinational and national companies worldwide. The CEFC intends to develop two contrasting factory platforms. One is highly automated, with data-intensive processing machines such as 5-axis CNC, metal additive manufacturing, metal laser routers etc. that are handled by Industrial robots, collaborative robots, automated guided vehicles, etc. The other platform is highly manual, with legacy machines with data layer, where handling is also carried out manually. The distinction is that all elements in both the Platforms (people, process, parts, tools and environment) are to be connected via IoT-based communication networks and data are stored and analytics carried out using cloud computing. The intent is to use the platforms as demonstration centers in which factories of the future will be explored to see their potential and challenges, and use the platforms for advancing research, innovation, training and support for practice. A major aim of this CEFC is to support Industry 4.0 in MSMEs of India by developing “advanced yet affordable” technologies and solutions for their use. The CEFC is supported by Tata Consultancy Services (TCS), Yaskawa, Faurecia, Toyota Kirloskar Motors (TKM) and Ashok Leyland as industrial partners who contribute with fully funded research projects. The CEFC is also supported by faculty members drawn from 12 departments of IISc as collaborators. A variety of research-intensive technologies are being developed at the CEFC for the benefit of industry. The technologies under development include smart resource bins for waste tracking, smart inspection systems, AR/VR-based digital twins and digital walkthrough systems, 3D printing systems for printing devices with embedded electronics, PCB assembly support systems, multi-modal robots, affordable door localization systems, etc. The CEFC is meant to serve the following purposes:
Use of the factory with its two platforms as demonstrators for Industry 4.0 (development of platform should be completed in next 6 months)
Utilization of the platforms for trying out new building blocks, technologies and solutions for their potential effects on KPI before committing investment on these.
Playing with various combinations of the two platforms for creating different variants of factories of the future and seeing their impact on KPIs.
Using the factory as a springboard for supporting development of new innovations and start-ups for Industry 4.0 (1 start-up initiated, 10 existing start-ups already supported as planned)
Creating Indigenous R&D capabilities in the area for India’s Industry 4.0 by training researchers and developing deep tech knowledge. (11 PhD students and 20 researchers are being trained, over 20 technologies, tools and solutions are being developed with industrial significance)
Providing awareness, training and education, especially high-end training to develop future leaders in manufacturing (over 500 people already trained, which is 2.5 times more than originally planned; a new MTech and PhD program in manufacturing initiated at IISc, an international conference on Industry 4.0 and Advanced Manufacturing I-4AM’19 initiated)
In continuation to this we have identified the opportunities and challenges for human robot collaboration in Industry 4.0 set-up. This is mentioned in subsequent sections.
A supply chain in a manufacturing environment involves manufacturers, suppliers, and other logistical entities that would entail dealing with the customers’ requests. Modern management practices are designed to reduce the inventories; thus, warehouses play a crucial role in customer services and product availability. Logistical support provided to improve the warehouse order picking scenario would entail reduction of time in retrieving of the object and its successful shipment for delivery. Customer satisfaction in such a scenario would require for an efficient and flexible warehouse order handling processes. However, any small changes in the customer end of the supply chain would create a large ripple in the stock levels and orders along the supply chain also called as a “Bullwhip Effect.” Increasing demand at the nth tier in a supply chain will be over-compensated by an even greater increase of the demand at the n+1th tier of the chain in [2]. As a result, the curve mapping the stock levels along the time looks similar to a whiplash, hence the name “Bullwhip Effect.” Some of the key aspects of the human factors in the logistics industry are quantified as Perceptual Factor, Mental Factor, Physical Factor, Psychological Factor in [3]:
Perceptual Factor: Perception to new things will play a role to changing needs of warehousing environment. This will play a very important factor in determining the overall productivity of the warehouse. This factor will amount to 24.4% in the order picking process. Some of the key things that will affect in this factor would include information technology, ability to read, confusion created due to negligence and ability to accept new technology. It is of the utmost importance that the laborers are skilled to understand the upcoming technology that will reduce the overall burden of their work.
Mental factor: The mental factor in any order picking process will be of maximum importance and will amount to 45.2% in the order picking process. Some of the key aspects in this factor would be as follows: cognitive ability, ability to learn new technology will be a very important factor to ensure that the order picking process can be done in a very efficient way and will amount to 37.3%. Some of the other factors include behavior, training. To ensure the productivity of the warehouse, the laborers should have decent working environment where they are more receptive and learn modern technologies and new ideas that will improve the efficiency of the system.
Physical Factor: The physical factor in order picking process will amount to 16.3%. Some of the key aspects that will affect the order picking process are: Having an improper workload will lead to musculoskeletal diseases in the human beings causing back pain and fatigue. Further improper material handling may lead to material damages that will increase the overall cost in the production. It is of utmost importance that the workload of all laborers should be uniformly distributed, to avoid the breakdown of the warehouse machinery.
Psychological Factor: Factors like work environment, stress, monetary incentives also play a very important role in ensuring that human beings are motivated to do quality work and ensure that the order handling process runs in a very smooth and efficient way. Laborers should have proper incentives and can be in the form of monetary or otherwise, to ensure that they are motivated throughout to ensure that the productivity of the warehouse is not dropped.
Logistical cost in Indian scenario accounts to 13–17% of the overall GDP, which is nearly double the GDP of the developed countries like US, France, UK, etc. in [4]. Main reasons for such high costs are due to lack of efficient transport systems. Further it is seen that there is a limited focus on robotics and automation which would reduce the majority of the human works. The main percentage of the logistical cost in India is borne by the end users. The future trends in warehousing industry would involve companies consolidating large warehouse spaces and developing futuristic technologies that would improve the warehousing operations leading to better and efficient productivity. A huge amount of flexibility can be incorporated by including human operators in the warehousing industry. Human being can react quickly to any operational changes or urgent requirements of the orders and maneuver in tight spaces that lead to efficiency in the order picking systems. Some of the key measures taken by the Indian government to improve the logistical scenario in India include the Creation of exclusive Warehousing Promotion Zones. Create logistics and warehousing policies separate from industrial promotion policies, Allocation of areas exclusively for warehousing within Industrial Parks, Setting up of Skill Augmentation Centers in [4]:
Creation of exclusive Warehousing Promotion Zones: To create modern warehouses and facilitate modern warehousing, need to create exclusive warehousing zones is stressed to develop modern warehousing infrastructures.
Create logistics and warehousing policies separate from industrial promotion policies: State governments are mandated to form separate policies for development of the logistics and warehousing industry so that the industries can grow to its full potential.
Allocation of areas exclusively for warehousing within Industrial Parks: Adequate storage facilities for raw materials and finished goods need to be provided in the industrial parks where the manufacturing facilities are provided.
Setting up of Skill Augmentation Centers: It is of the utmost importance to set up a skill augmentation center so that warehouses can be modernized to improve productivity and efficiency. Some of the modern technologies that can be included in the warehousing include using of cloud to access the warehouse inventories, deployment of drones in the warehousing industry. Using of IoT and automation can improve the overall performance of the system.
Automation in the manufacturing industry will ensure that the end result will be achieved in a more effective way thereby reducing the human effort. Automated guided vehicles are the most extensively used robots in the industry; however, these lack the self-regulating mobility and need navigation lines along the shop floor. Further material handling while using the AGV will require human effort which in some cases will reduce the productivity. The need for human operators to undertake planning activities and the lack of real time feedback of the shop floor’s inventory level will make the efficient flow of materials tough.
Autonomous mobile robots are machines designed to maneuver itself in an obstacle filled environment through the use of sensors and feedback. Due to its design it can be used in manufacturing industry thereby reducing wear and tear in different industrial components and improve the productivity. AMR’s provide a wide range of advantages such as: reduced floor traffic, flexibility, reliability, self-regulating mobility etc. in [5].
The need for using the autonomous mobile robots in manufacturing environment is as follows:
To increase productivity and efficiency
To improve material handling
To improve the safety of human operators in high risk, stress environments
To perform repetitive tasks so that the human beings can concentrate on cognitive and creative tasks.
To enhance overall revenue by delivering order in perfect fulfillment rates and better customer satisfaction.
To reduce the factory traffic by navigating in tight and complex environments.
Human machine interaction is one of the most crucial aspects of the warehousing industry. Since there is a collaboration between human and machine in the warehousing industry, efficient interaction between the two systems would ensure that the process runs in a smooth way in [6]. In an HMI system, machines relieve human from performing repetitive tasks, and human can focus on working in creative and cognitive tasks. Thereby such collaborations would improve the efficiency and reliability of the overall system. Human beings will not be able handle heavy objects in the warehousing industry. Such things will lead to the musculoskeletal damage in human beings and factor into improper material handling. The advent automation has reduced the burden on the human in the warehousing industries. However, there is a reduction of skill in the warehouse workers due to the increased workload on the human beings in [6]. Thereby creating a concept of adaptive automation where there is a continuous interaction between the human and machine considering the ever-changing needs of a logistics/warehousing setup.
Figure 1 shows the possible types of interaction in human machine system, which is adapted from “Formalizing Human–Machine Interactions for Adaptive Automation in Smart Manufacturing” [6].
Description for a human-machine system based on the type of interaction.
In general, the possible human interactions that are seen in a warehousing environment can be classified as Human machine interaction, Human task interaction, Supervisor system interaction in [6].
Typical human machine interaction system would consist of human supervisor, several manufacturing cells that and each cell consists of human operator, machine and a human machine interface. The whole system can be viewed as a cell layer and supervisor layer. The interfaces at the cell layer are associated with the UIs for human operators who manipulate the machines to achieve the logistical goals and respond to unexpected situations either by reporting unanticipated events to the supervisor or performing the exception handling tasks issued by the supervisor. Information about machine state is delivered to the human operator through the interface and the operator controls the machine directly through his commands and suitably maneuvers the machine. The operator will notify the supervisor about any interrupts that may affect the overall performance of the system thereby allowing the supervisor to perform exception handling tasks. The interfaces at the supervisor layer are for a human supervisor in the human machine system. In normal scenarios the supervisor will monitor the key monitoring indices for logistical warehouses and maintain the task progress. In cases of exceptions the supervisor has to advice the operator to take the corrective actions. Exception handling task supportability is associated with responsive management concerning the uncertainty inherent in almost every logistical system. Designing of Human machine systems should take into account that human machine system has to assist humans or supervisor in coping with an unforeseen scenario. Due to a high degree of complexity, the problems of exceptions only by the means of autonomous robots will be a challenge, thereby creating the need for human involvement.
Due to the complex nature of the AMR’s, some of the key limiting factors that decide the acceptance of autonomous mobile robots in the manufacturing industry are in [4]:
Self-efficiency: It decides the ability of the user to adopt to new technology and perform given tasks under different circumstances. Some of the sub-factors include understanding the usage and application of AMR, ability to use the AMR without any assistance. It is highly necessary that human operator is well educated about the application of the AMR’s so that upon interrupt, necessity suitable changes can be incorporated to the systems without bringing the whole production to a standstill.
Performance expectancy: Since the AMR comprises of many sensitive electronic components, the reliability of the overall system and the performance of the said system will dictate the productivity in the usage of AMR’s in the industry. Further due to the lack of regular maintenance schedule will bring down the performance expectancy of the robot.
Perceived risks: AMR’s are prone to a traffic collision due to hardware failure, software failure which will often lead to improper material handling, thereby creating a scene of uncertainty towards performance and productivity. Such incidents usually end with a financial loss to the manufacturers.
Intentions to use: Intention of the use of AMR’s is governed by users and the end application. If the technology is used as per the purpose of its creation then it will lead to easing out of work, thereby boosting the industries. Due to the software functionality of the AMR’s once if the steps involved in the manufacturing process is trained, it will retain these steps thereby reducing the intensity of the work.
Privacy: Breach of private information through hacking of the software used will lead to wrong marketing, scrutiny, etc. vehicle to vehicle communication will involve transferring of vehicular data in order to have better productivity but however leads to breach of privacy. So, privacy of data will be important in the autonomous environment to ensure that the data generated by the systems will not get into the wrong hands.
Reliability: The reliability of the AMR’s will mainly depend on the following factors: precision, accuracy, safety, security. Some of the sub-factors include getting confused due to extenuating circumstances of the everchanging needs of the warehouse, precision and the accuracy with which the system responds to the changing needs of a manufacturing industry, mean time between failure.
Further there are other constraints that limit the overall performance of the AMR’s in the factory setup in [7]:
Getting the software correct so that the robot can navigate the factory setup autonomously and do the complex tasks in an efficient way.
Gathering enough real-world data so that the robot can accommodate the real-world changes in the factory setup.
Creating precise motion control so that the robot can maneuver in tight spaces and material handling is done in an efficient way.
Reducing the false positives that may occur by training the robot in enough real-world scenarios and distinguishing the data obtained between the actual data and the false positive ones.
Present Solutions Used for Autonomous Navigation in Factory Set-Up.
One of the evident problems that may be seen while using an AMR is the process of motion planning for an unstructured environment like a warehouse where there are continuous upgrades of the warehouse technology and thereby will be constant updating of the maps. In such a scenario where the start and the finish points are fixed, the motion planning will be complex. There are infinite possibilities for achieving the trajectory for a given start and finish. The best way would be to use a probabilistic approach to generate the trajectory using the concept of least action. The concept of least action will use the simple fact that the best possible path out of the infinite possible paths from a start point to the finish point would be the one that consumes the least energy in [8]. The principle of least action will generate a best possible path out of the infinite possibilities that are available from starting point to finish point considering all of the infinite paths that are possible. While using the concept of least action all of the possible paths are discretized for a small interval that is decided by the user, and the trajectory generated for this discretized instant for all the paths will be a straight line as shown in the Figure 2 that is selected in [9].
Infinite possible paths that are possible for a given start and finish.
To find the energy of each of the infinite path that is essential in the computation of the least action, there will be a Lagrangian that is defined for all the paths that will be a function of time in [8]. Further an action function is defined, which will be an integral of the Lagrangian for the path from start to the finish.as per the Eq. 1. The main objective would be to minimize this function, so that the best optimal path is generated.
where S = the action function that is defined for a given start and finish.
L = Lagrangian that is defined over the path which is the difference of the kinetic and the potential energy and is the function of the time.
ti = start time.
tf = finish time.
The Lagrangian for the system is defined as
where
P(x) = overall Potential energy for the path.
The physical significance of the action function would be that, the function would eliminate the infinite path which is not practical and will keep only the paths that make sense, from where the optimal path is selected. Further by discretizing the path for small instants can be useful for the process of real time obstacle detection in the environment and generating a trajectory that can be obstacle free. The path taken by the system that is generated through the concept of least action will give the complete history of the path that is taken to achieve the required goal which means that path taken by the robot is dependent on the path that the robot has taken previously. The simplicity of this approach makes it more useful in using the proposed method in complex environments. So, the institute looks at incorporating the concept of least action for the motion planning of autonomous mobile robots that is developed at the common engineering facility center. The technology developed at the common engineering facility center is discussed in the paragraphs below.
The present solutions those are developed by the industry keeping in mind the different problems like the software complexity, performance, flexibility in the harsh conditions of a warehouse environment are as follows in [10, 11]:
Goods to person picking robots: companies like IAM, robotics, gray orange and blue offer mobile robot solutions that are loaded with modern technology and add new efficiency to the tasks done in factory setup. These robots can be programmed to have flexible routes in the factory set-up and requires less infrastructure to set up. The computer interface is friendly and easy to understand. Thereby the human machine interaction happens in a smooth way.
Self-driving forklift: Linde’s new automated forklift consists of navigation lasers, 3D camera and visual and acoustic warning indicator that enables to move safely around human workers. The company also includes the feature of detection of real-time obstacles and adjust suitably. These things can work in fleet thereby optimizing the performance of the warehouses. These are being used in Kerala, Gujarat, Madhya Pradesh for different industries like electronics, consumer. The system further is mainly used as an artificial intelligence solution to the said product and has been installed in the manufacturing setup at ITC.
Autonomous inventory robots: FETCH’s tag surveyor consists of three RFID mounted for optimal coverage and has reliability and consistently detect the products up to 25 feet away, thereby reducing the manual inventory count. Typically, the initial cost for such robots will be high due to complexity of the system. However, the run time costs will be reduced as the labor required to do the inventory will be reduced. This technology is in research stages currently in India and companies like iFuture robotics are at the forefront to develop a cost-effective solution.
Amazon air prime: This is the advanced delivery system developed by AMAZON that is used to deliver the products to customers through the means of UAV’s. The drones usually make their way through automated tracks and lift on to open sky and autonomously deliver to the customers. This was first implemented in 2016 in the UK and based on the success the company looks to expand the trial on a larger scale.
Robomart: It is a self- driving store that focuses on transferring of goods that are pre bought online. Robomart is designed to be completely autonomous but also has the additional feature of being completely electric.
Some of the current solutions that are incorporated in IISC’s smart manufacturing CEFC facility are shown in the Figures 3–5.
Yasakawa Robotic arm used for to pick and sort different items from a conveyor.
Autonomous mobile vehicle/Hanhwa Cobot.
Autonomous mobile vehicle/Hanhwa Cobot system collaborating with robotic arm for material handling process.
Figure 3 shows the robot arm that is used to distinguish and sort things from the conveyor. The robot has an interactive human machine interface through which suitable instruction to the robot can be provided. The instructions provided are codes that can be suitably uploaded to the interface. Further the stabilizer provided to the robot arm will ensure the smooth operation of the robot. Figures 4 and 5 shows the autonomous robot used for material handling process throughout the factory setup. There magnetic tapes that are provided along the floor of the smart factory which will guide the robot through the different parts of the factory. Further the robot is provided with obstacle detection system that will simply stop if the robot senses an obstacle along the path of motion. Further to ensure the safety of the human operators there are emergency brakes that are provided to the system. The motion path for the robot can be suitably programmed according to the requirements and can be uploaded to the interactive human machine interface.
The growth of any country is dependent on the investments that the country makes in the manufacturing and the technological upgrade. This report deals with how the technology, the advent of Industry 4.0, and demands of the Indian market make India a viable choice. There are many viable entities like China, which act as a main competitor by the fact that it spends around 53% of the GDP in the manufacturing. There is a high level of foreign direct investment that the government of China has encouraged to improve the manufacturing and warehousing scenarios. However, there are certain limitations like the lack of good infrastructure for the manufacturing industry, IPR violations, etc. that the industries face making China not a viable option for companies to look at. In such a scenario, the Indian markets emerge as a suitable alternative where the service sector accounts to high amount of the overall GDP of the country at around 53% in [12]. Additionally, the affordability of the technology, the initiative taken by the Indian government makes it a suitable alternative for the companies to look at. Further concept of IOT is looked at as an important factor and is expected to capture close to 20% of the overall IOT share of the globe. Government of India looks at the initiatives of green corridor, setting up of isolated warehousing environments and make in India initiative encourages company to setup shops in India. Due to these initiatives India looks at leapfrogging the world’s major players like China, Germany, USA as a major technological player for the industries to look at. Further for any industry to succeed the labor has to be skilled which India has in abundance. This report looks at the different concepts that may affect a typical warehousing scenario and how it affects the overall performance. Human machine interaction will play an important factor in determining the efficiency of the process. Further as a prospective solution the concept of least action is proposed where there is an optimal solution from the infinite paths. The proposed theory is simple and can be used for real time obstacle detection for a complex environment. The proposed concept can be looked at for a multi-robot system and IOT can be used for better control of the proposed robotic system in the warehouse.
We would like to thank, “Common Engineering Facility Centre (CEFC) IISc, Bangalore; Centre for Product Design and Manufacturing (CPDM), Department of Heavy Industries (DHI), Govt. of India,” for their support in this endeavour.
