Resistant genes for different insects along with their primer sequences, origin, and location
1. Introduction
Wheat is one of the major cereal crops with annual global production over 600 MT from about 200 M hectares (FAO 2012). The cultivation of wheat started about 10,000 years ago as part of the Neolithic revolution which state a transition from hunting and gathering of food to settle agriculture. Earlier cultivated forms of wheat were diploid (einkorn) and tetraploid (emmer) with known initial origin of the south-eastern part of Turkey (Dubcovsky and Dvorak, 2007). Subsequent evolutionary adaptation and continuous research produced hexaploid bread wheat that is currently widely adapted in about 95% area of world wheat. Globally, all crop production practices are being highly challeged by biotic and abiotic stresses. Biotic stresses especially insect pests and dieseases causes devastating damage in terms of yield and quality. On average pests cause 20-37% yield losses woldwide which translating to approximately $70 billion annually (Pimentel et al., 1997). In agro-ecosystems, herbivore insects are abudant and likely to colonise within same population and disperse from one crop field to another depending on the availablility of plant tissues and feeding behaviour of insects. Quantitative feeding style of the herbivore insect on specific crop resulting significant damage to the crop during the entire life cyle which is believed specific insect as pest of that perticular crop. Single pest may attack multiple crops within single growing season that make crop rotation and pest management more challenged. Wheat producing areas encounter with either sucking and pericing pests or plant tissue feeding pests. Regional pests also observed in wheat growing areas as major damaging pests woldwide. The breeding strategy againsts these insects/pests heavily rely on the inheritance of resistance mechanism in the crops under consideration. The insect resitance is mainly goverened by three types of mechanisms/genes i.e., oligogenes; where resistance is confered by single genes as in case of hessian fly in wheat, polygenes; where several genes having small and additive effect bring about resistance against insects as in case of cereal leaf beetle in wheat and sometime cytoplasmic genes also confer resitance againsts insects/pest e.g., in maize and lettuce against European corn borer and root aphid respectively.
Large numbers of chemical formulations have been developed as pesticides to chemically control pest problems in different crops, however, control during all stages of insect life i.e. egg, larva, pupa and adult is almost impossible. It is therefore important to understand biology of insect pest simultenously with the crop biology to unserstand when, where and what chemical should be used to control specific insect/pest more effectively. In addition, integrated pest management practices can also enhance control measures with mininum input and with no or less environmental hazards.
In this review, we have outlined major insects of wheat alongwith their biology and controll stretagies to minimize grain yield losses.
2. Wheat aphids
There are six species of aphids that damage cereals.These species include
Russian Wheat Aphid (RWA) is known to be a sporadic insect causing significant yield losses by spreading out from its origin. The centre of origin for RWA is considered to be the central Asian mountains of Caucasus and Tian Shan. The specie could now be found in South Africa, Western United States, Central and Southern Europe and Middle east (Berzonsky et al., 2003). The RWA was first reported in South Africa in 1978 (Walters 1984), in Mexico during 1980 (Gilchrist et al., 1984), in United States in 1986 and Canadian Prairie Provinces during 1988 (Morrison et al., 1988). RWA is present in almost all significant wheat producing areas of the world except Australia (Hughes and Maywald 1990). RWA attacks most of the cereals including wheat, barley, triticale, rye and oat. Alternate hosts for RWA are cool season (crested) and wheat grasses (
2.1. Biology
Climatic conditions and temperature in particular, plays a significant role in population dynamics of the aphids. A warmer temperature can potentially accelerate the aphid’s growth both in terms of number and size, yet, the extreme temperatures can possibly limit the survival and spread of the aphids. RWA is known to be present in its three different morphological types−immature wingless females, mature wingless females and mature winged females. Winged mature females or
2.2. Strategies to mitigate RWA