There is a hypothesis that the strengthening of hybridization processes in the secondary distribution range contributes to more successful existence of plants in their new homeland [1, 2]. Under unusual conditions, alien species can form hybrids with closely related native species, as well as with other alien plants inhabiting a given area. Often, hybrids are better adapted to secondary distribution range conditions than parent taxa [3, 4, 5], resulting in landscapes in a new home area. Successful recombination of genetic traits of parent species reduces the lag phase (a period of adaptation of an alien taxon to new conditions during which there is not yet active introduction into natural phytocoenosis and expansion of the secondary distribution range) and leads to the formation of new active “species transformers.” Cross-pollinated plant species are the most predisposed to hybridization. Sympatric species are less likely to be cross-species hybridized than allopatric species or populations [6]. The share of hybrid taxa among invasive species of Middle Russia reaches 10% [7].
For a long time, the most important factor in limiting hybridization was geographical isolation, but nowadays closely related taxa come into contact with each other through a multitude of anthropogenic “corridors” [8]. Thus, inter-regional immigration occurs by means of the introduction of plants, which can be frequent and repetitive, and therefore it significantly increases immigration flow [9]. If we consider the situation where conditions for the hybridization of closely related taxa already exist, there may be several possible developments that coexist: (a) New hybrid taxon may appear, and (b) native taxon disappears. During hybridization, genetic assimilation occurs, and new genes are injected into one or both parent species. Hybrids, even being fertile, can, however, be reproductively isolated from parent plants due to the effect of the selection on reproductive traits (allopolyploidy, heterozygous translocations, recombination, mitochondrial DNA-specific differences) and/or due to factors that predetermine crossing (flowering phenology, separation of ecological niches). Interspecific hybridization may also facilitate the naturalization of rare genotypes and cause an increase in their proportion by inverse crossbreeding with alien parent taxa or hybridization between the hybrids themselves. Greater selection advantages for alien alleles should lead to faster replacement of natural alleles through hybridization and slower replacement without hybridization [10]. The period of displacement (substitution) decreases significantly with increasing immigration flow and selective differentiation. Immigration and selection operate in a variety of ways: increasing immigration levels result in the substitution of native species by suppressing them, while increasing selective differentiation in favor of an alien species results in the substitution of an alien species by genetic assimilation without leaving “pure” native species. At moderate and high immigration rates, the loss of native species can be rapid with or without hybridization. Given the high number of species introduced by humans, the loss of native species can increase only as a result of hybridization [11].
Hybridization increases the threat of extinction of many species due to introgression [12, 13]. High degree of introgression is often manifested by wind-pollinated species such as oaks. Hybridization and introgression can lead to a hybrid complex consisting of many hybrids due to a large number of loci. Thus, multiloci seem to increase the number of hybrid types and genetic complexes and accelerate the reduction of “pure” natural species. In addition, the large number of loci essentially reduces the probability of having a “pure” individual of any parent origin [11]. Without introgression, hybrids, being reproductively isolated, can quickly form a new species. With introgression, speciation slows down as inverse crosses with parent lines occur. The impact of hybridization and introgression on the rate of substitution of native species by closely related ones has been addressed by a mathematical model involving a one-loop bipartite inheritance scheme with different levels of cross-species hybridization [11]. Although the model did not take into account vegetatively propagating hybrids, the results showed that the substitution of natural taxa by alien ones could occur very quickly (in less than five generations). According to the results, hybridization and introgression can increase the degree of substitution of native species by non-native ones. Introgression increases species substitution with low immigration, but prevents substitution when an indigenous species has a significant advantage in selection as well as with higher immigration levels. However, as introductions are associated with increased frequency of hybrids, the impact on the indigenous taxon remains high, and the likelihood of extinction increases significantly [11].
It is known that the highest invasive activity is exhibited by species of Asteraceae family [14], so we have focused our attention on representatives of this group of alien species. It is often impossible to say with certainty whether plants with intermediate morphological features are hybrids (between two species of the same genus). This may also be the case for new ecological forms, resulting from microevolution of species. To confirm or disprove the hypothesis about hybrid origin of certain taxon, it is best to use molecular genetic methods.
DNA was extracted from silica gel dried leaves of
Sample no. | Number of ITS/rpl32–trnL/trnL–trnF sequence in GeneBank | Taxon | Date and place of collection, notes |
---|---|---|---|
de_1a | МК559763/ – /MK575566 | (= “ | Russia, Kaluga region, Milyatinsky Reservoir, 2013 54.4914° N, 34.3393° E |
de _1b | МК559764/ – /MK575567 | ||
de _1c | МК559765/ – / MK575568 | ||
de _1d | МК559766/ – /MK575569 | ||
de _2a | МК559767/ – /MK575570 | Russia, Kaliningrad region, 2013 54.95° N, 20.49° E | |
de _2b | МК559768/ – /MK575571 | ||
de _2c | МК559769/ – /MK575572 | ||
de _2d | МК559770/ – / – | ||
de _3a | МК559771/ – /MK575573 | Russia, Vladimir region, near Tasinsky village, 2014 Formed with dissected lower leaves 55.567° N, 40.172° E | |
de _3b | МК559772/ – / – | ||
de _3c | МК559773/ – / MK575574 | ||
de _4a | МК559774/ – /MK575575 | Russia, Vladimir region, near Tasinsky village, 2014 Formed with whole lower leaves 55.567° N, 40.172° E | |
de _4b | МК559775/ – /MK575576 | ||
fr_5a | МК559780/ – /MK575581 | Russia, Vladimir region, near Tasinsky village, 2014 55.567° N, 40.172° E | |
fr_5b | МК559781/ – /MK575582 | Russia, Vladimir region, near Tasinsky village, 2018 55.567° N, 40.172° E | |
fr_5c | МК559782/ – /MK575583 | ||
cr_6a | МК559755/ – /MK575559 | Russia, Moscow region, near Zvenigorod town, 2014 55.69° N, 36.74° E | |
cr_6b | МК559756/ – /MK575560 | ||
t_7 | МК559754/ – /MK575558 | Russia, Vladimir region, near Tasinsky village, 2018 55.567° N, 40.172° E | |
cr_8a | МК559757/ – /MK575561 | ||
cr_8b | МК559758/ – /MK575562 | ||
cr_8c | МК559759/ – /− | ||
cr_9a | МК559760/ – /MK575563 | Belarus, Dzerzhinsk, 2018 53.693° N, 27.165° E | |
сr_9b | МК559761/ – /MK575564 | ||
cr_9c | МК559762/ – /MK575565 | ||
fr_10a | МК559783/ – /MK575584 | ||
fr_10b | МК559784/ – /MK575585 | ||
de _11a | МК559776/ – /MK575577 | ||
de _11b | МК559777/ – /MK575578 | ||
de _11c | МК559778/ – /MK575579 | ||
de _13 | МК559779/ – /MK575580 | Russia, Moscow, park near Sviblovo estate, 2018 55.8639° N, 37.6396° E | |
v_1a | MK491849/MK474079/ – | Russia, Pskov region, Pskov district, vicinity of Pskov, idle field, 2018 57.80° N, 28.25° E | |
v_1b | MK491850/MK474080/ – | ||
v_1c | MK491851/MK474081/ – | ||
n_2a | MK491852/MK474082/ – | ||
n_2b | MK491853/MK474083/ – | ||
n_2c | – /MK474084/ – | ||
c_3a | MK491854/MK474085/ – | ||
c_3b | MK491855/MK474086/ – | ||
c_3c | MK491856/MK474087/ – | ||
v_4 | – /MK474088/ – | Russia, Moscow region, Chekhov district, near the village of Chudinovo, idle field, 2018 55.1° N, 37.5° E | |
c_5a | MK491857/MK474090/ – | ||
c_5b | – /MK474089/ – | ||
v_6a | MK491858/− / – | Russia, Moscow region, “Losiny Ostrov” National Park, Pine forest, 2014 55.89° N, 37.77° E | |
v_6b | MK491859/− / – | ||
3 | MK397980/− / – | Italy, Pompeii, 2016 40.7° N, 14.5° E | |
5a | MK397981/− / – | Italy, the Island of Ischia, 2016 40.7° N, 13.9° E | |
5b | MK397982/− / – | ||
5c | MK397983/− / – | ||
6 | MK397984/− / – | Italy, Herculaneum, 2016 40.8° N, 14.4° E | |
8a | MK397986/− / – | Italy, Naples, 2016 40.8° N, 14.2° E | |
8b | MK397987/− / – | ||
10a | MK397988/− / – | Italy, Pompeii, 2016 40.7° N, 14.5° E | |
10b | MK397989/− / – | ||
13a | MK397991/− / – | Italy, the Island of Ischia, 2016 40.7° N, 13.9° E | |
13b | MK397992/− / – | ||
16 | MK397985/− / – | Portugal, Lisbon, 2017 38.7° N, 9.1° W | |
18 | MK397993/− / – | Spain, Madrid, park, 2017 40.4° N, 3.7° W | |
19 | MK397994/− / – | ||
20 | MK397995/− / – | ||
22 | MK397990/− / – |
Samples of the studied taxa of Asteraceae.
Note: “E. sumatrensis × E. canadensis (?)” – putative hybrids.
Map of the secondary distribution range of
Nucleotide sequence analysis shows that not all individuals defined as
Fragment of ITS1-ITS2 site of nuclear DNA of various taxa of
Based on the nucleotide sequences of the ITS1-ITS2 site in the SplitsTree program, the dendrogram is built using the UPGMA method (Figure 3). With high probability (with 100% bootstrap support), two clades were separated—sample t_7 (
Dendrogram based on analysis of the ITS region of DNA of various
For trnL-trnF site of chloroplast DNA, samples of
Fragment of the trnL-trnF intergenic spacer of chloroplast DNA of various taxa of
We have set ourselves the task to study the features of
The main difference between the hybrid
Panicles of
The size of the heads themselves also varies (Figure 6).
Parameters of flower heads of
With regard to the length of the head,
Sample no. | Position in the alignment | |||
---|---|---|---|---|
384 | 431 | 508 | 549 | |
v_1a | T | A | C | A |
v_1b | T | A | C | A |
v_1c | T | A | C | A |
n_2a | Y | M | Y | R |
n_2b | Y | M | Y | R |
c_3a | C | C | T | G |
c_3b | C | C | T | G |
c_3c | Y | M | T | R |
c_5a | C | C | T | G |
v_6a | T | A | C | A |
v_6b | T | A | C | A |
ITS1-ITS2 polymorphism for the
The nucleotides are coded using IUPAC nomenclature.
The analysis of the rpl32-trnL high-variable intergenic spacer made it impossible to give an unambiguous answer which species is maternal to
Sample no. | Position in the alignment | ||||
---|---|---|---|---|---|
191 | 242–264 | 271–306 (292–330) | 739–741 (746–748, 709–714) | 894 (900, 923) | |
v_1a | A | — | TGTCTAAAAGAATAATTCTTGTATTTCTT | T | C |
v_1b | C | — | TGTCTAAAAGAATAATTCTTGTATTTCTTGAATTCT | T | C |
v_1c | C | — | TGTCTAAAAGAATAATTCTTGTATTTCTTGAATTCT | — | C |
n_2a | C | — | TGTCTAAAAGAATAATTCTTGTATTTCTTGAATTCT | — | C |
n_2b | C | — | TGTCTAAAAGAATAATTCTTGTATTTCTTGAATTCT | T | C |
n_2c | C | — | TGTCTAAAAGAATAATTCTTGTATTTCTTGAATTCT | T | C |
c_3a | A | GAATCTTAATGTTATGTCTAAA | TGTCTAAAAGAATAATTCTTGTATTTCTT | T | A |
c_3b | A | — | TGTCTAAAAGAATAATTCTTGTATTTCTTGAATTCT | TTTT | A |
c_3c | C | — | — | — | C |
v_4 | C | — | TGTCTAAAAGAATAATTCTTGTATTTCTTGAATTCT | TT | C |
c_5a | C | — | — | T | C |
c_5b | A | — | — | TTTT | A |
Polymorphism of the rpl32-trnL region for the Solidago × niederederi hybrid and parental species.
The nucleotides are coded using IUPAC nomenclature.
Earlier we studied in detail morphological differences between species of the genus
Features | |||
---|---|---|---|
Number of heads/generative shoot | 500–600 | No more 30 | less 500 |
Diameter of heads, mm | 4.8 ± 0.1 × 2.4 ± 0.1 | 6.1 ± 0.1 × 5.2 ± 0.2 | 6.6 ± 0.1 × 3.2 ± 0.2 At the base, swollen |
Structure of shoot systems | The main shoot is barely branched off and ends in a compound raceme occupying the upper third of the escape | The lower lateral deciduous axes of the inflorescence overturn the main shoot axis; the inflorescence covers the upper third of the shoot | The lower lateral deciduous inflorescences are shorter than the main axis of the shoot; the diamond-shaped compound raceme is half the length of the generative shoot |
Shape of leaves | Linear-lanceolate with denticle margin | Almost linear with 3–5 denticles | Lanceolate-oval with a serrated margin |
Type of pubescence | The leaves are light green, slightly pubescent, the stem is light green, strongly pubescent | The leaves are gray-green, the pubescent leaves and stems are strongly pubescent with long silvery trichomes | The leaves are dark green, softly pubescent, the stems are grayish with abundant soft pubescence |
Diagnostic morphological features of
Previously a hybrid of
The analysis of the
Sample no. | Taxa | Position in the alignment | ||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
65, 129, 136, 137, 238, 472/473, 570/571 | 72, 87, 249, 404 | 83, 576/577 | 95 | 114 | 130, 567/568, 568/569 | 211-212 | 242 | 412 | 430 | 461, 584/585 | 469 | 471/472, 530/531, 558/559 | 499/500 | 502/503 | 520/521 | 535/536 | 559/560 | 598-600 | ||
3 | Т | C | A | C | C | T | YY | C | C | G | G | — | C | A | C | R | Y | R | TCT | |
5a | T | C | A | C | C | T | TC | C | C | R | G | — | C | A | C | R | Y | R | TCT | |
5b | T | C | A | C | C | T | TC | C | Y | R | G | — | C | A | C | R | C | R | TCT | |
5c | T | C | A | C | C | T | TC | Y | C | R | G | — | C | A | S | R | Y | R | TCT | |
6 | T | C | A | C | S | T | TC | Y | C | R | G | — | C | A | S | R | Y | R | TCT | |
16 | T | C | A | Y | C | T | YY | C | C | G | G | — | C | A | S | R | C | A | TCT | |
8a | T | C | A | Y | C | T | YY | C | C | R | G | — | C | A | S | G | Y | R | TCT | |
8b | T | C | A | Y | C | T | YY | C | C | R | G | — | C | A | S | R | Y | R | TCT | |
10a | T | C | A | Y | C | T | YY | C | C | G | G | — | C | A | S | R | Y | R | TCT | |
10b | T | C | A | C | C | T | TC | C | C | R | G | — | C | A | S | R | Y | R | TCT | |
22 | T | C | A | Y | C | T | YY | C | C | R | G | — | C | A | Y | R | C | R | TCT | |
13a | C | T | C | C | C | A | CC | C | C | G | G | T | A | T | C | A | C | A | — | |
13b | C | T | C | C | C | A | CC | C | C | G | A | T | A | T | C | A | C | A | — | |
18 | C | T | C | C | C | A | CC | C | C | G | A | T | A | T | C | A | C | A | — | |
19 | C | T | C | C | C | A | CC | C | C | G | A | T | A | T | C | A | C | A | — | |
20 | C | T | C | C | C | A | CC | C | C | G | A | T | A | T | C | A | C | A | — |
ITS1-ITS2 polymorphism for different taxa of
The nucleotides are coded using IUPAC nomenclature.
Note: “E. sumatrensis × E. canadensis (?)” – putative hybrids.
Thus, the obtained data on hybrid activity among the Asteraceae family of invasive species are ambiguous.
Hybrid
In the northwest of Russia, the populations of three taxa of
In Southern Europe, the hybriogenic activity of representatives of the genus
Our data on the rare occurrence of hybrids in comparison with parental species in the Asteraceae family contradict the hypothesis explaining the success of plant growth in the new homeland by strengthening hybridization processes in the secondary distribution range [1, 2], but this situation may change in the coming decades, so the hybriogenic activity of invasive species requires attention of the scientific community.
This study was carried out with partial support from the Russian Foundation for Basic Research, grant no. 18-04-00411.
The authors declare no conflict of interest.
This is a brief overview of the main steps involved in publishing with IntechOpen Compacts, Monographs and Edited Books. Once you submit your proposal you will be appointed a Author Service Manager who will be your single point of contact and lead you through all the described steps below.
",metaTitle:"Publishing Process Steps and Descriptions",metaDescription:"This is a brief overview of the main steps involved in publishing with InTechOpen Compacts, Monographs and Edited Books. Once you submit your proposal you will be appointed a Publishing Process Manager who will be your single point of contact and lead you through all the described steps below.",metaKeywords:null,canonicalURL:"page/publishing-process-steps",contentRaw:'[{"type":"htmlEditorComponent","content":"1. SEND YOUR PROPOSAL
\\n\\nPlease complete the publishing proposal form. The completed form should serve as an overview of your future Compacts, Monograph or Edited Book. Once submitted, your publishing proposal will be sent for evaluation, and a notice of acceptance or rejection will be sent within 10 to 30 working days from the date of submission.
\\n\\n2. SUBMIT YOUR MANUSCRIPT
\\n\\nAfter approval, you will proceed in submitting your full-length manuscript. 50-130 pages for compacts, 130-500 for Monographs & Edited Books.Your full-length manuscript must follow IntechOpen's Author Guidelines and comply with our publishing rules. Once the manuscript is submitted, but before it is forwarded for peer review, it will be screened for plagiarism.
\\n\\n3. PEER REVIEW RESULTS
\\n\\nExternal reviewers will evaluate your manuscript and provide you with their feedback. You may be asked to revise your draft, or parts of your draft, provide additional information and make any other necessary changes according to their comments and suggestions.
\\n\\n4. ACCEPTANCE AND PRICE QUOTE
\\n\\nIf the manuscript is formally accepted after peer review you will receive a formal Notice of Acceptance, and a price quote.
\\n\\nThe Open Access Publishing Fee of your IntechOpen Compacts, Monograph or Edited Book depends on the volume of the publication and includes: project management, editorial and peer review services, technical editing, language copyediting, cover design and book layout, book promotion and ISBN assignment.
\\n\\nWe will send you your price quote and after it has been accepted (by both the author and the publisher), both parties will sign a Statement of Work binding them to adhere to the agreed upon terms.
\\n\\nAt this step you will also be asked to accept the Copyright Agreement.
\\n\\n5. LANGUAGE COPYEDITING, TECHNICAL EDITING AND TYPESET PROOF
\\n\\nYour manuscript will be sent to Straive, a leader in content solution services, for language copyediting. You will then receive a typeset proof formatted in XML and available online in HTML and PDF to proofread and check for completeness. The first typeset proof of your manuscript is usually available 10 days after its original submission.
\\n\\nAfter we receive your proof corrections and a final typeset of the manuscript is approved, your manuscript is sent to our in house DTP department for technical formatting and online publication preparation.
\\n\\nAdditionally, you will be asked to provide a profile picture (face or chest-up portrait photograph) and a short summary of the book which is required for the book cover design.