A number of strategies have been deployed to mitigate RWA. Among these strategies, the host plant resistance has been the most effective and economic method to induce antixenosis, antibiosis and/or tolerance against RWA. RWA host plant resistance is well known to be qualitative in nature, and about nine resistance genes have been documented so far. These genes are:
3. Bird cherry-oat aphid
Bird cherry oat aphids can saliently be characterised due to their high adaptive biological plasticity and transmission of viral diseases−
3.1. Biology
Bird cherry oat aphid has the ability to multiply parthenogenically for one or more than one generation and subsequently undergo sexual reproduction. Bird cherry oat aphid alates fly to the primary host during autumn to mate and produce eggs. Change in environmental conditions stimulates the reproductive growth in Bird cherry oat aphid, to overwinter as eggs (Lees 1966), although it can survive in the regions of mild winter (Carter et al., 1980) and/or by descending down beneath the soil surface and feeding from the base of stalks (Wiktelius, 1987). An equivocal role of temperature in the survival of eggs has been reported in literature with a number of studies reporting the positive correlation between bird cherry oat aphid population and warm winters (Pierre 1987). However, certain clones adaptive to a site of cooler temperatures have shown considerable ability to withstand winter temperatures (Griffiths and Wratten 1979). Therefore, it could be very tempting to conclude a strong positive correlation between temperature and increase in population of Bird Cherry Oat Aphid.
The feeding symptoms of bird cherry oat aphids are almost absent. Direct yield losses caused by bird cherry oat aphid are greatly dependent upon plant growth stage; as 24-65% losses can occur in case of infestation at seedling stage, and very low or non-significant yield losses from booting or later stages have been reported (Kieckhefer et al., 1995; Voss et al., 1997). Indirect yield losses are caused by transmitting viral diseases
3.2. Strategies to mitigate bird cherry oat aphid
Number of studies have produced contrary results in the perspective of host plant resistance against bird cherry oat aphid. This might have happened due to very high biological plasticity of bird cherry oat aphids, presence of number of clones and related species in different geographical regions and different plant traits conferring resistance. Comprehensive and effective resistance against bird cherry oat aphid is typically possible when one has a detailed understanding of plant resistance mechanism to a particular growth stage of bird cherry oat aphid life cycle. In this scenario, numerous experiments have been designed to explore the most effective stage in the life cycle to limit the population of bird cherry oat aphid and its relationship to the extent of plant damage (Rauttapaa 1970; Markkula and Roukka 1972; Lowe 1980). Plant traits or mechanisms that induce nymphal mortality, elongated development at seedling stage and reduce birth rate at flowering are reportedly the most effective mechanisms to manage bird cherry oat aphid (Wiktelius and Pettersson 1985). Plant traits that can prevent the bird cherry oat aphid inoculating the phloem and can reduce the proportional production of winged females, can limit the BYD dispersal to other plants (Gibson and Plumb 1977).
4. Greenbug
4.1. Biology
Greenbug is a light green, small size (about 3 mm in length), and sap sucking arthropod. It injects its stylet in sieve tubes, by secreting protenacious saliva to facilitate penetration. Greenbug passively feed on sap upon a successful connection to the sieve tube (Miles 1999). Yellow to red lesions surrounded by a large cholrotic area can be readily identified on leaf surface, which turn necrotic with time. A seven-days feeding of 30 aphids per culm reportedly caused 40% grain weight losses on winter wheat (Kieckhefer and Kantack 1988). Greenbug is also reported to significantly reduce root length (Burton 1986) and hence limiting the plant capability to withstand drought stress. Greenbug has also been confirmed to vector
4.2. Strategies to mitigate greenbug
A regular detection of new greenbug biotypes has more or less necessitated the use of two strategies to mitigate its severe outbreaks: the chemical control method and host plant resistance. A number of chemicals have been used against greenbug including dimethoate, parathion, methyl parathion, chlorpyrifos, imidacloprid and malathion with varying doses depending upon the threshold on a specific growth stage. Extensive use of chemicals had not only induced insecticide resistance in the greenbug, but also has environmental concerns in addition to the extra cost. Therefore, the researchers continuously looked for host plant resistance against the greenbug. Qualitative inheritance of resistance conferred by both dominant and recessive genes is well documented in literature with gene symbols as: gb1,
5. Cereal leaf beetle
Cereal leaf beetle is an insect of cereal or small grain grasses. The particular origin of the insect is still unknown, however, it is considered to be a native insect of Europe and Asia. It is a serious insect in Eastern and South-Eastern Europe including Hungary, Yugoslavia, Poland, and Rumania. It is now considered to be present all over the Europe. In Asia, it is reported to be present in Pakistan, India and Iran. In America, it was probably introduced in early 1960s when it was first identified as a serious insect in Michigan, in 1962. It is now present in most of the states, and in Canadian Prairies−Alberta, Saskatchewan, and Manitoba (Kher et al., 2011). Cereal leaf beetle feeds on oat, wheat, barley in particular and on many other cultivated and non-cultivated grasses (Wilson and Shade 1966). The economic losses caused by cereal leaf beetle greatly vary among the crops, regions and timing and level of infestation. Buntin et al., (2004) reported a maximum loss of 40%; whereas Herbert et al., (2007) reported about 15% wheat yield losses in Virginia due to cereal leaf beetle.
5.1. Biology
Cereal leaf beetle adult is about 5mm long, bluish black head and elytra, and burgundy red thorax and legs. Adult feeding usually does not cause economic losses to the crops. However, the larvae, which is also about 5mm in length and shiny black in colour, feeds on photosynthetic tissues of the leaf, leaving behind the leaf skeleton only (Buntin et al. 2004). This results in significant loss of photosynthetic activity of the plant, giving it a frosted look. Hence, the plant fails to produce expected yield and quality (Merrit and Apple 1966, Grant and Patrick 1993). Cereal leaf beetle generally has one generation per year, however a small second generation is also reported in Virginia (McPherson 1983b). A typical cereal leaf beetle life cycle span is about 46 days, but can be as short as 10 days and as long as 90 days depending upon the environmental conditions and temperature (Guppy and Harcourt 1978, Metcalf and Metcalf 1993). Highest yield losses can be anticipated by the cereal leaf beetle larvae feeding the flag leaf. The losses vary greatly in different regions
5.2. Strategies to mitigate cereal leaf beetle
Chemical control has long been practiced to control cereal leaf beetle, even before its identification and recognition as a threatening pest. Pesticides have both been applied as granules to soil (Carbofuran) and as a foliar spray (Endosulfon, methomyl, methyl parathion, etc). Non-selective insecticides have indiscreetly killed the natural enemies and the parasitic species. Biological control has also been an effective method to mitigate cereal leaf beetle. A number of species parasitic to larvae and eggs have been reported as
6. Wheat stem sawfly
The stem sawfly of wheat,
The biology of WSS revealed that adults of both sexes are weak fliers and cannot fly long distances. The adult feed on exudate moisture and on nectar while resting on plant stem with head in downward position and legs aligned with its body. The life cycle of WSS is synchronised with the phenology of host plant and all growth and development occurs within the host plant except the last stage. The timing of its emergence is greatly influenced by temperature and adults become active during warm season when wind speed is minimum. The cloudy, windy and rainy conditions have an inverse relationship with the activity of WSS. Adult males become visible first as compared to female to ensure mating of females so that most of eggs oviposited in the early flight will be fertilized whereas eggs at the end of flight remained unfertilized. The haploid male will be produced from unfertilized eggs whereas fertilized eggs lead to the development of diploid female. The adults are sexually mature and ready for copulation and oviposition. The female lay 30-50 eggs during her entire life. The egg stage of WSS consists of 5-7 days in length while larval development last for one month. On completion of developmental phase, the larvae start feeding and filling the stem with excreted plant tissue called frass that ultimately lead to the stem splitting. The larvae then descend down to the base of stem creating a V shape furrow that results in complete cutting of the stem. The larva constructs a thin cellophane structure to get protection. This sealed cocoon help larva to remain protected from environmental hazards and predation.