\\n\\n6. INVOICE PAYMENT
\\n\\nThe invoice is generally paid by the author, the author’s institution or funder. The payment can be made by credit card from your Author Panel (one will be assigned to you at the beginning of the project), or via bank transfer as indicated on the invoice. We currently accept the following payment options:
\\n\\nIntechOpen will help you complete your payment safely and securely, keeping your personal, professional and financial information safe.
\\n\\n7. ONLINE PUBLICATION, PRINT AND DELIVERY OF THE BOOK
\\n\\nIntechOpen authors can choose whether to publish their book online only or opt for online and print editions. IntechOpen Compacts, Monographs and Edited Books will be published on www.intechopen.com. If ordered, print copies are delivered by DHL within 12 to 15 working days.
\\n\\nIf you feel that IntechOpen Compacts, Monographs or Edited Books are the right publishing format for your work, please fill out the publishing proposal form. For any specific queries related to the publishing process, or IntechOpen Compacts, Monographs & Edited Books in general, please contact us at book.department@intechopen.com
\\n"}]'},components:[{type:"htmlEditorComponent",content:'1. SEND YOUR PROPOSAL
\n\nPlease complete the publishing proposal form. The completed form should serve as an overview of your future Compacts, Monograph or Edited Book. Once submitted, your publishing proposal will be sent for evaluation, and a notice of acceptance or rejection will be sent within 10 to 30 working days from the date of submission.
\n\n2. SUBMIT YOUR MANUSCRIPT
\n\nAfter approval, you will proceed in submitting your full-length manuscript. 50-130 pages for compacts, 130-500 for Monographs & Edited Books.Your full-length manuscript must follow IntechOpen's Author Guidelines and comply with our publishing rules. Once the manuscript is submitted, but before it is forwarded for peer review, it will be screened for plagiarism.
\n\n3. PEER REVIEW RESULTS
\n\nExternal reviewers will evaluate your manuscript and provide you with their feedback. You may be asked to revise your draft, or parts of your draft, provide additional information and make any other necessary changes according to their comments and suggestions.
\n\n4. ACCEPTANCE AND PRICE QUOTE
\n\nIf the manuscript is formally accepted after peer review you will receive a formal Notice of Acceptance, and a price quote.
\n\nThe Open Access Publishing Fee of your IntechOpen Compacts, Monograph or Edited Book depends on the volume of the publication and includes: project management, editorial and peer review services, technical editing, language copyediting, cover design and book layout, book promotion and ISBN assignment.
\n\nWe will send you your price quote and after it has been accepted (by both the author and the publisher), both parties will sign a Statement of Work binding them to adhere to the agreed upon terms.
\n\nAt this step you will also be asked to accept the Copyright Agreement.
\n\n5. LANGUAGE COPYEDITING, TECHNICAL EDITING AND TYPESET PROOF
\n\nYour manuscript will be sent to Straive, a leader in content solution services, for language copyediting. You will then receive a typeset proof formatted in XML and available online in HTML and PDF to proofread and check for completeness. The first typeset proof of your manuscript is usually available 10 days after its original submission.
\n\nAfter we receive your proof corrections and a final typeset of the manuscript is approved, your manuscript is sent to our in house DTP department for technical formatting and online publication preparation.
\n\nAdditionally, you will be asked to provide a profile picture (face or chest-up portrait photograph) and a short summary of the book which is required for the book cover design.
\n\n6. INVOICE PAYMENT
\n\nThe invoice is generally paid by the author, the author’s institution or funder. The payment can be made by credit card from your Author Panel (one will be assigned to you at the beginning of the project), or via bank transfer as indicated on the invoice. We currently accept the following payment options:
\n\nIntechOpen will help you complete your payment safely and securely, keeping your personal, professional and financial information safe.
\n\n7. ONLINE PUBLICATION, PRINT AND DELIVERY OF THE BOOK
\n\nIntechOpen authors can choose whether to publish their book online only or opt for online and print editions. IntechOpen Compacts, Monographs and Edited Books will be published on www.intechopen.com. If ordered, print copies are delivered by DHL within 12 to 15 working days.
\n\nIf you feel that IntechOpen Compacts, Monographs or Edited Books are the right publishing format for your work, please fill out the publishing proposal form. For any specific queries related to the publishing process, or IntechOpen Compacts, Monographs & Edited Books in general, please contact us at book.department@intechopen.com
\n'}]},successStories:{items:[]},authorsAndEditors:{filterParams:{},profiles:[{id:"396",title:"Dr.",name:"Vedran",middleName:null,surname:"Kordic",slug:"vedran-kordic",fullName:"Vedran Kordic",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/396/images/7281_n.png",biography:"After obtaining his Master's degree in Mechanical Engineering he continued his education at the Vienna University of Technology where he obtained his PhD degree in 2004. He worked as a researcher at the Automation and Control Institute, Faculty of Electrical Engineering, Vienna University of Technology until 2008. His studies in robotics lead him not only to a PhD degree but also inspired him to co-found and build the International Journal of Advanced Robotic Systems - world's first Open Access journal in the field of robotics.",institutionString:null,institution:{name:"TU Wien",country:{name:"Austria"}}},{id:"441",title:"Ph.D.",name:"Jaekyu",middleName:null,surname:"Park",slug:"jaekyu-park",fullName:"Jaekyu Park",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/441/images/1881_n.jpg",biography:null,institutionString:null,institution:{name:"LG Corporation (South Korea)",country:{name:"Korea, South"}}},{id:"465",title:"Dr",name:"Christian",middleName:null,surname:"Martens",slug:"christian-martens",fullName:"Christian Martens",position:null,profilePictureURL:"//cdnintech.com/web/frontend/www/assets/author.svg",biography:null,institutionString:null,institution:null},{id:"479",title:"Dr.",name:"Valentina",middleName:null,surname:"Colla",slug:"valentina-colla",fullName:"Valentina Colla",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/479/images/358_n.jpg",biography:null,institutionString:null,institution:{name:"Sant'Anna School of Advanced Studies",country:{name:"Italy"}}},{id:"494",title:"PhD",name:"Loris",middleName:null,surname:"Nanni",slug:"loris-nanni",fullName:"Loris Nanni",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/494/images/system/494.jpg",biography:"Loris Nanni received his Master Degree cum laude on June-2002 from the University of Bologna, and the April 26th 2006 he received his Ph.D. in Computer Engineering at DEIS, University of Bologna. On September, 29th 2006 he has won a post PhD fellowship from the university of Bologna (from October 2006 to October 2008), at the competitive examination he was ranked first in the industrial engineering area. He extensively served as referee for several international journals. He is author/coauthor of more than 100 research papers. He has been involved in some projects supported by MURST and European Community. His research interests include pattern recognition, bioinformatics, and biometric systems (fingerprint classification and recognition, signature verification, face recognition).",institutionString:null,institution:null},{id:"496",title:"Dr.",name:"Carlos",middleName:null,surname:"Leon",slug:"carlos-leon",fullName:"Carlos Leon",position:null,profilePictureURL:"//cdnintech.com/web/frontend/www/assets/author.svg",biography:null,institutionString:null,institution:{name:"University of Seville",country:{name:"Spain"}}},{id:"512",title:"Dr.",name:"Dayang",middleName:null,surname:"Jawawi",slug:"dayang-jawawi",fullName:"Dayang Jawawi",position:null,profilePictureURL:"//cdnintech.com/web/frontend/www/assets/author.svg",biography:null,institutionString:null,institution:{name:"University of Technology Malaysia",country:{name:"Malaysia"}}},{id:"528",title:"Dr.",name:"Kresimir",middleName:null,surname:"Delac",slug:"kresimir-delac",fullName:"Kresimir Delac",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/528/images/system/528.jpg",biography:"K. Delac received his B.Sc.E.E. degree in 2003 and is currentlypursuing a Ph.D. degree at the University of Zagreb, Faculty of Electrical Engineering andComputing. His current research interests are digital image analysis, pattern recognition andbiometrics.",institutionString:null,institution:{name:"University of Zagreb",country:{name:"Croatia"}}},{id:"557",title:"Dr.",name:"Andon",middleName:"Venelinov",surname:"Topalov",slug:"andon-topalov",fullName:"Andon Topalov",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/557/images/1927_n.jpg",biography:"Dr. Andon V. Topalov received the MSc degree in Control Engineering from the Faculty of Information Systems, Technologies, and Automation at Moscow State University of Civil Engineering (MGGU) in 1979. He then received his PhD degree in Control Engineering from the Department of Automation and Remote Control at Moscow State Mining University (MGSU), Moscow, in 1984. From 1985 to 1986, he was a Research Fellow in the Research Institute for Electronic Equipment, ZZU AD, Plovdiv, Bulgaria. In 1986, he joined the Department of Control Systems, Technical University of Sofia at the Plovdiv campus, where he is presently a Full Professor. He has held long-term visiting Professor/Scholar positions at various institutions in South Korea, Turkey, Mexico, Greece, Belgium, UK, and Germany. And he has coauthored one book and authored or coauthored more than 80 research papers in conference proceedings and journals. His current research interests are in the fields of intelligent control and robotics.",institutionString:null,institution:{name:"Technical University of Sofia",country:{name:"Bulgaria"}}},{id:"585",title:"Prof.",name:"Munir",middleName:null,surname:"Merdan",slug:"munir-merdan",fullName:"Munir Merdan",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/585/images/system/585.jpg",biography:"Munir Merdan received the M.Sc. degree in mechanical engineering from the Technical University of Sarajevo, Bosnia and Herzegovina, in 2001, and the Ph.D. degree in electrical engineering from the Vienna University of Technology, Vienna, Austria, in 2009.Since 2005, he has been at the Automation and Control Institute, Vienna University of Technology, where he is currently a Senior Researcher. His research interests include the application of agent technology for achieving agile control in the manufacturing environment.",institutionString:null,institution:null},{id:"605",title:"Prof",name:"Dil",middleName:null,surname:"Hussain",slug:"dil-hussain",fullName:"Dil Hussain",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/605/images/system/605.jpg",biography:"Dr. Dil Muhammad Akbar Hussain is a professor of Electronics Engineering & Computer Science at the Department of Energy Technology, Aalborg University Denmark. Professor Akbar has a Master degree in Digital Electronics from Govt. College University, Lahore Pakistan and a P-hD degree in Control Engineering from the School of Engineering and Applied Sciences, University of Sussex United Kingdom. Aalborg University has Two Satellite Campuses, one in Copenhagen (Aalborg University Copenhagen) and the other in Esbjerg (Aalborg University Esbjerg).\n· He is a member of prestigious IEEE (Institute of Electrical and Electronics Engineers), and IAENG (International Association of Engineers) organizations. \n· He is the chief Editor of the Journal of Software Engineering.\n· He is the member of the Editorial Board of International Journal of Computer Science and Software Technology (IJCSST) and International Journal of Computer Engineering and Information Technology. \n· He is also the Editor of Communication in Computer and Information Science CCIS-20 by Springer.\n· Reviewer For Many Conferences\nHe is the lead person in making collaboration agreements between Aalborg University and many universities of Pakistan, for which the MOU’s (Memorandum of Understanding) have been signed.\nProfessor Akbar is working in Academia since 1990, he started his career as a Lab demonstrator/TA at the University of Sussex. After finishing his P. hD degree in 1992, he served in the Industry as a Scientific Officer and continued his academic career as a visiting scholar for a number of educational institutions. In 1996 he joined National University of Science & Technology Pakistan (NUST) as an Associate Professor; NUST is one of the top few universities in Pakistan. In 1999 he joined an International Company Lineo Inc, Canada as Manager Compiler Group, where he headed the group for developing Compiler Tool Chain and Porting of Operating Systems for the BLACKfin processor. The processor development was a joint venture by Intel and Analog Devices. In 2002 Lineo Inc., was taken over by another company, so he joined Aalborg University Denmark as an Assistant Professor.\nProfessor Akbar has truly a multi-disciplined career and he continued his legacy and making progress in many areas of his interests both in teaching and research. He has contributed in stochastic estimation of control area especially, in the Multiple Target Tracking and Interactive Multiple Model (IMM) research, Ball & Beam Control Problem, Robotics, Levitation Control. He has contributed in developing Algorithms for Fingerprint Matching, Computer Vision and Face Recognition. He has been supervising Pattern Recognition, Formal Languages and Distributed Processing projects for several years. He has reviewed many books on Management, Computer Science. Currently, he is an active and permanent reviewer for many international conferences and symposia and the program committee member for many international conferences.\nIn teaching he has taught the core computer science subjects like, Digital Design, Real Time Embedded System Programming, Operating Systems, Software Engineering, Data Structures, Databases, Compiler Construction. In the Engineering side, Digital Signal Processing, Computer Architecture, Electronics Devices, Digital Filtering and Engineering Management.\nApart from his Academic Interest and activities he loves sport especially, Cricket, Football, Snooker and Squash. He plays cricket for Esbjerg city in the second division team as an opener wicket keeper batsman. He is a very good player of squash but has not played squash since his arrival in Denmark.",institutionString:null,institution:null},{id:"611",title:"Prof.",name:"T",middleName:null,surname:"Nagarajan",slug:"t-nagarajan",fullName:"T Nagarajan",position:null,profilePictureURL:"//cdnintech.com/web/frontend/www/assets/author.svg",biography:null,institutionString:null,institution:{name:"Universiti Teknologi Petronas",country:{name:"Malaysia"}}}],filtersByRegion:[{group:"region",caption:"North America",value:1,count:6675},{group:"region",caption:"Middle and South America",value:2,count:5955},{group:"region",caption:"Africa",value:3,count:2460},{group:"region",caption:"Asia",value:4,count:12718},{group:"region",caption:"Australia and Oceania",value:5,count:1018},{group:"region",caption:"Europe",value:6,count:17721}],offset:12,limit:12,total:134178},chapterEmbeded:{data:{}},editorApplication:{success:null,errors:{}},ofsBooks:{filterParams:{hasNoEditors:"0",sort:"-dateEndThirdStepPublish",src:"N-T-0-T2"},books:[{type:"book",id:"9985",title:"Geostatistics",subtitle:null,isOpenForSubmission:!0,hash:"423cb3896195a618c4acb493ce4fd23d",slug:null,bookSignature:"Prof. Jeffrey M. Yarus, Dr. Marko Maucec, Dr. Timothy C. Coburn and Associate Prof. Michael Pyrcz",coverURL:"https://cdn.intechopen.com/books/images_new/9985.jpg",editedByType:null,editors:[{id:"78011",title:"Prof.",name:"Jeffrey M.",surname:"Yarus",slug:"jeffrey-m.-yarus",fullName:"Jeffrey M. Yarus"}],productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"12058",title:"Future Housing",subtitle:null,isOpenForSubmission:!0,hash:"e7f4a1e57fab392b61156956c1247b9e",slug:null,bookSignature:"Dr. Ivan Oropeza-Perez and Dr. Astrid Helena Petzold-Rodríguez",coverURL:"https://cdn.intechopen.com/books/images_new/12058.jpg",editedByType:null,editors:[{id:"282172",title:"Dr.",name:"Ivan",surname:"Oropeza-Perez",slug:"ivan-oropeza-perez",fullName:"Ivan Oropeza-Perez"}],productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"12215",title:"Cell Death and Disease",subtitle:null,isOpenForSubmission:!0,hash:"dfd456a29478fccf4ebd3294137eb1e3",slug:null,bookSignature:"Dr. Ke Xu",coverURL:"https://cdn.intechopen.com/books/images_new/12215.jpg",editedByType:null,editors:[{id:"59529",title:"Dr.",name:"Ke",surname:"Xu",slug:"ke-xu",fullName:"Ke Xu"}],productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"12112",title:"The Colorectal Surgery",subtitle:null,isOpenForSubmission:!0,hash:"21c65e742d31d5b69fb681ef78cfa0be",slug:null,bookSignature:"Dr. Muhammad Shamim",coverURL:"https://cdn.intechopen.com/books/images_new/12112.jpg",editedByType:null,editors:[{id:"235128",title:"Dr.",name:"Muhammad",surname:"Shamim",slug:"muhammad-shamim",fullName:"Muhammad Shamim"}],productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"12079",title:"Strategies Towards the Synthesis of Heterocycles and Their Applications",subtitle:null,isOpenForSubmission:!0,hash:"bc4022af925c0883636e0819008971ee",slug:null,bookSignature:"Dr. Premlata Kumari and Dr. Amit B Patel",coverURL:"https://cdn.intechopen.com/books/images_new/12079.jpg",editedByType:null,editors:[{id:"177041",title:"Dr.",name:"Premlata",surname:"Kumari",slug:"premlata-kumari",fullName:"Premlata Kumari"}],productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"11998",title:"Biocomposites - Recent Advances",subtitle:null,isOpenForSubmission:!0,hash:"8bc7ffd7544fff1901301c787e64fada",slug:null,bookSignature:"Prof. Magdy Elnashar",coverURL:"https://cdn.intechopen.com/books/images_new/11998.jpg",editedByType:null,editors:[{id:"12075",title:"Prof.",name:"Magdy",surname:"Elnashar",slug:"magdy-elnashar",fullName:"Magdy Elnashar"}],productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"11999",title:"Earthquakes - Recent Advances, New Perspectives and Applications",subtitle:null,isOpenForSubmission:!0,hash:"b2af07109b13b76e5af9583532ab5bee",slug:null,bookSignature:"Dr. Walter Salazar",coverURL:"https://cdn.intechopen.com/books/images_new/11999.jpg",editedByType:null,editors:[{id:"236461",title:"Dr.",name:"Walter",surname:"Salazar",slug:"walter-salazar",fullName:"Walter Salazar"}],productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"11500",title:"Multi-Objective Optimization - Recent Advances, New Perspectives and Applications",subtitle:null,isOpenForSubmission:!0,hash:"842f84f308439c0a55c4e8e6a8fd9c01",slug:null,bookSignature:"Dr. Adel El-Shahat",coverURL:"https://cdn.intechopen.com/books/images_new/11500.jpg",editedByType:null,editors:[{id:"193331",title:"Dr.",name:"Adel",surname:"El-Shahat",slug:"adel-el-shahat",fullName:"Adel El-Shahat"}],productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"12172",title:"Health Risks of Food Additives - Recent Developments and Trends in Food Sector",subtitle:null,isOpenForSubmission:!0,hash:"f6aa23b1045d266d0928fcef04fa3417",slug:null,bookSignature:"Dr. Muhammad Sajid Arshad and Mr. Waseem Khalid",coverURL:"https://cdn.intechopen.com/books/images_new/12172.jpg",editedByType:null,editors:[{id:"192998",title:"Dr.",name:"Muhammad