The protected larvae can survive for months and it passes most of its winter in the crown root since temperature remained higher as compared to ambient temperature. The rate of mortality of larvae becomes high if it is exposed to low temperature. However, pupation occurs if there is rise in temperature and weather is dry. The pupal development depends on climatic conditions like drop in temperature. The pupa is white and as pupal development proceeds, wings start emerging/developing followed by pigmentation in the body that results in a mature adult. The insect remained in soil during winter and under favourable environmental conditions, it emerges out and ready for flight. The distribution of WSS is spatial and temporal. As soon as they emerge from stubbles, they start migrating to the nearby wheat plants. The infestation might be severe if females oviposit first within field margin that often results in the uniform distribution of eggs as the flight progress (Nansen et al. 2005). The release of signalling compounds from plants attracts WSS that often lead to severe infestation. However female is unable to differentiate between damaged and healthier plants.
The mature WSS cause little injury but boring action of larvae is very destructive and is a major cause of severe losses. The declined in phosynthetic activities due to destruction of parenchyma and vascular tissues is one of the main damage caused by larvae. The stem will be hollow in a week as larvae feeds up and down.
The mitigation strategies might include cultural control (strip planting and alternative planting strategies), early forecasting system, simulation modelling for long term planning, biological control, chemical control and development of host plant resistance (gene deployment, resistant cultivar development and cultivar blends). The pheromone monitoring and host-plant semiochemicals techniques could be used as an effective strategy to minimize damage of WSS. However, the future research needs to involve multi scale collaborative efforts among different disciplines to develop a holistic approach to control any outbreak of WSS. Cultural methods are critical to control WSS, therefore, it’s important to encourage producers to adopt such procedures which can minimize the WSS population and increase beneficial insects. The use of resistant genotypes having solid stem can contribute to minimize the damage to a greater extent. The use of cultivars blends, IPM (integrated pest management) and ICM (integrated crop management) could be considered as management tools for the control of WSS.
7. Wheat midge
The major pest of spring wheat in most part of world is Wheat midge (WM) which can cause 30% reduction in wheat yield resulting in an economic loss of 30 million dollar. It is also called orange wheat blossom midge and it is the periodic pest of wheat crop in the northern hemisphere and cause significant damage when climatic conditions favours its growth. It’s the main pest of China, Europe and North America where winter and spring wheat is being cultivated. WM is serious pest in Canada (Lamb et al. 2000) that has resulted in widespread use of insecticides. The origin of WM was first detected during 1741 in England. The dispersal of WM mainly take place from Europe to North America and then to Asia. Its dissemination is through larvae which remain in the spikes and then stored in the seed after harvesting with combine harvester. WM hibernate in the soil and during spring season it multiply and pupate. The hatching of cocoon depends on soil temperature and moisture that result in higher numbers. At the ear emergence, the adult WM mates and females then move to wheat crop where it starts laying eggs. The flight of females takes place at evening and if wheat crop is absent laying of eggs take place at barley or weed grasses. The hatching of larvae from eggs takes place after a week and produces alpha-amylase enzyme to release sugars from the grain. The larvae then drop to the soil after feeding for few weeks and made a cocoon around itself. The generation of WM completes in one year and it passes winters in soil as larvae. The high temperature terminates the diapause of larvae and it comes out from cocoons and spends some time at soil surface (Doane and Olfert, 2008). The damage to the crop starts at grain development stages causing shrivelling and crack which ultimately reduces yield and quality of crop.