Sajid",surname:"Arshad",slug:"muhammad-sajid-arshad",fullName:"Muhammad Sajid Arshad"}],productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"12113",title:"Tendons - Trauma, Inflammation, Degeneration, and Treatment",subtitle:null,isOpenForSubmission:!0,hash:"2387a4e0d2a76883b16dcccd452281ab",slug:null,bookSignature:"Dr. Nahum Rosenberg",coverURL:"https://cdn.intechopen.com/books/images_new/12113.jpg",editedByType:null,editors:[{id:"68911",title:"Dr.",name:"Nahum",surname:"Rosenberg",slug:"nahum-rosenberg",fullName:"Nahum Rosenberg"}],productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"12196",title:"Sepsis - New Perspectives",subtitle:null,isOpenForSubmission:!0,hash:"3590e6f6047122bd96d1d57da29c4054",slug:null,bookSignature:"Dr. Lixing Huang, Dr. Youyu Zhang and Dr. Lingbin Sun",coverURL:"https://cdn.intechopen.com/books/images_new/12196.jpg",editedByType:null,editors:[{id:"333148",title:"Dr.",name:"Lixing",surname:"Huang",slug:"lixing-huang",fullName:"Lixing Huang"}],productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"12050",title:"Advanced Biodiesel - Technological Advances, Challenges, and Sustainability Considerations",subtitle:null,isOpenForSubmission:!0,hash:"bb86ab5c5ca0dab95f01941eb350f920",slug:null,bookSignature:"Dr. IMR Fattah",coverURL:"https://cdn.intechopen.com/books/images_new/12050.jpg",editedByType:null,editors:[{id:"463663",title:"Dr.",name:"IMR",surname:"Fattah",slug:"imr-fattah",fullName:"IMR Fattah"}],productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}}],filtersByTopic:[{group:"topic",caption:"Agricultural and Biological Sciences",value:5,count:38},{group:"topic",caption:"Biochemistry, Genetics and Molecular Biology",value:6,count:12},{group:"topic",caption:"Business, Management and Economics",value:7,count:7},{group:"topic",caption:"Chemistry",value:8,count:22},{group:"topic",caption:"Computer and Information Science",value:9,count:23},{group:"topic",caption:"Earth and Planetary Sciences",value:10,count:15},{group:"topic",caption:"Engineering",value:11,count:63},{group:"topic",caption:"Environmental Sciences",value:12,count:9},{group:"topic",caption:"Immunology and Microbiology",value:13,count:15},{group:"topic",caption:"Materials Science",value:14,count:24},{group:"topic",caption:"Mathematics",value:15,count:11},{group:"topic",caption:"Medicine",value:16,count:112},{group:"topic",caption:"Nanotechnology and Nanomaterials",value:17,count:6},{group:"topic",caption:"Neuroscience",value:18,count:3},{group:"topic",caption:"Pharmacology, Toxicology and Pharmaceutical Science",value:19,count:9},{group:"topic",caption:"Physics",value:20,count:9},{group:"topic",caption:"Psychology",value:21,count:10},{group:"topic",caption:"Robotics",value:22,count:2},{group:"topic",caption:"Social Sciences",value:23,count:9},{group:"topic",caption:"Veterinary Medicine and Science",value:25,count:4}],offset:12,limit:12,total:404},popularBooks:{featuredBooks:[{type:"book",id:"10858",title:"MOOC (Massive Open Online Courses)",subtitle:null,isOpenForSubmission:!1,hash:"d32f86793bc72dde32532f509b1ec5b0",slug:"mooc-massive-open-online-courses-",bookSignature:"Dragan Cvetković",coverURL:"https://cdn.intechopen.com/books/images_new/10858.jpg",editors:[{id:"101330",title:"Dr.",name:"Dragan",middleName:"Mladen",surname:"Cvetković",slug:"dragan-cvetkovic",fullName:"Dragan Cvetković"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"10195",title:"Serotonin and the CNS",subtitle:"New Developments in Pharmacology and Therapeutics",isOpenForSubmission:!1,hash:"7ed9d96da98233a885bd2869a8056c36",slug:"serotonin-and-the-cns-new-developments-in-pharmacology-and-therapeutics",bookSignature:"Berend Olivier",coverURL:"https://cdn.intechopen.com/books/images_new/10195.jpg",editors:[{id:"71579",title:"Prof.",name:"Berend",middleName:null,surname:"Olivier",slug:"berend-olivier",fullName:"Berend Olivier"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"10755",title:"Corporate Governance",subtitle:"Recent Advances and Perspectives",isOpenForSubmission:!1,hash:"ffe06d1d5c4bf0fc2e63511825fe1257",slug:"corporate-governance-recent-advances-and-perspectives",bookSignature:"Okechukwu Lawrence Emeagwali and Feyza Bhatti",coverURL:"https://cdn.intechopen.com/books/images_new/10755.jpg",editors:[{id:"196317",title:"Associate Prof.",name:"Okechukwu Lawrence",middleName:null,surname:"Emeagwali",slug:"okechukwu-lawrence-emeagwali",fullName:"Okechukwu Lawrence Emeagwali"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"11120",title:"Environmental Impact and Remediation of Heavy Metals",subtitle:null,isOpenForSubmission:!1,hash:"9e77514288e7394f1e6cd13481af3509",slug:"environmental-impact-and-remediation-of-heavy-metals",bookSignature:"Hosam M. Saleh and Amal I. Hassan",coverURL:"https://cdn.intechopen.com/books/images_new/11120.jpg",editors:[{id:"144691",title:"Prof.",name:"Hosam M.",middleName:null,surname:"Saleh",slug:"hosam-m.-saleh",fullName:"Hosam M. Saleh"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"10901",title:"Grapes and Wine",subtitle:null,isOpenForSubmission:!1,hash:"5d7f2aa74874444bc6986e613ccebd7c",slug:"grapes-and-wine",bookSignature:"Antonio Morata, Iris Loira and Carmen González",coverURL:"https://cdn.intechopen.com/books/images_new/10901.jpg",editors:[{id:"180952",title:"Prof.",name:"Antonio",middleName:null,surname:"Morata",slug:"antonio-morata",fullName:"Antonio Morata"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"11080",title:"Engineering Principles",subtitle:"Welding and Residual Stresses",isOpenForSubmission:!1,hash:"6c07a13a113bce94174b40096f30fb5e",slug:"engineering-principles-welding-and-residual-stresses",bookSignature:"Kavian Omar Cooke and Ronaldo Câmara Cozza",coverURL:"https://cdn.intechopen.com/books/images_new/11080.jpg",editors:[{id:"138778",title:"Dr.",name:"Kavian",middleName:"Omar",surname:"Cooke",slug:"kavian-cooke",fullName:"Kavian Cooke"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"11332",title:"Essential Oils",subtitle:"Advances in Extractions and Biological Applications",isOpenForSubmission:!1,hash:"742e6cae3a35686f975edc8d7f9afa94",slug:"essential-oils-advances-in-extractions-and-biological-applications",bookSignature:"Mozaniel Santana de Oliveira and Eloisa Helena de Aguiar Andrade",coverURL:"https://cdn.intechopen.com/books/images_new/11332.jpg",editors:[{id:"195290",title:"Ph.D.",name:"Mozaniel",middleName:null,surname:"Santana De Oliveira",slug:"mozaniel-santana-de-oliveira",fullName:"Mozaniel Santana De Oliveira"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"11029",title:"Hepatitis B",subtitle:null,isOpenForSubmission:!1,hash:"609701f502efc3538c112ff47a2c2119",slug:"hepatitis-b",bookSignature:"Luis Rodrigo",coverURL:"https://cdn.intechopen.com/books/images_new/11029.jpg",editors:[{id:"73208",title:"Prof.",name:"Luis",middleName:null,surname:"Rodrigo",slug:"luis-rodrigo",fullName:"Luis Rodrigo"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"9537",title:"Human Rights in the Contemporary World",subtitle:null,isOpenForSubmission:!1,hash:"54f05b93812fd434f3962956d6413a6b",slug:"human-rights-in-the-contemporary-world",bookSignature:"Trudy Corrigan",coverURL:"https://cdn.intechopen.com/books/images_new/9537.jpg",editors:[{id:"197557",title:"Dr.",name:"Trudy",middleName:null,surname:"Corrigan",slug:"trudy-corrigan",fullName:"Trudy Corrigan"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"11371",title:"Cerebral Circulation",subtitle:"Updates on Models, Diagnostics and Treatments of Related Diseases",isOpenForSubmission:!1,hash:"e2d3335445d2852d0b906bb9750e939f",slug:"cerebral-circulation-updates-on-models-diagnostics-and-treatments-of-related-diseases",bookSignature:"Alba Scerrati, Luca Ricciardi and Flavia Dones",coverURL:"https://cdn.intechopen.com/books/images_new/11371.jpg",editors:[{id:"182614",title:"Dr.",name:"Alba",middleName:null,surname:"Scerrati",slug:"alba-scerrati",fullName:"Alba Scerrati"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"11012",title:"Radiopharmaceuticals",subtitle:"Current Research for Better Diagnosis and Therapy",isOpenForSubmission:!1,hash:"f9046d6f96148b285e776f384991120d",slug:"radiopharmaceuticals-current-research-for-better-diagnosis-and-therapy",bookSignature:"Farid A. Badria",coverURL:"https://cdn.intechopen.com/books/images_new/11012.jpg",editors:[{id:"41865",title:"Prof.",name:"Farid A.",middleName:null,surname:"Badria",slug:"farid-a.-badria",fullName:"Farid A. Badria"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"9974",title:"E-Learning and Digital Education in the Twenty-First Century",subtitle:null,isOpenForSubmission:!1,hash:"88b58d66e975df20425fc1dfd22d53aa",slug:"e-learning-and-digital-education-in-the-twenty-first-century",bookSignature:"M. Mahruf C. Shohel",coverURL:"https://cdn.intechopen.com/books/images_new/9974.jpg",editors:[{id:"94099",title:"Dr.",name:"M. Mahruf C.",middleName:null,surname:"Shohel",slug:"m.-mahruf-c.-shohel",fullName:"M. Mahruf C. Shohel"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}}],offset:12,limit:12,total:4431},hotBookTopics:{hotBooks:[],offset:0,limit:12,total:null},publish:{},publishingProposal:{success:null,errors:{}},books:{featuredBooks:[{type:"book",id:"10858",title:"MOOC (Massive Open Online Courses)",subtitle:null,isOpenForSubmission:!1,hash:"d32f86793bc72dde32532f509b1ec5b0",slug:"mooc-massive-open-online-courses-",bookSignature:"Dragan Cvetković",coverURL:"https://cdn.intechopen.com/books/images_new/10858.jpg",publishedDate:"June 23rd 2022",numberOfDownloads:1677,editors:[{id:"101330",title:"Dr.",name:"Dragan",middleName:"Mladen",surname:"Cvetković",slug:"dragan-cvetkovic",fullName:"Dragan Cvetković"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"10195",title:"Serotonin and the CNS",subtitle:"New Developments in Pharmacology and Therapeutics",isOpenForSubmission:!1,hash:"7ed9d96da98233a885bd2869a8056c36",slug:"serotonin-and-the-cns-new-developments-in-pharmacology-and-therapeutics",bookSignature:"Berend Olivier",coverURL:"https://cdn.intechopen.com/books/images_new/10195.jpg",publishedDate:"June 23rd 2022",numberOfDownloads:1337,editors:[{id:"71579",title:"Prof.",name:"Berend",middleName:null,surname:"Olivier",slug:"berend-olivier",fullName:"Berend Olivier"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"10755",title:"Corporate Governance",subtitle:"Recent Advances and Perspectives",isOpenForSubmission:!1,hash:"ffe06d1d5c4bf0fc2e63511825fe1257",slug:"corporate-governance-recent-advances-and-perspectives",bookSignature:"Okechukwu Lawrence Emeagwali and Feyza Bhatti",coverURL:"https://cdn.intechopen.com/books/images_new/10755.jpg",publishedDate:"June 23rd 2022",numberOfDownloads:1309,editors:[{id:"196317",title:"Associate Prof.",name:"Okechukwu Lawrence",middleName:null,surname:"Emeagwali",slug:"okechukwu-lawrence-emeagwali",fullName:"Okechukwu Lawrence Emeagwali"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"11120",title:"Environmental Impact and Remediation of Heavy Metals",subtitle:null,isOpenForSubmission:!1,hash:"9e77514288e7394f1e6cd13481af3509",slug:"environmental-impact-and-remediation-of-heavy-metals",bookSignature:"Hosam M. Saleh and Amal I. Hassan",coverURL:"https://cdn.intechopen.com/books/images_new/11120.jpg",publishedDate:"June 23rd 2022",numberOfDownloads:847,editors:[{id:"144691",title:"Prof.",name:"Hosam M.",middleName:null,surname:"Saleh",slug:"hosam-m.-saleh",fullName:"Hosam M. Saleh"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"10901",title:"Grapes and Wine",subtitle:null,isOpenForSubmission:!1,hash:"5d7f2aa74874444bc6986e613ccebd7c",slug:"grapes-and-wine",bookSignature:"Antonio Morata, Iris Loira and Carmen González",coverURL:"https://cdn.intechopen.com/books/images_new/10901.jpg",publishedDate:"June 15th 2022",numberOfDownloads:2273,editors:[{id:"180952",title:"Prof.",name:"Antonio",middleName:null,surname:"Morata",slug:"antonio-morata",fullName:"Antonio Morata"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"11080",title:"Engineering Principles",subtitle:"Welding and Residual Stresses",isOpenForSubmission:!1,hash:"6c07a13a113bce94174b40096f30fb5e",slug:"engineering-principles-welding-and-residual-stresses",bookSignature:"Kavian Omar Cooke and Ronaldo Câmara Cozza",coverURL:"https://cdn.intechopen.com/books/images_new/11080.jpg",publishedDate:"June 23rd 2022",numberOfDownloads:591,editors:[{id:"138778",title:"Dr.",name:"Kavian",middleName:"Omar",surname:"Cooke",slug:"kavian-cooke",fullName:"Kavian Cooke"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"11332",title:"Essential Oils",subtitle:"Advances in Extractions and Biological Applications",isOpenForSubmission:!1,hash:"742e6cae3a35686f975edc8d7f9afa94",slug:"essential-oils-advances-in-extractions-and-biological-applications",bookSignature:"Mozaniel Santana de Oliveira and Eloisa Helena de Aguiar Andrade",coverURL:"https://cdn.intechopen.com/books/images_new/11332.jpg",publishedDate:"June 23rd 2022",numberOfDownloads:515,editors:[{id:"195290",title:"Ph.D.",name:"Mozaniel",middleName:null,surname:"Santana De Oliveira",slug:"mozaniel-santana-de-oliveira",fullName:"Mozaniel Santana De Oliveira"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"11029",title:"Hepatitis B",subtitle:null,isOpenForSubmission:!1,hash:"609701f502efc3538c112ff47a2c2119",slug:"hepatitis-b",bookSignature:"Luis Rodrigo",coverURL:"https://cdn.intechopen.com/books/images_new/11029.jpg",publishedDate:"June 23rd 2022",numberOfDownloads:413,editors:[{id:"73208",title:"Prof.",name:"Luis",middleName:null,surname:"Rodrigo",slug:"luis-rodrigo",fullName:"Luis Rodrigo"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"9537",title:"Human Rights in the Contemporary World",subtitle:null,isOpenForSubmission:!1,hash:"54f05b93812fd434f3962956d6413a6b",slug:"human-rights-in-the-contemporary-world",bookSignature:"Trudy Corrigan",coverURL:"https://cdn.intechopen.com/books/images_new/9537.jpg",publishedDate:"June 8th 2022",numberOfDownloads:2194,editors:[{id:"197557",title:"Dr.",name:"Trudy",middleName:null,surname:"Corrigan",slug:"trudy-corrigan",fullName:"Trudy Corrigan"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}},{type:"book",id:"11371",title:"Cerebral Circulation",subtitle:"Updates on Models, Diagnostics and Treatments of Related Diseases",isOpenForSubmission:!1,hash:"e2d3335445d2852d0b906bb9750e939f",slug:"cerebral-circulation-updates-on-models-diagnostics-and-treatments-of-related-diseases",bookSignature:"Alba Scerrati, Luca Ricciardi and Flavia Dones",coverURL:"https://cdn.intechopen.com/books/images_new/11371.jpg",publishedDate:"June 23rd 2022",numberOfDownloads:341,editors:[{id:"182614",title:"Dr.",name:"Alba",middleName:null,surname:"Scerrati",slug:"alba-scerrati",fullName:"Alba Scerrati"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter"}}],latestBooks:[{type:"book",id:"11043",title:"Endometriosis",subtitle:"Recent Advances, New Perspectives and Treatments",isOpenForSubmission:!1,hash:"7baf1c70b11d41400bb9302ae9411ca4",slug:"endometriosis-recent-advances-new-perspectives-and-treatments",bookSignature:"Giovana Ap. Gonçalves",coverURL:"https://cdn.intechopen.com/books/images_new/11043.jpg",editedByType:"Edited by",publishedDate:"June 28th 2022",editors:[{id:"185930",title:"Associate Prof.",name:"Giovana",middleName:null,surname:"Gonçalves",slug:"giovana-goncalves",fullName:"Giovana Gonçalves"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"10536",title:"Campylobacter",subtitle:null,isOpenForSubmission:!1,hash:"c4b132b741dd0a2ed539b824ab63965f",slug:"campylobacter",bookSignature:"Guillermo Tellez-Isaias and Saeed El-Ashram",coverURL:"https://cdn.intechopen.com/books/images_new/10536.jpg",editedByType:"Edited by",publishedDate:"June 28th 2022",editors:[{id:"73465",title:"Dr.",name:"Guillermo",middleName:null,surname:"Téllez",slug:"guillermo-tellez",fullName:"Guillermo Téllez"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"10798",title:"Starch",subtitle:"Evolution and Recent Advances",isOpenForSubmission:!1,hash:"f197f6062c1574a9a90e50a369271bcf",slug:"starch-evolution-and-recent-advances",bookSignature:"Martins Ochubiojo Emeje",coverURL:"https://cdn.intechopen.com/books/images_new/10798.jpg",editedByType:"Edited by",publishedDate:"June 28th 2022",editors:[{id:"94311",title:"Prof.",name:"Martins",middleName:"Ochubiojo",surname:"Ochubiojo Emeje",slug:"martins-ochubiojo-emeje",fullName:"Martins Ochubiojo Emeje"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"11083",title:"Hazardous Waste Management",subtitle:null,isOpenForSubmission:!1,hash:"d553bd4f6f1c4b115ca69bd19faac7dc",slug:"hazardous-waste-management",bookSignature:"Rajesh Banu Jeyakumar, Kavitha Sankarapandian and Yukesh Kannah Ravi",coverURL:"https://cdn.intechopen.com/books/images_new/11083.jpg",editedByType:"Edited by",publishedDate:"June 28th 2022",editors:[{id:"218539",title:"Dr.",name:"Rajesh Banu",middleName:null,surname:"Jeyakumar",slug:"rajesh-banu-jeyakumar",fullName:"Rajesh Banu Jeyakumar"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"10848",title:"Tribology of Machine Elements",subtitle:"Fundamentals and Applications",isOpenForSubmission:!1,hash:"3c4ca4c4692ca8d4fa749b4ae81ec1fa",slug:"tribology-of-machine-elements-fundamentals-and-applications",bookSignature:"Giuseppe Pintaude, Tiago Cousseau and Anna Rudawska",coverURL:"https://cdn.intechopen.com/books/images_new/10848.jpg",editedByType:"Edited by",publishedDate:"June 28th 2022",editors:[{id:"18347",title:"Prof.",name:"Giuseppe",middleName:null,surname:"Pintaude",slug:"giuseppe-pintaude",fullName:"Giuseppe Pintaude"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"10856",title:"Crude Oil",subtitle:"New Technologies and Recent Approaches",isOpenForSubmission:!1,hash:"8d0a7ca35b3de95b295dc4eab39a087e",slug:"crude-oil-new-technologies-and-recent-approaches",bookSignature:"Manar Elsayed Abdel-Raouf and Mohamed Hasan El-Keshawy",coverURL:"https://cdn.intechopen.com/books/images_new/10856.jpg",editedByType:"Edited by",publishedDate:"June 28th 2022",editors:[{id:"102626",title:"Prof.",name:"Manar",middleName:null,surname:"Elsayed Abdel-Raouf",slug:"manar-elsayed-abdel-raouf",fullName:"Manar Elsayed Abdel-Raouf"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"9625",title:"Spinocerebellar Ataxia",subtitle:"Concepts, Particularities and Generalities",isOpenForSubmission:!1,hash:"365a7025fd46eb45de2549bdd9d50b98",slug:"spinocerebellar-ataxia-concepts-particularities-and-generalities",bookSignature:"Patricia Bozzetto Ambrosi",coverURL:"https://cdn.intechopen.com/books/images_new/9625.jpg",editedByType:"Edited by",publishedDate:"June 28th 2022",editors:[{id:"221787",title:"Dr.",name:"Patricia",middleName:null,surname:"Bozzetto Ambrosi",slug:"patricia-bozzetto-ambrosi",fullName:"Patricia Bozzetto Ambrosi"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"10905",title:"Plant Defense Mechanisms",subtitle:null,isOpenForSubmission:!1,hash:"84ad5b27dde5f01dc76087d0fd6fa834",slug:"plant-defense-mechanisms",bookSignature:"Josphert Ngui Kimatu",coverURL:"https://cdn.intechopen.com/books/images_new/10905.jpg",editedByType:"Edited by",publishedDate:"June 28th 2022",editors:[{id:"224171",title:"Prof.",name:"Josphert N.",middleName:null,surname:"Kimatu",slug:"josphert-n.