The development of WM is highly dependent on soil moisture and temperature. The termination of larval diapause occurred in phases: firstly, larvae required cool temperature for three months; secondly, larvae enter into moisture sensitive phase which remained for 5-6 weeks. However, if soil is dry it remained in diapause for one year while on the other hand if moisture is sufficient, larvae’s terminated diapause, pupated and emerged as adults within five weeks. The adult’s stage is last stage of WM and basically it is small orange fly with length of 2-3mm. It has two large black eyes with size equivalent to mosquito and has three pairs of legs which are larger in size. The wings are oval shaped and transparent. The adults will prefer to remain in crop canopy where the environment is humid and when conditions become favourable the female become active and comes at the top of canopy starting laying eggs on newly emerged spike. Therefore, WM larvae compete directly with humans for the grain and destroy the grain by causing shrivelling. The infestation of WM can be seen on all parts of spike and feeding of larvae is greater on small seeds as compared to larger one (Lamb et al. 2000). The intensity of damage could be determined from the feeding place of larvae. If it feeds closer to the grain embryo, the attack will be very severe. Usually, the seed is attacked by larger number of larvae but if four or more is present attack will be of serious nature. The body size of larvae might be affected significantly if they are present on one seed because of competitions between them. The damage caused by larvae to the wheat seed can be calculated by dividing mass lost by the seed to the mass gain by the larvae (Lamb et al. 2000) called as efficiency index of WM larvae. The activity of WM larvae decreases when wheat seeds have lost 75% of their mass. WM feeding has resulted in maximum impact among feeding insects that feed on crops belong to Poaceae family (Gavloski and Lamb 2000). The damage of WM to crop adversely affects the agronomic performance like resistance to sprouting, yield, germination and seedlings early vigor. It also affects grain quality resulting to change in seed protein levels and decline in the drought resistance patterns of crop. The quality might be further deteriorated due to carrying of harmful microorganism with WM and attack by the semolina after the WM.
The WM could be controlled by inspecting field at heading stage and by the application of insecticide to minimize the damage. If infestation of WM is identified at early stage by regular monitoring at heading and flowering then WM attack could be minimized to a greater extent. The use of wheat genotypes that are resistant to WM is another way to control its attack. However, it has been recommended that the best control measure is to use predators that can eat the WM larvae so that it is unable to multiply further. The examples of predators include polyphagpus which might control WM at the different vulnerable stages. The concept of host plant resistance is another way to control WM by developing such genotypes that can resist the development of WM. The host plant resistance includes resistance mechanism and genetics in which genotypes produce antitoxic substances lead to minimize WM infestation. These genotypes changes oviposition in the field and reduce the egg densities in the field resulting in lower numbers of WM. The research studies has depicted that these lines could control WM larvae from 58 to 100% (Lamb et al. 2000).The development of antibiosis is another way to control WM and resistance in spring wheat is linked with the production of phenolic compounds from seeds which might destroy the WM (Ding et al. 2000).In the same way, use of selection protocols and field methods like screening of wheat genotypes and cultural practices are the important ways to control WM. The modifications in the oviposition sites can also control WM to a considerable degree. Breeding wheat for resistance to insects is an easiest and cheapest mean to control WM
8. Hessian fly
The
The damage caused by HF maggots is mainly on vegetative growth which might reduce the activity of photosynthesizing machinery resulting to stunting growth. The maggots during feeding also inject toxic substances resulting to inhibition of plant growth. These toxin acts as inhibitors to the plants and overall hormonal action of plants disturbs resulting to poor growth. However damage could be severe if timing and degree of infestation is perfectly matched with crop phenological stages. The single maggots can cause significant damage to wheat plant because toxins released during feeding interfere with wheat crop growth. Meanwhile if the attack of larvae is at single leaf stage then it will be killed immediately. The attack at later stages cause destruction of first tillers and growth of the crop delayed. The weakening and shortening of stem occur due to larvae attack and it might break from the first or second node before the harvest of crop resulting to head loss. The reduction in yield and quality of crop will be observed with severe mechanical losses to stem and head during heavy infestation.