-kimatu",fullName:"Josphert N. Kimatu"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"10686",title:"Natural Gas",subtitle:"New Perspectives and Future Developments",isOpenForSubmission:!1,hash:"581763788a6a59e653a9d1d9b5a42d79",slug:"natural-gas-new-perspectives-and-future-developments",bookSignature:"Maryam Takht Ravanchi",coverURL:"https://cdn.intechopen.com/books/images_new/10686.jpg",editedByType:"Edited by",publishedDate:"June 28th 2022",editors:[{id:"2416",title:"Dr.",name:"Maryam",middleName:null,surname:"Takht Ravanchi",slug:"maryam-takht-ravanchi",fullName:"Maryam Takht Ravanchi"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"10988",title:"Railway Transport Planning and Manageme",subtitle:null,isOpenForSubmission:!1,hash:"5cb54cc53caedad9ec78372563c82e2c",slug:"railway-transport-planning-and-management",bookSignature:"Stefano de Luca, Roberta Di Pace and Chiara Fiori",coverURL:"https://cdn.intechopen.com/books/images_new/10988.jpg",editedByType:"Edited by",publishedDate:"June 28th 2022",editors:[{id:"271061",title:"Prof.",name:"Stefano",middleName:null,surname:"de Luca",slug:"stefano-de-luca",fullName:"Stefano de Luca"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}}]},subject:{topic:{id:"1388",title:"Knowledge Management",slug:"management-knowledge-management",parent:{id:"272",title:"Management",slug:"management"},numberOfBooks:2,numberOfSeries:0,numberOfAuthorsAndEditors:19,numberOfWosCitations:9,numberOfCrossrefCitations:27,numberOfDimensionsCitations:41,videoUrl:null,fallbackUrl:null,description:null},booksByTopicFilter:{topicId:"1388",sort:"-publishedDate",limit:12,offset:0},booksByTopicCollection:[{type:"book",id:"7808",title:"Current Issues in Knowledge Management",subtitle:null,isOpenForSubmission:!1,hash:"93933c9bdd9d2d5fc7419959897005bf",slug:"current-issues-in-knowledge-management",bookSignature:"Mark Wickham",coverURL:"https://cdn.intechopen.com/books/images_new/7808.jpg",editedByType:"Edited by",editors:[{id:"195021",title:"Dr.",name:"Mark",middleName:null,surname:"Wickham",slug:"mark-wickham",fullName:"Mark Wickham"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}},{type:"book",id:"5605",title:"Parenting",subtitle:"Empirical Advances and Intervention Resources",isOpenForSubmission:!1,hash:"1791ac20219bb1f0832571672b219fbe",slug:"parenting-empirical-advances-and-intervention-resources",bookSignature:"Loredana Benedetto and Massimo Ingrassia",coverURL:"https://cdn.intechopen.com/books/images_new/5605.jpg",editedByType:"Edited by",editors:[{id:"193200",title:"Prof.",name:"Loredana",middleName:null,surname:"Benedetto",slug:"loredana-benedetto",fullName:"Loredana Benedetto"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null,productType:{id:"1",chapterContentType:"chapter",authoredCaption:"Edited by"}}],booksByTopicTotal:2,seriesByTopicCollection:[],seriesByTopicTotal:0,mostCitedChapters:[{id:"55633",doi:"10.5772/intechopen.68933",title:"Parental Self-efficacy in Promoting Children Care and Parenting Quality",slug:"parental-self-efficacy-in-promoting-children-care-and-parenting-quality",totalDownloads:2102,totalCrossrefCites:9,totalDimensionsCites:13,abstract:"Parental self-efficacy (PSE) emerges as a crucial variable into exploring variability in parenting quality. After introducing the link between PSE and parental competence, the role of PSE on parenting quality, its multiple influences, and transactional effects connected to contextual or cultural variables are discussed. The chapter addresses some key issues: (a) the levels of PSE measurement (i.e., domain- or task-specific approach), their interrelationship and magnitude as mutual predictors (study 1); (b) infant-caring, parent’s adjustment, and PSE development in the transition to parenthood (study 2); (c) parenting difficult children and the role of PSE as a “buffer” variable moderating the effects of negative child’s characteristics on parenting skills; and (d) PSE beliefs in family context, the relationships with other family measures (marital self-efficacy and stress), and their associations with children’s adjustments (study 3). Finally, in the study 4, PSE is presented as an outcome variable in a parent training. In all summarized studies, a special attention was devoted to father’s PSE as a specific factor affecting childrearing and parent’s well-being. As Bandura says, PSE is not a personality trait, but a learnable set of beliefs producing positive effects on parenting quality. Suggestions for family-based interventions enhancing PSE are discussed.",book:{id:"5605",slug:"parenting-empirical-advances-and-intervention-resources",title:"Parenting",fullTitle:"Parenting - Empirical Advances and Intervention Resources"},signatures:"Loredana Benedetto and Massimo Ingrassia",authors:[{id:"193200",title:"Prof.",name:"Loredana",middleName:null,surname:"Benedetto",slug:"loredana-benedetto",fullName:"Loredana Benedetto"},{id:"193901",title:"Prof.",name:"Massimo",middleName:null,surname:"Ingrassia",slug:"massimo-ingrassia",fullName:"Massimo Ingrassia"}]},{id:"53767",doi:"10.5772/66985",title:"Parenting Practices and the Development of Internalizing/ Externalizing Problems in Adolescence",slug:"parenting-practices-and-the-development-of-internalizing-externalizing-problems-in-adolescence",totalDownloads:1712,totalCrossrefCites:5,totalDimensionsCites:8,abstract:"This chapter examines the existing relationship between different types of parental practices and the development of internalizing and externalizing behavioral problems in adolescence. Parental involvement and parenting styles are defined and analyzed as possible parameters of adolescent problems, including bullying and victimization. Special emphasis is given to the distinction between behavioral and psychological parental control. Furthermore, issues such as parent‐adolescent conflict, locus of control, and parental values are discussed as correlates of these problems, since prior research has identified them as either risk or protective factors for child and adolescent social and emotional adaptation.",book:{id:"5605",slug:"parenting-empirical-advances-and-intervention-resources",title:"Parenting",fullTitle:"Parenting - Empirical Advances and Intervention Resources"},signatures:"Stelios N. Georgiou and Maria Symeou",authors:[{id:"193345",title:"Prof.",name:"Stelios",middleName:null,surname:"Georgiou",slug:"stelios-georgiou",fullName:"Stelios Georgiou"},{id:"197682",title:"Dr.",name:"Maria",middleName:null,surname:"Symeou",slug:"maria-symeou",fullName:"Maria Symeou"}]},{id:"67167",doi:"10.5772/intechopen.86517",title:"Aligning Human Resource Management with Knowledge Management for Better Organizational Performance: How Human Resource Practices Support Knowledge Management Strategies?",slug:"aligning-human-resource-management-with-knowledge-management-for-better-organizational-performance-h",totalDownloads:1965,totalCrossrefCites:6,totalDimensionsCites:7,abstract:"Contributing to the HR-approach to knowledge management (KM), this chapter aims at outlining the role of human resource management (HRM) in supporting KM through utilizing the theoretical and empirical literature. The article is divided into two sections. The first section presents various knowledge concepts, KM perspectives and KM strategies. This section ends up by linking these topics in a KM sequential model which helps us to track the philosophical underpinnings and perspectives of each KM strategy. The second section investigates various HR orientations and HR practices and situates their differing contextual characteristics under each KM strategy. It aligns various HR practices with different KM strategies; suggesting that HRM is most effective as a combination of practices that are consistent and sharpened in supporting each KM strategy, which is part of the organizational strategy. The debated practices are recruitment and selection, compensation management, training and development, performance management, retention management and career management. Each of those practices is speculated to alter based on the chosen KM strategy; presenting a framework that is useful for practitioners and academics alike. The review ends up by identifying some research gaps and opportunities to be carried out in future studies. Those research gaps, if addressed, will extend our understanding of KM and the supporting role HRM.",book:{id:"7808",slug:"current-issues-in-knowledge-management",title:"Current Issues in Knowledge Management",fullTitle:"Current Issues in Knowledge Management"},signatures:"Hadi El-Farr and Rezvan Hosseingholizadeh",authors:[{id:"293827",title:"Dr.",name:"Hadi",middleName:null,surname:"El-Farr",slug:"hadi-el-farr",fullName:"Hadi El-Farr"},{id:"293834",title:"Dr.",name:"Rezvan",middleName:null,surname:"Hosseingholizadeh",slug:"rezvan-hosseingholizadeh",fullName:"Rezvan Hosseingholizadeh"}]},{id:"59135",doi:"10.5772/intechopen.73540",title:"The Relationship between Parenting and Internalizing Problems in Childhood",slug:"the-relationship-between-parenting-and-internalizing-problems-in-childhood",totalDownloads:1480,totalCrossrefCites:2,totalDimensionsCites:5,abstract:"Several types of stress factors are likely to be implied in the development, maintenance, and transmission of internalizing symptomatology: genetic/temperamental factors, cognitive factors, family factors, and societal/cultural factors. Nonetheless, family factors—especially those related to parenting—seem to be crucial during childhood, because children are nested within their families and family factors are able to indirectly influence other factors as well. The current chapter focuses on the relationship between parental style and internalizing symptoms in childhood. In the first part of the chapter, the most important studies on the topic are reviewed in detail and differences in parenting behaviors between mothers and fathers are illustrated. A discussion on the cognitive and metacognitive factors as possible pathways of the relation between parenting and childhood symptoms is also proposed. The last part of the chapter reviews studies investigating the efficacy of parental involvement in cognitive behavior therapy for children who exhibit internalizing symptoms.",book:{id:"5605",slug:"parenting-empirical-advances-and-intervention-resources",title:"Parenting",fullTitle:"Parenting - Empirical Advances and Intervention Resources"},signatures:"Simona Scaini, Sara Palmieri and Marcella Caputi",authors:[{id:"240074",title:"Dr.",name:"Simona",middleName:null,surname:"Scaini",slug:"simona-scaini",fullName:"Simona Scaini"},{id:"240906",title:"Dr.",name:"Marcella",middleName:null,surname:"Caputi",slug:"marcella-caputi",fullName:"Marcella Caputi"}]},{id:"67575",doi:"10.5772/intechopen.86757",title:"Toward Management Based on Knowledge",slug:"toward-management-based-on-knowledge",totalDownloads:1128,totalCrossrefCites:3,totalDimensionsCites:3,abstract:"In a world overwhelmed with pervasive digital technologies, the organization is transformed and becomes a socio-technical system which is constantly renewed. Organization needs specific skills, adapted to the values and to the cultures peculiar to each location. The cooperation and the mobility become a shape of inescapable work which rests on a permanent personal and collective learning. Beyond the information handled in the digital information systems, the role of the tacit knowledge, which is in each individual’s head, cannot be ignored. A constructivist attitude replaces a determinist attitude strongly deep-rooted in our educational modes. The managers have to pass from a posture of authority and of control to a posture of incitation, of support, and of accompaniment. The notions that are introduced in this chapter result from a managerial and socio-technical vision of knowledge management. They arouse essential reflections to develop a mode of management adapted to the digital transformation of the organizations called management based on knowledge.",book:{id:"7808",slug:"current-issues-in-knowledge-management",title:"Current Issues in Knowledge Management",fullTitle:"Current Issues in Knowledge Management"},signatures:"Michel Grundstein",authors:[{id:"292425",title:"Mr.",name:"Michel",middleName:null,surname:"Grundstein",slug:"michel-grundstein",fullName:"Michel Grundstein"}]}],mostDownloadedChaptersLast30Days:[{id:"55633",title:"Parental Self-efficacy in Promoting Children Care and Parenting Quality",slug:"parental-self-efficacy-in-promoting-children-care-and-parenting-quality",totalDownloads:2099,totalCrossrefCites:9,totalDimensionsCites:13,abstract:"Parental self-efficacy (PSE) emerges as a crucial variable into exploring variability in parenting quality. After introducing the link between PSE and parental competence, the role of PSE on parenting quality, its multiple influences, and transactional effects connected to contextual or cultural variables are discussed. The chapter addresses some key issues: (a) the levels of PSE measurement (i.e., domain- or task-specific approach), their interrelationship and magnitude as mutual predictors (study 1); (b) infant-caring, parent’s adjustment, and PSE development in the transition to parenthood (study 2); (c) parenting difficult children and the role of PSE as a “buffer” variable moderating the effects of negative child’s characteristics on parenting skills; and (d) PSE beliefs in family context, the relationships with other family measures (marital self-efficacy and stress), and their associations with children’s adjustments (study 3). Finally, in the study 4, PSE is presented as an outcome variable in a parent training. In all summarized studies, a special attention was devoted to father’s PSE as a specific factor affecting childrearing and parent’s well-being. As Bandura says, PSE is not a personality trait, but a learnable set of beliefs producing positive effects on parenting quality. Suggestions for family-based interventions enhancing PSE are discussed.",book:{id:"5605",slug:"parenting-empirical-advances-and-intervention-resources",title:"Parenting",fullTitle:"Parenting - Empirical Advances and Intervention Resources"},signatures:"Loredana Benedetto and Massimo Ingrassia",authors:[{id:"193200",title:"Prof.",name:"Loredana",middleName:null,surname:"Benedetto",slug:"loredana-benedetto",fullName:"Loredana Benedetto"},{id:"193901",title:"Prof.",name:"Massimo",middleName:null,surname:"Ingrassia",slug:"massimo-ingrassia",fullName:"Massimo Ingrassia"}]},{id:"67528",title:"The Management, Sharing and Transfer of Knowledge in the Oil Districts - The Case Study of An Italian District",slug:"the-management-sharing-and-transfer-of-knowledge-in-the-oil-districts-the-case-study-of-an-italian-d",totalDownloads:1172,totalCrossrefCites:0,totalDimensionsCites:0,abstract:"Knowledge management is one of the most innovative and effective tools available to companies to manage an economic and organizational ever-changing environment. The chapter is based on an empirical study starting from the classification of oil district and aims to understand how firms’ position affect knowledge transfer process within the district. We support the idea that knowledge transfer is deeply affected by firms’ contractual power as well as by their position within the district. The companies of the industrial districts have the advantage of exploiting and sharing knowledge with each other. The literature generally holds that knowledge transfer requires a sense of equality and fairness among the firms, to create conditions in which firms will share their own knowledge for joint competitive advantage. However, empirical evidence shows that the value chains are often characterized by hierarchical relations and asymmetry between the parties: this feature is particularly evident in the oil districts. For companies attempting to acquire new information, the typologies of their intercompany collaboration and their cultural relationships are crucial.",book:{id:"7808",slug:"current-issues-in-knowledge-management",title:"Current Issues in Knowledge Management",fullTitle:"Current Issues in Knowledge Management"},signatures:"Giovanna Testa",authors:[{id:"293404",title:"Dr.",name:"Giovanna",middleName:null,surname:"Testa",slug:"giovanna-testa",fullName:"Giovanna Testa"}]},{id:"67167",title:"Aligning Human Resource Management with Knowledge Management for Better Organizational Performance: How Human Resource Practices Support Knowledge Management Strategies?",slug:"aligning-human-resource-management-with-knowledge-management-for-better-organizational-performance-h",totalDownloads:1961,totalCrossrefCites:6,totalDimensionsCites:7,abstract:"Contributing to the HR-approach to knowledge management (KM), this chapter aims at outlining the role of human resource management (HRM) in supporting KM through utilizing the theoretical and empirical literature. The article is divided into two sections. The first section presents various knowledge concepts, KM perspectives and KM strategies. This section ends up by linking these topics in a KM sequential model which helps us to track the philosophical underpinnings and perspectives of each KM strategy. The second section investigates various HR orientations and HR practices and situates their differing contextual characteristics under each KM strategy. It aligns various HR practices with different KM strategies; suggesting that HRM is most effective as a combination of practices that are consistent and sharpened in supporting each KM strategy, which is part of the organizational strategy. The debated practices are recruitment and selection, compensation management, training and development, performance management, retention management and career management. Each of those practices is speculated to alter based on the chosen KM strategy; presenting a framework that is useful for practitioners and academics alike. The review ends up by identifying some research gaps and opportunities to be carried out in future studies. Those research gaps, if addressed, will extend our understanding of KM and the supporting role HRM.",book:{id:"7808",slug:"current-issues-in-knowledge-management",title:"Current Issues in Knowledge Management",fullTitle:"Current Issues in Knowledge Management"},signatures:"Hadi El-Farr and Rezvan Hosseingholizadeh",authors:[{id:"293827",title:"Dr.",name:"Hadi",middleName:null,surname:"El-Farr",slug:"hadi-el-farr",fullName:"Hadi El-Farr"},{id:"293834",title:"Dr.",name:"Rezvan",middleName:null,surname:"Hosseingholizadeh",slug:"rezvan-hosseingholizadeh",fullName:"Rezvan Hosseingholizadeh"}]},{id:"53767",title:"Parenting Practices and the Development of Internalizing/ Externalizing Problems in Adolescence",slug:"parenting-practices-and-the-development-of-internalizing-externalizing-problems-in-adolescence",totalDownloads:1708,totalCrossrefCites:5,totalDimensionsCites:8,abstract:"This chapter examines the existing relationship between different types of parental practices and the development of internalizing and externalizing behavioral problems in adolescence. Parental involvement and parenting styles are defined and analyzed as possible parameters of adolescent problems, including bullying and victimization. Special emphasis is given to the distinction between behavioral and psychological parental control. Furthermore, issues such as parent‐adolescent conflict, locus of control, and parental values are discussed as correlates of these problems, since prior research has identified them as either risk or protective factors for child and adolescent social and emotional adaptation.",book:{id:"5605",slug:"parenting-empirical-advances-and-intervention-resources",title:"Parenting",fullTitle:"Parenting - Empirical Advances and Intervention Resources"},signatures:"Stelios N. Georgiou and Maria Symeou",authors:[{id:"193345",title:"Prof.",name:"Stelios",middleName:null,surname:"Georgiou",slug:"stelios-georgiou",fullName:"Stelios Georgiou"},{id:"197682",title:"Dr.",name:"Maria",middleName:null,surname:"Symeou",slug:"maria-symeou",fullName:"Maria Symeou"}]},{id:"59028",title:"Parent Training Interventions for Children and Adolescents with Aggressive Behavioral Problems",slug:"parent-training-interventions-for-children-and-adolescents-with-aggressive-behavioral-problems",totalDownloads:1630,totalCrossrefCites:0,totalDimensionsCites:2,abstract:"Children