The use of preventive rather than chemical control methods can control the population dynamics of the insect. These methods include biological and cultural approaches which are reliable and feasible for wheat crop growers. The growing of resistance cultivars by the use of biotechnology is the best way to control the damaged caused by HF. The tissues of plants contain several types of carbohydrate binding proteins called lectins. These lectins have potential to build resistance in the wheat against insects. The identification of genes which might produce this type of lectins will be best way to control HF. The genes includes Hfr-2 called as HF destructor which is expressed in the leaf sheaths of the resistance genotypes (Puthoff et al., 2005).Similarly mannose binding lectins which serve as storage protein accumulates in the phloem sap and might act against HF. These lectins have anti insect properties because it accumulates in the midgut of insect and kill them immediately. The production of Wci-1 mRNAs and Hfr-1 in response to the attack of HF larvae is another defensive mechanism which is present in resistant varieties of wheat. The Hfr-1 gene is called defender gene against HF and it can control crop from severe attack (Subramanyam et al., 2006). Meanwhile there are number of different sources of incorporation of resistance traits into wheat which might built defensive mechanism in crop against HF. Antibiosis is the main mechanism of resistance associated with these genes and is expressed as the death of first larvae. The biochemical nature of antibiosis in wheat includes development of silica in sheaths and production of free amino acids, organic acids and sugars in plants. The development of resistance genotypes in wheat breeding programme might improve the durability of resistance in wheat genotypes against HF. The breeding programmes include use of resistant genes or combination of different level of resistance genes that might respond differential to abiotic and biotic stresses. The use of genes which have potential to control HF is best way to control population dynamics of HF larvae in wheat crop. The knowledge of molecular markers and QTL mapping associated with resistance genes incorporation in wheat is another landmark which might be used to control HF. The use of simulation genetic models might be used to check the development of single gene resistance in crop and it is adequate way to control the HF.
The HF population dynamics could be controlled by modification in tillage practices and change in the cropping pattern which can destroy the life cycle of pest. The delayed planting is another way to control the HF. There are large numbers of different parasitoids which attack the HF and might be used to control its attack on crop. The use of chemical to control HF is not recommended. The best way to control HF is development of resistant genotypes which work like systemic insecticides. Similarly production of novel jacalin like lectin gene from wheat responds significantly to the infestation of HF larvae and could be use effectively in future breeding programmes. The wheat genotypes having higher levels of Hfr-1 at the larval feeding sites and only small amount of lectin at these sites will control the larvae.