who display early disruptive and aggressive behavior are also at greater risk for delinquency, mood and anxiety disorders, and substance use in the long term. As is the case for many forms of childhood psychopathology, a number of factors are associated with the emergence of aggressive and disruptive behavior, including family factors. Indeed, conduct problems during childhood are usually associated with peculiar parenting practices, such as increasingly coercive cycles of harsh parenting and noncompliance exhibited by child; insensitive and nonresponsive parenting; inconsistent, severe discipline and vague commands and directions; lack of parental warmth and involvement; and absence of parental monitoring and supervision. That is why behavioral parent trainings (BPTs) represent one of the gold standard interventions for conduct problems. The main goal of BPT is to decrease coercive interchanges and, consequently, children aggressive problems by teaching parents strategies in order to apply a more effective discipline. Therefore, the putative mechanism for change in youth behavior in BPT is change in parent behavior. Some of the most employed parent training interventions for aggressive behavior problems are presented.",book:{id:"5605",slug:"parenting-empirical-advances-and-intervention-resources",title:"Parenting",fullTitle:"Parenting - Empirical Advances and Intervention Resources"},signatures:"Pietro Muratori, Valentina Levantini, Azzurra Manfredi, Laura\nRuglioni and Furio Lambruschi",authors:[{id:"238556",title:"Dr.",name:"Pietro",middleName:null,surname:"Muratori",slug:"pietro-muratori",fullName:"Pietro Muratori"}]}],onlineFirstChaptersFilter:{topicId:"1388",limit:6,offset:0},onlineFirstChaptersCollection:[],onlineFirstChaptersTotal:0},preDownload:{success:null,errors:{}},subscriptionForm:{success:null,errors:{}},aboutIntechopen:{},privacyPolicy:{},peerReviewing:{},howOpenAccessPublishingWithIntechopenWorks:{},sponsorshipBooks:{sponsorshipBooks:[],offset:8,limit:8,total:0},allSeries:{pteSeriesList:[{id:"14",title:"Artificial Intelligence",numberOfPublishedBooks:9,numberOfPublishedChapters:89,numberOfOpenTopics:6,numberOfUpcomingTopics:0,issn:"2633-1403",doi:"10.5772/intechopen.79920",isOpenForSubmission:!0},{id:"7",title:"Biomedical Engineering",numberOfPublishedBooks:12,numberOfPublishedChapters:104,numberOfOpenTopics:3,numberOfUpcomingTopics:0,issn:"2631-5343",doi:"10.5772/intechopen.71985",isOpenForSubmission:!0}],lsSeriesList:[{id:"11",title:"Biochemistry",numberOfPublishedBooks:32,numberOfPublishedChapters:318,numberOfOpenTopics:4,numberOfUpcomingTopics:0,issn:"2632-0983",doi:"10.5772/intechopen.72877",isOpenForSubmission:!0},{id:"25",title:"Environmental Sciences",numberOfPublishedBooks:1,numberOfPublishedChapters:12,numberOfOpenTopics:4,numberOfUpcomingTopics:0,issn:"2754-6713",doi:"10.5772/intechopen.100362",isOpenForSubmission:!0},{id:"10",title:"Physiology",numberOfPublishedBooks:11,numberOfPublishedChapters:141,numberOfOpenTopics:4,numberOfUpcomingTopics:0,issn:"2631-8261",doi:"10.5772/intechopen.72796",isOpenForSubmission:!0}],hsSeriesList:[{id:"3",title:"Dentistry",numberOfPublishedBooks:8,numberOfPublishedChapters:133,numberOfOpenTopics:2,numberOfUpcomingTopics:0,issn:"2631-6218",doi:"10.5772/intechopen.71199",isOpenForSubmission:!0},{id:"6",title:"Infectious Diseases",numberOfPublishedBooks:13,numberOfPublishedChapters:113,numberOfOpenTopics:3,numberOfUpcomingTopics:1,issn:"2631-6188",doi:"10.5772/intechopen.71852",isOpenForSubmission:!0},{id:"13",title:"Veterinary Medicine and Science",numberOfPublishedBooks:11,numberOfPublishedChapters:107,numberOfOpenTopics:3,numberOfUpcomingTopics:0,issn:"2632-0517",doi:"10.5772/intechopen.73681",isOpenForSubmission:!0}],sshSeriesList:[{id:"22",title:"Business, Management and Economics",numberOfPublishedBooks:1,numberOfPublishedChapters:19,numberOfOpenTopics:3,numberOfUpcomingTopics:0,issn:"2753-894X",doi:"10.5772/intechopen.100359",isOpenForSubmission:!0},{id:"23",title:"Education and Human Development",numberOfPublishedBooks:0,numberOfPublishedChapters:5,numberOfOpenTopics:1,numberOfUpcomingTopics:1,issn:null,doi:"10.5772/intechopen.100360",isOpenForSubmission:!0},{id:"24",title:"Sustainable Development",numberOfPublishedBooks:0,numberOfPublishedChapters:15,numberOfOpenTopics:5,numberOfUpcomingTopics:0,issn:null,doi:"10.5772/intechopen.100361",isOpenForSubmission:!0}],testimonialsList:[{id:"13",text:"The collaboration with and support of the technical staff of IntechOpen is fantastic. The whole process of submitting an article and editing of the submitted article goes extremely smooth and fast, the number of reads and downloads of chapters is high, and the contributions are also frequently cited.",author:{id:"55578",name:"Antonio",surname:"Jurado-Navas",institutionString:null,profilePictureURL:"https://s3.us-east-1.amazonaws.com/intech-files/0030O00002bRisIQAS/Profile_Picture_1626166543950",slug:"antonio-jurado-navas",institution:{id:"720",name:"University of Malaga",country:{id:null,name:"Spain"}}}},{id:"6",text:"It is great to work with the IntechOpen to produce a worthwhile collection of research that also becomes a great educational resource and guide for future research endeavors.",author:{id:"259298",name:"Edward",surname:"Narayan",institutionString:null,profilePictureURL:"https://mts.intechopen.com/storage/users/259298/images/system/259298.jpeg",slug:"edward-narayan",institution:{id:"3",name:"University of Queensland",country:{id:null,name:"Australia"}}}}]},series:{item:{id:"6",title:"Infectious Diseases",doi:"10.5772/intechopen.71852",issn:"2631-6188",scope:"This series will provide a comprehensive overview of recent research trends in various Infectious Diseases (as per the most recent Baltimore classification). Topics will include general overviews of infections, immunopathology, diagnosis, treatment, epidemiology, etiology, and current clinical recommendations for managing infectious diseases. Ongoing issues, recent advances, and future diagnostic approaches and therapeutic strategies will also be discussed. This book series will focus on various aspects and properties of infectious diseases whose deep understanding is essential for safeguarding the human race from losing resources and economies due to pathogens.",coverUrl:"https://cdn.intechopen.com/series/covers/6.jpg",latestPublicationDate:"June 25th, 2022",hasOnlineFirst:!0,numberOfPublishedBooks:13,editor:{id:"131400",title:"Prof.",name:"Alfonso J.",middleName:null,surname:"Rodriguez-Morales",slug:"alfonso-j.-rodriguez-morales",fullName:"Alfonso J. Rodriguez-Morales",profilePictureURL:"https://mts.intechopen.com/storage/users/131400/images/system/131400.png",biography:"Dr. Rodriguez-Morales is an expert in tropical and emerging diseases, particularly zoonotic and vector-borne diseases (especially arboviral diseases). He is the president of the Travel Medicine Committee of the Pan-American Infectious Diseases Association (API), as well as the president of the Colombian Association of Infectious Diseases (ACIN). He is a member of the Committee on Tropical Medicine, Zoonoses, and Travel Medicine of ACIN. He is a vice-president of the Latin American Society for Travel Medicine (SLAMVI) and a Member of the Council of the International Society for Infectious Diseases (ISID). Since 2014, he has been recognized as a Senior Researcher, at the Ministry of Science of Colombia. He is a professor at the Faculty of Medicine of the Fundacion Universitaria Autonoma de las Americas, in Pereira, Risaralda, Colombia. He is an External Professor, Master in Research on Tropical Medicine and International Health, Universitat de Barcelona, Spain. He is also a professor at the Master in Clinical Epidemiology and Biostatistics, Universidad Científica del Sur, Lima, Peru. In 2021 he has been awarded the “Raul Isturiz Award” Medal of the API. Also, in 2021, he was awarded with the “Jose Felix Patiño” Asclepius Staff Medal of the Colombian Medical College, due to his scientific contributions to COVID-19 during the pandemic. He is currently the Editor in Chief of the journal Travel Medicine and Infectious Diseases. His Scopus H index is 47 (Google Scholar H index, 68).",institutionString:"Institución Universitaria Visión de las Américas, Colombia",institution:null},editorTwo:null,editorThree:null},subseries:{paginationCount:4,paginationItems:[{id:"3",title:"Bacterial Infectious Diseases",coverUrl:"https://cdn.intechopen.com/series_topics/covers/3.jpg",isOpenForSubmission:!1,annualVolume:null,editor:null,editorTwo:null,editorThree:null},{id:"4",title:"Fungal Infectious Diseases",coverUrl:"https://cdn.intechopen.com/series_topics/covers/4.jpg",isOpenForSubmission:!0,annualVolume:11400,editor:{id:"174134",title:"Dr.",name:"Yuping",middleName:null,surname:"Ran",slug:"yuping-ran",fullName:"Yuping Ran",profilePictureURL:"https://s3.us-east-1.amazonaws.com/intech-files/0030O00002bS9d6QAC/Profile_Picture_1630330675373",biography:"Dr. Yuping Ran, Professor, Department of Dermatology, West China Hospital, Sichuan University, Chengdu, China. Completed the Course Medical Mycology, the Centraalbureau voor Schimmelcultures (CBS), Fungal Biodiversity Centre, Netherlands (2006). International Union of Microbiological Societies (IUMS) Fellow, and International Emerging Infectious Diseases (IEID) Fellow, Centers for Diseases Control and Prevention (CDC), Atlanta, USA. Diploma of Dermatological Scientist, Japanese Society for Investigative Dermatology. Ph.D. of Juntendo University, Japan. Bachelor’s and Master’s degree, Medicine, West China University of Medical Sciences. Chair of Sichuan Medical Association Dermatology Committee. General Secretary of The 19th Annual Meeting of Chinese Society of Dermatology and the Asia Pacific Society for Medical Mycology (2013). In charge of the Annual Medical Mycology Course over 20-years authorized by National Continue Medical Education Committee of China. Member of the board of directors of the Asia-Pacific Society for Medical Mycology (APSMM). Associate editor of Mycopathologia. Vice-chief of the editorial board of Chinses Journal of Mycology, China. Board Member and Chair of Mycology Group of Chinese Society of Dermatology.",institutionString:null,institution:{name:"Sichuan University",institutionURL:null,country:{name:"China"}}},editorTwo:null,editorThree:null},{id:"5",title:"Parasitic Infectious Diseases",coverUrl:"https://cdn.intechopen.com/series_topics/covers/5.jpg",isOpenForSubmission:!0,annualVolume:11401,editor:{id:"67907",title:"Dr.",name:"Amidou",middleName:null,surname:"Samie",slug:"amidou-samie",fullName:"Amidou Samie",profilePictureURL:"https://mts.intechopen.com/storage/users/67907/images/system/67907.jpg",biography:"Dr. Amidou Samie is an Associate Professor of Microbiology at the University of Venda, in South Africa, where he graduated for his PhD in May 2008. He joined the Department of Microbiology the same year and has been giving lectures on topics covering parasitology, immunology, molecular biology and industrial microbiology. He is currently a rated researcher by the National Research Foundation of South Africa at category C2. He has published widely in the field of infectious diseases and has overseen several MSc’s and PhDs. His research activities mostly cover topics on infectious diseases from epidemiology to control. His particular interest lies in the study of intestinal protozoan parasites and opportunistic infections among HIV patients as well as the potential impact of childhood diarrhoea on growth and child development. He also conducts research on water-borne diseases and water quality and is involved in the evaluation of point-of-use water treatment technologies using silver and copper nanoparticles in collaboration with the University of Virginia, USA. He also studies the use of medicinal plants for the control of infectious diseases as well as antimicrobial drug resistance.",institutionString:null,institution:{name:"University of Venda",institutionURL:null,country:{name:"South Africa"}}},editorTwo:null,editorThree:null},{id:"6",title:"Viral Infectious Diseases",coverUrl:"https://cdn.intechopen.com/series_topics/covers/6.jpg",isOpenForSubmission:!0,annualVolume:11402,editor:{id:"158026",title:"Prof.",name:"Shailendra K.",middleName:null,surname:"Saxena",slug:"shailendra-k.-saxena",fullName:"Shailendra K. Saxena",profilePictureURL:"https://s3.us-east-1.amazonaws.com/intech-files/0030O00002bRET3QAO/Profile_Picture_2022-05-10T10:10:26.jpeg",biography:"Professor Dr. Shailendra K. Saxena is a vice dean and professor at King George's Medical University, Lucknow, India. His research interests involve understanding the molecular mechanisms of host defense during human viral infections and developing new predictive, preventive, and therapeutic strategies for them using Japanese encephalitis virus (JEV), HIV, and emerging viruses as a model via stem cell and cell culture technologies. His research work has been published in various high-impact factor journals (Science, PNAS, Nature Medicine) with a high number of citations. He has received many awards and honors in India and abroad including various Young Scientist Awards, BBSRC India Partnering Award, and Dr. JC Bose National Award of Department of Biotechnology, Min. of Science and Technology, Govt. of India. Dr. Saxena is a fellow of various international societies/academies including the Royal College of Pathologists, United Kingdom; Royal Society of Medicine, London; Royal Society of Biology, United Kingdom; Royal Society of Chemistry, London; and Academy of Translational Medicine Professionals, Austria. He was named a Global Leader in Science by The Scientist. He is also an international opinion leader/expert in vaccination for Japanese encephalitis by IPIC (UK).",institutionString:"King George's Medical University",institution:{name:"King George's Medical University",institutionURL:null,country:{name:"India"}}},editorTwo:null,editorThree:null}]},overviewPageOFChapters:{paginationCount:58,paginationItems:[{id:"81961",title:"Antioxidants as an Adjuncts to Periodontal Therapy",doi:"10.5772/intechopen.105016",signatures:"Sura Dakhil Jassim and Ali Abbas Abdulkareem",slug:"antioxidants-as-an-adjuncts-to-periodontal-therapy",totalDownloads:3,totalCrossrefCites:0,totalDimensionsCites:0,authors:null,book:{title:"Dental Trauma",coverURL:"https://cdn.intechopen.com/books/images_new/11567.jpg",subseries:{id:"2",title:"Prosthodontics and Implant Dentistry"}}},{id:"82357",title:"Caries Management Aided by Fluorescence-Based Devices",doi:"10.5772/intechopen.105567",signatures:"Atena Galuscan, Daniela Jumanca and Aurora Doris Fratila",slug:"caries-management-aided-by-fluorescence-based-devices",totalDownloads:4,totalCrossrefCites:0,totalDimensionsCites:0,authors:null,book:{title:"Dental Caries - The Selection of Restoration Methods and Restorative Materials",coverURL:"https://cdn.intechopen.com/books/images_new/11565.jpg",subseries:{id:"1",title:"Oral Health"}}},{id:"81894",title:"Diet and Nutrition and Their Relationship with Early Childhood Dental Caries",doi:"10.5772/intechopen.105123",signatures:"Luanna Gonçalves Ferreira, Giuliana de Campos Chaves Lamarque and Francisco Wanderley Garcia Paula-Silva",slug:"diet-and-nutrition-and-their-relationship-with-early-childhood-dental-caries",totalDownloads:11,totalCrossrefCites:0,totalDimensionsCites:0,authors:null,book:{title:"Dental Caries - The Selection of Restoration Methods and Restorative Materials",coverURL:"https://cdn.intechopen.com/books/images_new/11565.jpg",subseries:{id:"1",title:"Oral Health"}}},{id:"81595",title:"Prosthetic Concepts in Dental Implantology",doi:"10.5772/intechopen.104725",signatures:"Ivica Pelivan",slug:"prosthetic-concepts-in-dental-implantology",totalDownloads:27,totalCrossrefCites:0,totalDimensionsCites:0,authors:null,book:{title:"Current Concepts in Dental Implantology - From Science to Clinical Research",coverURL:"https://cdn.intechopen.com/books/images_new/10808.jpg",subseries:{id:"2",title:"Prosthodontics and Implant Dentistry"}}}]},overviewPagePublishedBooks:{paginationCount:8,paginationItems:[{type:"book",id:"6668",title:"Dental Caries",subtitle:"Diagnosis, Prevention and Management",coverURL:"https://cdn.intechopen.com/books/images_new/6668.jpg",slug:"dental-caries-diagnosis-prevention-and-management",publishedDate:"September 19th 2018",editedByType:"Edited by",bookSignature:"Zühre Akarslan",hash:"b0f7667770a391f772726c3013c1b9ba",volumeInSeries:1,fullTitle:"Dental Caries - Diagnosis, Prevention and Management",editors:[{id:"171887",title:"Prof.",name:"Zühre",middleName:null,surname:"Akarslan",slug:"zuhre-akarslan",fullName:"Zühre Akarslan",profilePictureURL:"https://mts.intechopen.com/storage/users/171887/images/system/171887.jpg",biography:"Zühre Akarslan was born in 1977 in Cyprus. She graduated from Gazi University Faculty of Dentistry, Ankara, Turkey in 2000. \r\nLater she received her Ph.D. degree from the Oral Diagnosis and Radiology Department; which was recently renamed as Oral and Dentomaxillofacial Radiology, from the same university. \r\nShe is working as a full-time Associate Professor and is a lecturer and an academic researcher. \r\nHer expertise areas are dental caries, cancer, dental fear and anxiety, gag reflex in dentistry, oral medicine, and dentomaxillofacial radiology.",institutionString:"Gazi University",institution:{name:"Gazi University",institutionURL:null,country:{name:"Turkey"}}}]},{type:"book",id:"7139",title:"Current Approaches in Orthodontics",subtitle:null,coverURL:"https://cdn.intechopen.com/books/images_new/7139.jpg",slug:"current-approaches-in-orthodontics",publishedDate:"April 10th 2019",editedByType:"Edited by",bookSignature:"Belma Işık Aslan and Fatma Deniz Uzuner",hash:"2c77384eeb748cf05a898d65b9dcb48a",volumeInSeries:2,fullTitle:"Current Approaches in Orthodontics",editors:[{id:"42847",title:"Dr.",name:"Belma",middleName:null,surname:"Işik Aslan",slug:"belma-isik-aslan",fullName:"Belma Işik Aslan",profilePictureURL:"https://mts.intechopen.com/storage/users/42847/images/system/42847.jpg",biography:"Dr. Belma IşIk Aslan was born in 1976 in Ankara-TURKEY. After graduating from TED Ankara College in 1994, she attended to Gazi University, Faculty of Dentistry in Ankara. She completed her PhD in orthodontic education at Gazi University between 1999-2005. Dr. Işık Aslan stayed at the Providence Hospital Craniofacial Institude and Reconstructive Surgery in Michigan, USA for three months as an observer. She worked as a specialist doctor at Gazi University, Dentistry Faculty, Department of Orthodontics between 2005-2014. She was appointed as associate professor in January, 2014 and as professor in 2021. Dr. Işık Aslan still works as an instructor at the same faculty. She has published a total of 35 articles, 10 book chapters, 39 conference proceedings both internationally and nationally. Also she was the academic editor of the international book 'Current Advances in Orthodontics'. She is a member of the Turkish Orthodontic Society and Turkish Cleft Lip and Palate Society. She is married and has 2 children. Her knowledge of English is at an advanced level.",institutionString:"Gazi University Dentistry Faculty Department of Orthodontics",institution:null}]},{type:"book",id:"7572",title:"Trauma in Dentistry",subtitle:null,coverURL:"https://cdn.intechopen.com/books/images_new/7572.jpg",slug:"trauma-in-dentistry",publishedDate:"July 3rd 2019",editedByType:"Edited by",bookSignature:"Serdar Gözler",hash:"7cb94732cfb315f8d1e70ebf500eb8a9",volumeInSeries:3,fullTitle:"Trauma in Dentistry",editors:[{id:"204606",title:"Dr.",name:"Serdar",middleName:null,surname:"Gözler",slug:"serdar-gozler",fullName:"Serdar Gözler",profilePictureURL:"https://mts.intechopen.com/storage/users/204606/images/system/204606.jpeg",biography:"Dr. Serdar Gözler has completed his undergraduate studies at the Marmara University Faculty of Dentistry in 1978, followed by an assistantship in the Prosthesis Department of Dicle University Faculty of Dentistry. Starting his PhD work on non-resilient overdentures with Assoc. Prof. Hüsnü Yavuzyılmaz, he continued his studies with Prof. Dr. Gürbüz Öztürk of Istanbul University Faculty of Dentistry Department of Prosthodontics, this time on Gnatology. He attended training programs on occlusion, neurology, neurophysiology, EMG, radiology and biostatistics. In 1982, he presented his PhD thesis \\Gerber and Lauritzen Occlusion Analysis Techniques: Diagnosis Values,\\ at Istanbul University School of Dentistry, Department of Prosthodontics. As he was also working with Prof. Senih Çalıkkocaoğlu on The Physiology of Chewing at the same time, Gözler has written a chapter in Çalıkkocaoğlu\\'s book \\Complete Prostheses\\ entitled \\The Place of Neuromuscular Mechanism in Prosthetic Dentistry.