|
|
|
|
|
|
GreenBug | gb1 | Not mapped | T. Turgidum/T. Durum | ||
Gb2 | ATATCTCAACCAACTTCACAAAGTC | S. Cereale | Lu et al., 2010 | ||
CATTGTTTAAAAAGAGGGGATATG | |||||
Gb3 | 5'- AGC GAG GAG GAT GCA TCT TAT T -3' | T. Tauschii | 7DL | Weng et al., 2002. | |
5'- GAC ATA CAC ATG ATG GAC ACG G-3' | |||||
Gb4 | Not mapped | T. Tauschii | |||
Gb5 | Not mapped | T. Speltoides | |||
Gb2/Gb6 | TATACACCAACAAGTAGCGACAATA | S. Cereale | Lu et al., 2010 | ||
AAACAAACCTTCAGTATCTTCTCAC | |||||
RAPD-PCR based Single Decamers | 5'-CTCACCGTCC-3' | Kharrat et al., 2012 | |||
5'- GAGCCCTCCA-3' | Kharrat et al., 2012 | ||||
5'-TCACGTCCAC-3' | Kharrat et al., 2012 | ||||
5'- GGCTCATGTG-3' | Kharrat et al., 2012 | ||||
5'- AGTC-GTCCCC-3' | Kharrat et al., 2012 | ||||
Hesian Fly | H9 | 5'- GGA AGC GCG TCA GCA CTA GGC AAC -3' | T. Aestivum | 1AS | Kong et al., 2005 |
5'- GGC TTC TAG GTG CTG CGG CTT TTG TC -3' | |||||
H13 | 5'- CAA ATG CTA ATC CCC GCC -3' | T. Aestivum | 6D | Liu et al., 2005 | |
5'- TGT AAA CAA GGT CGC AGG TG -3' | |||||
H25 | 5’- CTG CCT TCT CCA TGG TTT GT -3’ | S. Cereale | 4A | Sebesta et al., 1997 | |
5’- AAT GGC CAA AGG TTA TGA AGG -3’ | |||||
H26/H32 | 5'- CCT AAC TGA GGT CCC ACC AA -3' | T. Tauschii | Yu et al., 2010 | ||
5'- GCA AAG GAC TTG ATG CCT GT -3' | |||||
H31 | 5'- TCC TAC CTC CAT TCC CCT TT -3' | T. Turgidum | 5BS | Williams et al., 2010 | |
5'- TCA AAA TGA ATC GGA AGG GT -3' | |||||
Hdic | 5'- GAC AGC ACC TTG CCC TTT G -3' | T. turgidum ssp. dicoccum | 1AS | Liu et al., 2005 | |
5'- CAT CGG CAA CAT GCT CAT C -3' | |||||
Stem Saw Fly |
|
5'- GCA ATC TTT TTT CTG ACC ACG -3' | 3BL | Cook et al., | |
5'- ACG AGG CAA GAA CAC ACA TG -3' | |||||
|
5' GCAATCTTTTTTCTGACCACG 3' | Durum wheat | 3BL | ||
5' ATGTGCATGTCGGACGC 3' | |||||
|
5' GTTGTCCCTATGAGAAGGAACG 3' | 3BL | |||
5' TTCTGCTGCTGTTTTCATTTAC 3' | |||||
Dn1 | 5' TCTGTAGGCTCTCTCCGACTG 3' | T. Aestivum | Peng et al., 2007 | ||
RWA | 5' ACCTGATCAGATCCCACTCG 3' | ||||
Dn2 | 5'- GAT CAA GAC TTT TGT ATC TCT C -3' | T. Aestivum | 7D/1B | Peng et al., 2007 | |
5'- GAT GTC CAA CAG TTA GCT TA -3' | |||||
dn3 | not mapped | . | . | ||
Dn4 | 5'-CTG TTC TTG CGT GGC ATT AA-3' | T. Aestivum | 1DS | Peng et al., 2007 | |
5'-AAT AAG GAC ACA ATT GGG ATG G-3' | |||||
Dn5 | 5' TCTGTAGGCTCTCTCCGACTG 3' | T. Aestivum | 7DS | Peng et al., 2007 | |
5' ACCTGATCAGATCCCACTCG 3' | |||||
Dn6 | 5' TCTGTAGGCTCTCTCCGACTG 3' | T. Aestivum | 7DS | Peng et al., 2007 | |
5' ACCTGATCAGATCCCACTCG 3' | |||||
Dn7 | Xscb241 RFLP marker | 1RS | |||
Dn8 | 5' TTCCTCACTGTAAGGGCGTT 3' | T. Aestivum | 7DS | Peng et al., 2007 | |
5' CAGCCTTAGCCTTGGCG 3' |
References
- 1.
Anstead J. A Burd J. D Shufran K. A 2003 Over-summering and biotypic diversity ofSchizaphis graminum (Homoptera: Aphididae) populations on noncultivated grass hosts. Environ Entomol32 662 667 - 2.
Anstead J. A 2000 Genetic and biotypic diversity of greenbug (Schizaphis graminum Rondani) populations on non-cultivated hosts. M.S. Thesis. Okla. State Univ., Stillwater, OK. - 3.
Archer T. L Peairs F. B Pike K. S Johnson G. D Kroening M 1998 Economic injury levels for the Russian wheat aphid (Homoptera: Aphididae) on winter wheat in several climate zones. J. Econ. Entomol.91 741 747 - 4.