\\ The book was published five times since by the Istanbul University Publications. Having presented in various conferences about occlusion analysis until 1998, Dr. Gözler has also decided to use the T-Scan II occlusion analysis method. Having been personally trained by Dr. Robert Kerstein on this method, Dr. Gözler has been lecturing on the T-Scan Occlusion Analysis Method in conferences both in Turkey and abroad. Dr. Gözler has various articles and presentations on Digital Occlusion Analysis methods. He is now Head of the TMD Clinic at Prosthodontic Department of Faculty of Dentistry , Istanbul Aydın University , Turkey.",institutionString:"Istanbul Aydin University",institution:{name:"Istanbul Aydın University",institutionURL:null,country:{name:"Turkey"}}}]},{type:"book",id:"7060",title:"Gingival Disease",subtitle:"A Professional Approach for Treatment and Prevention",coverURL:"https://cdn.intechopen.com/books/images_new/7060.jpg",slug:"gingival-disease-a-professional-approach-for-treatment-and-prevention",publishedDate:"October 23rd 2019",editedByType:"Edited by",bookSignature:"Alaa Eddin Omar Al Ostwani",hash:"b81d39988cba3a3cf746c1616912cf41",volumeInSeries:4,fullTitle:"Gingival Disease - A Professional Approach for Treatment and Prevention",editors:[{id:"240870",title:"Ph.D.",name:"Alaa Eddin Omar",middleName:null,surname:"Al Ostwani",slug:"alaa-eddin-omar-al-ostwani",fullName:"Alaa Eddin Omar Al Ostwani",profilePictureURL:"https://mts.intechopen.com/storage/users/240870/images/system/240870.jpeg",biography:"Dr. Al Ostwani Alaa Eddin Omar received his Master in dentistry from Damascus University in 2010, and his Ph.D. in Pediatric Dentistry from Damascus University in 2014. Dr. Al Ostwani is an assistant professor and faculty member at IUST University since 2014. \nDuring his academic experience, he has received several awards including the scientific research award from the Union of Arab Universities, the Syrian gold medal and the international gold medal for invention and creativity. Dr. Al Ostwani is a Member of the International Association of Dental Traumatology and the Syrian Society for Research and Preventive Dentistry since 2017. He is also a Member of the Reviewer Board of International Journal of Dental Medicine (IJDM), and the Indian Journal of Conservative and Endodontics since 2016.",institutionString:"International University for Science and Technology.",institution:{name:"Islamic University of Science and Technology",institutionURL:null,country:{name:"India"}}}]}]},openForSubmissionBooks:{paginationCount:3,paginationItems:[{id:"11570",title:"Influenza - New Approaches",coverURL:"https://cdn.intechopen.com/books/images_new/11570.jpg",hash:"157b379b9d7a4bf5e2cc7a742f155a44",secondStepPassed:!0,currentStepOfPublishingProcess:3,submissionDeadline:"May 10th 2022",isOpenForSubmission:!0,editors:[{id:"139889",title:"Dr.",name:"Seyyed Shamsadin",surname:"Athari",slug:"seyyed-shamsadin-athari",fullName:"Seyyed Shamsadin Athari"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null},{id:"11569",title:"Bacterial Sexually Transmitted Infections - New Findings, Diagnosis, Treatment, and Prevention",coverURL:"https://cdn.intechopen.com/books/images_new/11569.jpg",hash:"069d6142ecb0d46d14920102d48c0e9d",secondStepPassed:!0,currentStepOfPublishingProcess:3,submissionDeadline:"May 31st 2022",isOpenForSubmission:!0,editors:[{id:"189561",title:"Dr.",name:"Mihaela Laura",surname:"Vica",slug:"mihaela-laura-vica",fullName:"Mihaela Laura Vica"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null},{id:"11568",title:"Staphylococcal Infections - Recent Advances and Perspectives",coverURL:"https://cdn.intechopen.com/books/images_new/11568.jpg",hash:"92c881664d1921c7f2d0fee34b78cd08",secondStepPassed:!1,currentStepOfPublishingProcess:2,submissionDeadline:"July 8th 2022",isOpenForSubmission:!0,editors:[{id:"59719",title:"Dr.",name:"Jaime",surname:"Bustos-Martínez",slug:"jaime-bustos-martinez",fullName:"Jaime Bustos-Martínez"}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null}]},onlineFirstChapters:{paginationCount:10,paginationItems:[{id:"82380",title:"Evolution of Parasitism and Pathogenic Adaptations in Certain Medically Important Fungi",doi:"10.5772/intechopen.105206",signatures:"Gokul Shankar Sabesan, Ranjit Singh AJA, Ranjith Mehenderkar and Basanta Kumar Mohanty",slug:"evolution-of-parasitism-and-pathogenic-adaptations-in-certain-medically-important-fungi",totalDownloads:4,totalCrossrefCites:0,totalDimensionsCites:0,authors:null,book:{title:"Fungal Infectious Diseases - Annual Volume 2022",coverURL:"https://cdn.intechopen.com/books/images_new/11400.jpg",subseries:{id:"4",title:"Fungal Infectious Diseases"}}},{id:"82367",title:"Spatial Variation and Factors Associated with Unsuppressed HIV Viral Load among Women in an HIV Hyperendemic Area of KwaZulu-Natal, South Africa",doi:"10.5772/intechopen.105547",signatures:"Adenike O. Soogun, Ayesha B.M. Kharsany, Temesgen Zewotir and Delia North",slug:"spatial-variation-and-factors-associated-with-unsuppressed-hiv-viral-load-among-women-in-an-hiv-hype",totalDownloads:11,totalCrossrefCites:0,totalDimensionsCites:0,authors:null,book:{title:"HIV-AIDS - Updates, Perspectives and Applications",coverURL:"https://cdn.intechopen.com/books/images_new/11575.jpg",subseries:{id:"6",title:"Viral Infectious Diseases"}}},{id:"82193",title:"Enterococcal Infections: Recent Nomenclature and emerging trends",doi:"10.5772/intechopen.104792",signatures:"Kavita Raja",slug:"enterococcal-infections-recent-nomenclature-and-emerging-trends",totalDownloads:7,totalCrossrefCites:0,totalDimensionsCites:0,authors:null,book:{title:"Streptococcal Infections",coverURL:"https://cdn.intechopen.com/books/images_new/10828.jpg",subseries:{id:"3",title:"Bacterial Infectious Diseases"}}},{id:"82207",title:"Management Strategies in Perinatal HIV",doi:"10.5772/intechopen.105451",signatures:"Kayla Aleshire and Rima Bazzi",slug:"management-strategies-in-perinatal-hiv",totalDownloads:8,totalCrossrefCites:0,totalDimensionsCites:0,authors:null,book:{title:"HIV-AIDS - Updates, Perspectives and Applications",coverURL:"https://cdn.intechopen.com/books/images_new/11575.jpg",subseries:{id:"6",title:"Viral Infectious Diseases"}}},{id:"82013",title:"Streamlining Laboratory Tests for HIV Detection",doi:"10.5772/intechopen.105096",signatures:"Ramakrishna Prakash and Mysore Krishnamurthy Yashaswini",slug:"streamlining-laboratory-tests-for-hiv-detection",totalDownloads:3,totalCrossrefCites:0,totalDimensionsCites:0,authors:null,book:{title:"HIV-AIDS - Updates, Perspectives and Applications",coverURL:"https://cdn.intechopen.com/books/images_new/11575.jpg",subseries:{id:"6",title:"Viral Infectious Diseases"}}},{id:"81972",title:"The Submicroscopic Plasmodium falciparum Malaria in Sub-Saharan Africa; Current Understanding of the Host Immune System and New Perspectives",doi:"10.5772/intechopen.105086",signatures:"Kwame Kumi Asare",slug:"the-submicroscopic-plasmodium-falciparum-malaria-in-sub-saharan-africa-current-understanding-of-the-",totalDownloads:5,totalCrossrefCites:0,totalDimensionsCites:0,authors:null,book:{title:"Malaria - Recent Advances, and New Perspectives",coverURL:"https://cdn.intechopen.com/books/images_new/11576.jpg",subseries:{id:"5",title:"Parasitic Infectious Diseases"}}},{id:"81821",title:"Pneumococcal Carriage in Jordanian Children and the Importance of Vaccination",doi:"10.5772/intechopen.104999",signatures:"Adnan Al-Lahham",slug:"pneumococcal-carriage-in-jordanian-children-and-the-importance-of-vaccination",totalDownloads:6,totalCrossrefCites:0,totalDimensionsCites:0,authors:null,book:{title:"Streptococcal Infections",coverURL:"https://cdn.intechopen.com/books/images_new/10828.jpg",subseries:{id:"3",title:"Bacterial Infectious Diseases"}}},{id:"81813",title:"Schistosomiasis: Discovery of New Molecules for Disease Treatment and Vaccine Development",doi:"10.5772/intechopen.104738",signatures:"Andressa Barban do Patrocinio",slug:"schistosomiasis-discovery-of-new-molecules-for-disease-treatment-and-vaccine-development",totalDownloads:17,totalCrossrefCites:0,totalDimensionsCites:0,authors:null,book:{title:"New Horizons for Schistosomiasis Research",coverURL:"https://cdn.intechopen.com/books/images_new/10829.jpg",subseries:{id:"5",title:"Parasitic Infectious Diseases"}}},{id:"81644",title:"Perspective Chapter: Ethics of Using Placebo Controlled Trials for Covid-19 Vaccine Development in Vulnerable Populations",doi:"10.5772/intechopen.104776",signatures:"Lesley Burgess, Jurie Jordaan and Matthew Wilson",slug:"perspective-chapter-ethics-of-using-placebo-controlled-trials-for-covid-19-vaccine-development-in-vu",totalDownloads:22,totalCrossrefCites:0,totalDimensionsCites:0,authors:null,book:{title:"SARS-CoV-2 Variants - Two Years After",coverURL:"https://cdn.intechopen.com/books/images_new/11573.jpg",subseries:{id:"6",title:"Viral Infectious Diseases"}}},{id:"80546",title:"Streptococcal Skin and Skin-Structure Infections",doi:"10.5772/intechopen.102894",signatures:"Alwyn Rapose",slug:"streptococcal-skin-and-skin-structure-infections",totalDownloads:64,totalCrossrefCites:0,totalDimensionsCites:0,authors:null,book:{title:"Streptococcal Infections",coverURL:"https://cdn.intechopen.com/books/images_new/10828.jpg",subseries:{id:"3",title:"Bacterial Infectious Diseases"}}}]},subseriesFiltersForOFChapters:[{caption:"Fungal Infectious Diseases",value:4,count:1,group:"subseries"},{caption:"Parasitic Infectious Diseases",value:5,count:2,group:"subseries"},{caption:"Bacterial Infectious Diseases",value:3,count:3,group:"subseries"},{caption:"Viral Infectious Diseases",value:6,count:4,group:"subseries"}],publishedBooks:{paginationCount:1,paginationItems:[{type:"book",id:"10843",title:"Persistent Organic Pollutants (POPs)",subtitle:"Monitoring, Impact and Treatment",coverURL:"https://cdn.intechopen.com/books/images_new/10843.jpg",slug:"persistent-organic-pollutants-pops-monitoring-impact-and-treatment",publishedDate:"April 13th 2022",editedByType:"Edited by",bookSignature:"Mohamed Nageeb Rashed",hash:"f5b1589f0a990b6114fef2dadc735dd9",volumeInSeries:1,fullTitle:"Persistent Organic Pollutants (POPs) - Monitoring, Impact and Treatment",editors:[{id:"63465",title:"Prof.",name:"Mohamed Nageeb",middleName:null,surname:"Rashed",slug:"mohamed-nageeb-rashed",fullName:"Mohamed Nageeb Rashed",profilePictureURL:"https://mts.intechopen.com/storage/users/63465/images/system/63465.gif",institutionString:null,institution:{name:"Aswan University",institutionURL:null,country:{name:"Egypt"}}}],equalEditorOne:null,equalEditorTwo:null,equalEditorThree:null}]},subseriesFiltersForPublishedBooks:[{group:"subseries",caption:"Pollution",value:38,count:1}],publicationYearFilters:[{group:"publicationYear",caption:"2022",value:2022,count:1}],authors:{paginationCount:301,paginationItems:[{id:"116250",title:"Dr.",name:"Nima",middleName:null,surname:"Rezaei",slug:"nima-rezaei",fullName:"Nima Rezaei",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/116250/images/system/116250.jpg",biography:"Professor Nima Rezaei obtained an MD from Tehran University of Medical Sciences, Iran. He also obtained an MSc in Molecular and Genetic Medicine, and a Ph.D. in Clinical Immunology and Human Genetics from the University of Sheffield, UK. He also completed a short-term fellowship in Pediatric Clinical Immunology and Bone Marrow Transplantation at Newcastle General Hospital, England. Dr. Rezaei is a Full Professor of Immunology and Vice Dean of International Affairs and Research, at the School of Medicine, Tehran University of Medical Sciences, and the co-founder and head of the Research Center for Immunodeficiencies. He is also the founding president of the Universal Scientific Education and Research Network (USERN). Dr. Rezaei has directed more than 100 research projects and has designed and participated in several international collaborative projects. He is an editor, editorial assistant, or editorial board member of more than forty international journals. He has edited more than 50 international books, presented more than 500 lectures/posters in congresses/meetings, and published more than 1,100 scientific papers in international journals.",institutionString:"Tehran University of Medical Sciences",institution:{name:"Tehran University of Medical Sciences",country:{name:"Iran"}}},{id:"180733",title:"Dr.",name:"Jean",middleName:null,surname:"Engohang-Ndong",slug:"jean-engohang-ndong",fullName:"Jean Engohang-Ndong",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/180733/images/system/180733.png",biography:"Dr. Jean Engohang-Ndong was born and raised in Gabon. After obtaining his Associate Degree of Science at the University of Science and Technology of Masuku, Gabon, he continued his education in France where he obtained his BS, MS, and Ph.D. in Medical Microbiology. He worked as a post-doctoral fellow at the Public Health Research Institute (PHRI), Newark, NJ for four years before accepting a three-year faculty position at Brigham Young University-Hawaii. Dr. Engohang-Ndong is a tenured faculty member with the academic rank of Full Professor at Kent State University, Ohio, where he teaches a wide range of biological science courses and pursues his research in medical and environmental microbiology. Recently, he expanded his research interest to epidemiology and biostatistics of chronic diseases in Gabon.",institutionString:"Kent State University",institution:{name:"Kent State University",country:{name:"United States of America"}}},{id:"188773",title:"Prof.",name:"Emmanuel",middleName:null,surname:"Drouet",slug:"emmanuel-drouet",fullName:"Emmanuel Drouet",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/188773/images/system/188773.png",biography:"Emmanuel Drouet, PharmD, is a Professor of Virology at the Faculty of Pharmacy, the University Grenoble-Alpes, France. As a head scientist at the Institute of Structural Biology in Grenoble, Dr. Drouet’s research investigates persisting viruses in humans (RNA and DNA viruses) and the balance with our host immune system. He focuses on these viruses’ effects on humans (both their impact on pathology and their symbiotic relationships in humans). He has an excellent track record in the herpesvirus field, and his group is engaged in clinical research in the field of Epstein-Barr virus diseases. He is the editor of the online Encyclopedia of Environment and he coordinates the Universal Health Coverage education program for the BioHealth Computing Schools of the European Institute of Science.",institutionString:null,institution:{name:"Grenoble Alpes University",country:{name:"France"}}},{id:"131400",title:"Prof.",name:"Alfonso J.",middleName:null,surname:"Rodriguez-Morales",slug:"alfonso-j.-rodriguez-morales",fullName:"Alfonso J. Rodriguez-Morales",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/131400/images/system/131400.png",biography:"Dr. Rodriguez-Morales is an expert in tropical and emerging diseases, particularly zoonotic and vector-borne diseases (especially arboviral diseases). He is the president of the Travel Medicine Committee of the Pan-American Infectious Diseases Association (API), as well as the president of the Colombian Association of Infectious Diseases (ACIN). He is a member of the Committee on Tropical Medicine, Zoonoses, and Travel Medicine of ACIN. He is a vice-president of the Latin American Society for Travel Medicine (SLAMVI) and a Member of the Council of the International Society for Infectious Diseases (ISID). Since 2014, he has been recognized as a Senior Researcher, at the Ministry of Science of Colombia. He is a professor at the Faculty of Medicine of the Fundacion Universitaria Autonoma de las Americas, in Pereira, Risaralda, Colombia. He is an External Professor, Master in Research on Tropical Medicine and International Health, Universitat de Barcelona, Spain. He is also a professor at the Master in Clinical Epidemiology and Biostatistics, Universidad Científica del Sur, Lima, Peru. In 2021 he has been awarded the “Raul Isturiz Award” Medal of the API. Also, in 2021, he was awarded with the “Jose Felix Patiño” Asclepius Staff Medal of the Colombian Medical College, due to his scientific contributions to COVID-19 during the pandemic. He is currently the Editor in Chief of the journal Travel Medicine and Infectious Diseases. His Scopus H index is 47 (Google Scholar H index, 68).",institutionString:"Institución Universitaria Visión de las Américas, Colombia",institution:null},{id:"332819",title:"Dr.",name:"Chukwudi Michael",middleName:"Michael",surname:"Egbuche",slug:"chukwudi-michael-egbuche",fullName:"Chukwudi Michael Egbuche",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/332819/images/14624_n.jpg",biography:"I an Dr. Chukwudi Michael Egbuche. I am a Senior Lecturer in the Department of Parasitology and Entomology, Nnamdi Azikiwe University, Awka.",institutionString:null,institution:{name:"Nnamdi Azikiwe University",country:{name:"Nigeria"}}},{id:"284232",title:"Mr.",name:"Nikunj",middleName:"U",surname:"Tandel",slug:"nikunj-tandel",fullName:"Nikunj Tandel",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/284232/images/8275_n.jpg",biography:'Mr. Nikunj Tandel has completed his Master\'s degree in Biotechnology from VIT University, India in the year of 2012. He is having 8 years of research experience especially in the field of malaria epidemiology, immunology, and nanoparticle-based drug delivery system against the infectious diseases, autoimmune disorders and cancer. He has worked for the NIH funded-International Center of Excellence in Malaria Research project "Center for the study of complex malaria in India (CSCMi)" in collaboration with New York University. The preliminary objectives of the study are to understand and develop the evidence-based tools and interventions for the control and prevention of malaria in different sites of the INDIA. Alongside, with the help of next-generation genomics study, the team has studied the antimalarial drug resistance in India. Further, he has extended his research in the development of Humanized mice for the study of liver-stage malaria and identification of molecular marker(s) for the Artemisinin resistance. At present, his research focuses on understanding the role of B cells in the activation of CD8+ T cells in malaria. Received the CSIR-SRF (Senior Research Fellow) award-2018, FIMSA (Federation of Immunological Societies of Asia-Oceania) Travel Bursary award to attend the IUIS-IIS-FIMSA Immunology course-2019',institutionString:"Nirma University",institution:{name:"Nirma University",country:{name:"India"}}},{id:"334383",title:"Ph.D.",name:"Simone",middleName:"Ulrich",surname:"Ulrich Picoli",slug:"simone-ulrich-picoli",fullName:"Simone Ulrich Picoli",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/334383/images/15919_n.jpg",biography:"Graduated in Pharmacy from Universidade Luterana do Brasil (1999), Master in Agricultural and Environmental Microbiology from Federal University of Rio Grande do Sul (2002), Specialization in Clinical Microbiology from Universidade de São Paulo, USP (2007) and PhD in Sciences in Gastroenterology and Hepatology (2012). She is currently an Adjunct Professor at Feevale University in Medicine and Biomedicine courses and a permanent professor of the Academic Master\\'s Degree in Virology. She has experience in the field of Microbiology, with an emphasis on Bacteriology, working mainly on the following topics: bacteriophages, bacterial resistance, clinical microbiology and food microbiology.",institutionString:null,institution:{name:"Universidade Feevale",country:{name:"Brazil"}}},{id:"229220",title:"Dr.",name:"Amjad",middleName:"Islam",surname:"Aqib",slug:"amjad-aqib",fullName:"Amjad Aqib",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/229220/images/system/229220.png",biography:"Dr. Amjad Islam Aqib obtained a DVM and MSc (Hons) from University of Agriculture Faisalabad (UAF), Pakistan, and a PhD from the University of Veterinary and Animal Sciences Lahore, Pakistan. Dr. Aqib joined the Department of Clinical Medicine and Surgery at UAF for one year as an assistant professor where he developed a research laboratory designated for pathogenic bacteria. Since 2018, he has been Assistant Professor/Officer in-charge, Department of Medicine, Manager Research Operations and Development-ORIC, and President One Health Club at Cholistan University of Veterinary and Animal Sciences, Bahawalpur, Pakistan. He has nearly 100 publications to his credit. His research interests include epidemiological patterns and molecular analysis of antimicrobial resistance and modulation and vaccine development against animal pathogens of public health concern.",institutionString:"Cholistan University of Veterinary and Animal Sciences",institution:null},{id:"62900",title:"Prof.",name:"Fethi",middleName:null,surname:"Derbel",slug:"fethi-derbel",fullName:"Fethi Derbel",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/62900/images/system/62900.jpeg",biography:"Professor Fethi Derbel was born in 1960 in Tunisia. He received his medical degree from the Sousse Faculty of Medicine at Sousse, University of Sousse, Tunisia. He completed his surgical residency in General Surgery at the University Hospital Farhat Hached of Sousse and was a member of the Unit of Liver Transplantation in the University of Rennes, France. He then worked in the Department of Surgery at the Sahloul University Hospital in Sousse. Professor Derbel is presently working at the Clinique les Oliviers, Sousse, Tunisia. His hospital activities are mostly concerned with laparoscopic, colorectal, pancreatic, hepatobiliary, and gastric surgery. He is also very interested in hernia surgery and performs ventral hernia repairs and inguinal hernia repairs. He has been a member of the GREPA and Tunisian Hernia Society (THS). During his residency, he managed patients suffering from diabetic foot, and he was very interested in this pathology. For this reason, he decided to coordinate a book project dealing with the diabetic foot. Professor Derbel has published many articles in journals and collaborates intensively with IntechOpen Access Publisher as an editor.",institutionString:"Clinique les Oliviers",institution:null},{id:"300144",title:"Dr.",name:"Meriem",middleName:null,surname:"Braiki",slug:"meriem-braiki",fullName:"Meriem Braiki",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/300144/images/system/300144.jpg",biography:"Dr. Meriem Braiki is a specialist in pediatric surgeon from Tunisia. She was born in 1985. She received her medical degree from the University of Medicine at Sousse, Tunisia. She achieved her surgical residency training periods in Pediatric Surgery departments at University Hospitals in Monastir, Tunis and France.\r\nShe is currently working at the Pediatric surgery department, Sidi Bouzid Hospital, Tunisia. Her hospital activities are mostly concerned with laparoscopic, parietal, urological and digestive surgery. She has published several articles in diffrent journals.",institutionString:"Sidi Bouzid Regional Hospital",institution:null},{id:"229481",title:"Dr.",name:"Erika M.",middleName:"Martins",surname:"de Carvalho",slug:"erika-m.-de-carvalho",fullName:"Erika M. de Carvalho",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/229481/images/6397_n.jpg",biography:null,institutionString:null,institution:{name:"Oswaldo Cruz Foundation",country:{name:"Brazil"}}},{id:"186537",title:"Prof.",name:"Tonay",middleName:null,surname:"Inceboz",slug:"tonay-inceboz",fullName:"Tonay Inceboz",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/186537/images/system/186537.jfif",biography:"I was graduated from Ege University of Medical Faculty (Turkey) in 1988 and completed his Med. PhD degree in Medical Parasitology at the same university. I became an Associate Professor in 2008 and Professor in 2014. I am currently working as a Professor at the Department of Medical Parasitology at Dokuz Eylul University, Izmir, Turkey.\n\nI have given many lectures, presentations in different academic meetings. I have more than 60 articles in peer-reviewed journals, 18 book chapters, 1 book editorship.\n\nMy research interests are Echinococcus granulosus, Echinococcus multilocularis (diagnosis, life cycle, in vitro and in vivo cultivation), and Trichomonas vaginalis (diagnosis, PCR, and in vitro cultivation).",institutionString:"Dokuz Eylül University",institution:{name:"Dokuz Eylül University",country:{name:"Turkey"}}},{id:"71812",title:"Prof.",name:"Hanem Fathy",middleName:"Fathy",surname:"Khater",slug:"hanem-fathy-khater",fullName:"Hanem Fathy Khater",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/71812/images/1167_n.jpg",biography:"Prof. Khater is a Professor of Parasitology at Benha University, Egypt. She studied for her doctoral degree, at the Department of Entomology, College of Agriculture, Food and Natural Resources, University of Missouri, Columbia, USA. She has completed her Ph.D. degrees in Parasitology in Egypt, from where she got the award for “the best scientific Ph.D. dissertation”. She worked at the School of Biological Sciences, Bristol, England, the UK in controlling insects of medical and veterinary importance as a grant from Newton Mosharafa, the British Council. Her research is focused on searching of pesticides against mosquitoes, house flies, lice, green bottle fly, camel nasal botfly, soft and hard ticks, mites, and the diamondback moth as well as control of several parasites using safe and natural materials to avoid drug resistances and environmental contamination.",institutionString:null,institution:{name:"Banha University",country:{name:"Egypt"}}},{id:"99780",title:"Prof.",name:"Omolade",middleName:"Olayinka",surname:"Okwa",slug:"omolade-okwa",fullName:"Omolade Okwa",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/99780/images/system/99780.jpg",biography:"Omolade Olayinka Okwa is presently a Professor of Parasitology at Lagos State University, Nigeria. She has a PhD in Parasitology (1997), an MSc in Cellular Parasitology (1992), and a BSc (Hons) Zoology (1990) all from the University of Ibadan, Nigeria. She teaches parasitology at the undergraduate and postgraduate levels. She was a recipient of a Commonwealth fellowship supported by British Council tenable at the Centre for Entomology and Parasitology (CAEP), Keele University, United Kingdom between 2004 and 2005. She was awarded an Honorary Visiting Research Fellow at the same university from 2005 to 2007. \nShe has been an external examiner to the Department of Veterinary Microbiology and Parasitology, University of Ibadan, MSc programme between 2010 and 2012. She is a member of the Nigerian Society of Experimental Biology (NISEB), Parasitology and Public Health Society of Nigeria (PPSN), Science Association of Nigeria (SAN), Zoological Society of Nigeria (ZSN), and is Vice Chairperson of the Organisation of Women in Science (OWSG), LASU chapter. She served as Head of Department of Zoology and Environmental Biology, Lagos State University from 2007 to 2010 and 2014 to 2016. She is a reviewer for several local and international journals such as Unilag Journal of Science, Libyan Journal of Medicine, Journal of Medicine and Medical Sciences, and Annual Research and Review in Science. \nShe has authored 45 scientific research publications in local and international journals, 8 scientific reviews, 4 books, and 3 book chapters, which includes the books “Malaria Parasites” and “Malaria” which are IntechOpen access publications.",institutionString:"Lagos State University",institution:{name:"Lagos State University",country:{name:"Nigeria"}}},{id:"273100",title:"Dr.",name:"Vijay",middleName:null,surname:"Gayam",slug:"vijay-gayam",fullName:"Vijay Gayam",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/273100/images/system/273100.jpeg",biography:"Dr. Vijay Bhaskar Reddy Gayam is currently practicing as an internist at Interfaith Medical Center in Brooklyn, New York, USA. He is also a Clinical Assistant Professor at the SUNY Downstate University Hospital and Adjunct Professor of Medicine at the American University of Antigua. He is a holder of an M.B.B.S. degree bestowed to him by Osmania Medical College and received his M.D. at Interfaith Medical Center. His career goals thus far have heavily focused on direct patient care, medical education, and clinical research. He currently serves in two leadership capacities; Assistant Program Director of Medicine at Interfaith Medical Center and as a Councilor for the American\r\nFederation for Medical Research. As a true academician and researcher, he has more than 50 papers indexed in international peer-reviewed journals. He has also presented numerous papers in multiple national and international scientific conferences. His areas of research interest include general internal medicine, gastroenterology and hepatology. He serves as an editor, editorial board member and reviewer for multiple international journals. His research on Hepatitis C has been very successful and has led to multiple research awards, including the 'Equity in Prevention and Treatment Award” from the New York Department of Health Viral Hepatitis Symposium (2018) and the 'Presidential Poster Award” awarded to him by the American College of Gastroenterology (2018). He was also awarded 'Outstanding Clinician in General Medicine” by Venus International Foundation for his extensive research expertise and services, perform over and above the standard expected in the advancement of healthcare, patient safety and quality of care.",institutionString:"Interfaith Medical Center",institution:{name:"Interfaith Medical Center",country:{name:"United States of America"}}},{id:"93517",title:"Dr.",name:"Clement",middleName:"Adebajo",surname:"Meseko",slug:"clement-meseko",fullName:"Clement Meseko",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/93517/images/system/93517.jpg",biography:"Dr. Clement Meseko obtained DVM and PhD degree in Veterinary Medicine and Virology respectively. He has worked for over 20 years in both private and public sectors including the academia, contributing to knowledge and control of infectious disease. Through the application of epidemiological skill, classical and molecular virological skills, he investigates viruses of economic and public health importance for the mitigation of the negative impact on people, animal and the environment in the context of Onehealth. \r\nDr. Meseko’s field experience on animal and zoonotic diseases and pathogen dynamics at the human-animal interface over the years shaped his carrier in research and scientific inquiries. He has been part of the investigation of Highly Pathogenic Avian Influenza incursions in sub Saharan Africa and monitors swine Influenza (Pandemic influenza Virus) agro-ecology and potential for interspecies transmission. He has authored and reviewed a number of journal articles and book chapters.",institutionString:"National Veterinary Research Institute",institution:{name:"National Veterinary Research Institute",country:{name:"Nigeria"}}},{id:"158026",title:"Prof.",name:"Shailendra K.",middleName:null,surname:"Saxena",slug:"shailendra-k.-saxena",fullName:"Shailendra K. Saxena",position:null,profilePictureURL:"https://s3.us-east-1.amazonaws.com/intech-files/0030O00002bRET3QAO/Profile_Picture_2022-05-10T10:10:26.jpeg",biography:"Professor Dr. Shailendra K. Saxena is a vice dean and professor at King George's Medical University, Lucknow, India. His research interests involve understanding the molecular mechanisms of host defense during human viral infections and developing new predictive, preventive, and therapeutic strategies for them using Japanese encephalitis virus (JEV), HIV, and emerging viruses as a model via stem cell and cell culture technologies. His research work has been published in various high-impact factor journals (Science, PNAS, Nature Medicine) with a high number of citations. He has received many awards and honors in India and abroad including various Young Scientist Awards, BBSRC India Partnering Award, and Dr. JC Bose National Award of Department of Biotechnology, Min. of Science and Technology, Govt. of India. Dr. Saxena is a fellow of various international societies/academies including the Royal College of Pathologists, United Kingdom; Royal Society of Medicine, London; Royal Society of Biology, United Kingdom; Royal Society of Chemistry, London; and Academy of Translational Medicine Professionals, Austria. He was named a Global Leader in Science by The Scientist. He is also an international opinion leader/expert in vaccination for Japanese encephalitis by IPIC (UK).",institutionString:"King George's Medical University",institution:{name:"King George's Medical University",country:{name:"India"}}},{id:"94928",title:"Dr.",name:"Takuo",middleName:null,surname:"Mizukami",slug:"takuo-mizukami",fullName:"Takuo Mizukami",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/94928/images/6402_n.jpg",biography:null,institutionString:null,institution:{name:"National Institute of Infectious Diseases",country:{name:"Japan"}}},{id:"233433",title:"Dr.",name:"Yulia",middleName:null,surname:"Desheva",slug:"yulia-desheva",fullName:"Yulia Desheva",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/233433/images/system/233433.png",biography:"Dr. Yulia Desheva is a leading researcher at the Institute of Experimental Medicine, St. Petersburg, Russia. She is a professor in the Stomatology Faculty, St. Petersburg State University. She has expertise in the development and evaluation of a wide range of live mucosal vaccines against influenza and bacterial complications. Her research interests include immunity against influenza and COVID-19 and the development of immunization schemes for high-risk individuals.",institutionString:'Federal State Budgetary Scientific Institution "Institute of Experimental Medicine"',institution:null},{id:"238958",title:"Mr.",name:"Atamjit",middleName:null,surname:"Singh",slug:"atamjit-singh",fullName:"Atamjit Singh",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/238958/images/6575_n.jpg",biography:null,institutionString:null,institution:null},{id:"333753",title:"Dr.",name:"Rais",middleName:null,surname:"Ahmed",slug:"rais-ahmed",fullName:"Rais Ahmed",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/333753/images/20168_n.jpg",biography:null,institutionString:null,institution:null},{id:"252058",title:"M.Sc.",name:"Juan",middleName:null,surname:"Sulca",slug:"juan-sulca",fullName:"Juan Sulca",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/252058/images/12834_n.jpg",biography:null,institutionString:null,institution:null},{id:"191392",title:"Dr.",name:"Marimuthu",middleName:null,surname:"Govindarajan",slug:"marimuthu-govindarajan",fullName:"Marimuthu Govindarajan",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/191392/images/5828_n.jpg",biography:"Dr. M. Govindarajan completed his BSc degree in Zoology at Government Arts College (Autonomous), Kumbakonam, and MSc, MPhil, and PhD degrees at Annamalai University, Annamalai Nagar, Tamil Nadu, India. He is serving as an assistant professor at the Department of Zoology, Annamalai University. His research interests include isolation, identification, and characterization of biologically active molecules from plants and microbes. He has identified more than 20 pure compounds with high mosquitocidal activity and also conducted high-quality research on photochemistry and nanosynthesis. He has published more than 150 studies in journals with impact factor and 2 books in Lambert Academic Publishing, Germany. He serves as an editorial board member in various national and international scientific journals.",institutionString:null,institution:null},{id:"274660",title:"Dr.",name:"Damodar",middleName:null,surname:"Paudel",slug:"damodar-paudel",fullName:"Damodar Paudel",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/274660/images/8176_n.jpg",biography:"I am DrDamodar Paudel,currently working as consultant Physician in Nepal police Hospital.",institutionString:null,institution:null},{id:"241562",title:"Dr.",name:"Melvin",middleName:null,surname:"Sanicas",slug:"melvin-sanicas",fullName:"Melvin Sanicas",position:null,profilePictureURL:"https://mts.intechopen.com/storage/users/241562/images/6699_n.jpg",biography:null,institutionString:null,institution:null},{id:"337446",title:"Dr.",name:"Maria",middleName:null,surname:"Zavala-Colon",slug:"maria-zavala-colon",fullName:"Maria Zavala-Colon",position:null,profilePictureURL:"//cdnintech.com/web/frontend/www/assets/author.svg",biography:null,institutionString:null,institution:{name:"University of Puerto Rico, Medical Sciences Campus",country:{name:"United States of America"}}},{id:"338856",title:"Mrs.",name:"Nur Alvira",middleName:null,surname:"Pascawati",slug:"nur-alvira-pascawati",fullName:"Nur Alvira Pascawati",position:null,profilePictureURL:"//cdnintech.com/web/frontend/www/assets/author.svg",biography:null,institutionString:null,institution:{name:"Universitas Respati Yogyakarta",country:{name:"Indonesia"}}},{id:"441116",title:"Dr.",name:"Jovanka M.",middleName:null,surname:"Voyich",slug:"jovanka-m.-voyich",fullName:"Jovanka M. Voyich",position:null,profilePictureURL:"//cdnintech.com/web/frontend/www/assets/author.svg",biography:null,institutionString:null,institution:{name:"Montana State University",country:{name:"United States of America"}}},{id:"330412",title:"Dr.",name:"Muhammad",middleName:null,surname:"Farhab",slug:"muhammad-farhab",fullName:"Muhammad Farhab",position:null,profilePictureURL:"//cdnintech.com/web/frontend/www/assets/author.svg",biography:null,institutionString:null,institution:{name:"University of Agriculture Faisalabad",country:{name:"Pakistan"}}},{id:"349495",title:"Dr.",name:"Muhammad",middleName:null,surname:"Ijaz",slug:"muhammad-ijaz",fullName:"Muhammad Ijaz",position:null,profilePictureURL:"//cdnintech.com/web/frontend/www/assets/author.svg",biography:null,institutionString:null,institution:{name:"University of Veterinary and Animal Sciences",country:{name:"Pakistan"}}}]}},subseries:{item:{id:"95",type:"subseries",title:"Urban Planning and Environmental Management",keywords:"Circular economy, Contingency planning and response to disasters, Ecosystem services, Integrated urban water management, Nature-based solutions, Sustainable urban development, Urban green spaces",scope:"