RIH Mckenzie, and TG Shanower.Berzonsky W. A W. O Herbert F. L Patterson H Ding F. B Peairs S. D Haley D. R Porter M. O Harris R. H Ratcliffe R. J Lamb 2003 Breeding wheat for resistance to insects. Plant Breeding Reviews.22 - 5.
andBishop G. W L Sandvol 1984 Effects of barley yellow dwarf on yield of winter wheat.28 Abstracts of Reports of the 43rd Annual PaciÞc North West Vegetable Insect Conference. - 6.
Botha A-M L Lacock C Van Niekerk M. T Matsioloko F. B De Preez S Loots E Venter andK. J Kunert C. A Cullis 2005 Is photosynthetic transcriptional regulation inTriticum aestivum L. cv. ÔTugelaDN_ a contributing factor for tolerance toDiuraphis noxia (Homoptera: Aphididae)? Plant Cell Rep.25 41 54 - 7.
Boyko E. V C. M Smith V. K Thara J. M Bruno Y Deng andS. R Strakey D. L Klaahsen 2006 Molecular basis of plant gene expression during aphid invasion: wheatPto - andPti -like sequences are involved in interactions between wheat and Russian wheat aphid (Homoptera: Aphididae). J. Econ. Entomol.99 1340 1445 - 8.
Buntin G. D K. L Flanders andR. W Slaughter Z. D Delamar 2004 Damage loss assessment and control of the cereal leaf beetle (Coleoptera: Chrysomelidae) in winter wheat. Journal of Economic Entomology. 97 374 382 - 9.
andBurd J N Elliott 1996 Changes in chlorophyll a fluorescence induction kinetics in cereals infested with Russian wheat aphid (Homoptera: Aphididae). J. Econ. Entomol.89 1332 1337 - 10.
Burton R. L 1986 Effect of greenbug (Homoptera: Aphididae) damage on root and shoot biomass of wheat seedlings. J. Econ. Entomol.79 633 636 - 11.
Butts R. A 1992 The influence of seeding dates on the impact of fall infestations of Russian wheat aphid in winter wheat.120 123 In: W. P. Morrison (ed.), Proc. Fifth RussianWheat Aphid Conference. Great Plains Agr. Council Publ. 142. - 12.
Butts R. A Thomas J. B Lukow O Hill B. D 1997 Effect of fall infestations of Russian wheat aphid (Homoptera: Aphididea) on winter wheat yield and quality on the Canadian Prairies. J. Econ. Entomol.94 1005 1009 - 13.
Carter N Mclean I. F. G Watt A. D Dixon A. F. G 1980 Cereal aphids-a case study and review.-Appl. Biol. 5 271 348 - 14.
Identification of microsatellite markers associated with a stem solidness locus in wheat. E. Crop ScienceCook J. P Wichman D. M Martin J. M Bruckner P. L Talbert L 44 1397 1402 - 15.
andDaamen R. A W Stol 1993 Surveys of cereal diseases and pests in the Netherlands. 6. Occurrence of insect pests in winter wheat. Neth. J. Pl. Path.99 51 56 - 16.
Dedryver C. A 1978 Biologie des pucerons des cer£ales dans l’ouest de la France. 1.-Repartition et evolution des populations deSitobion avenae F.,Metopolophium dirhodum Wlk., etRhopalosiphum padi L., de 1974 a 1977 sur ble d’hiver dans le bassin de Rennes.-Ann.ZooL, Ecol. Anirn. 10 483 505 - 17.
Ding H andR. J Lamb N Ames 2000 Inducible production of phenolic acids in wheat and antibiotic resistance toSitodiplosismosellana . J. Chem. Ecol.26 969 985 - 18.
Doane J. F Olfert O 2008 Seasonal development of wheat midge, Sitodiplosis mosellana (Ge´ hin) (Diptera: Cecidomyiidae), in Saskatchewan, Canada. Crop Prot.27 951 958 - 19.
Du Toit F.1989 Inheritance of resistance in twoTriticum aestivium lines to Russian wheat aphid (Homoptera: Aphididea). J. Econ. Entomol.82 1251 1253 - 20.
andDubcovsky J Dvorak J 2007 Genome plasticity: a key factor in the success of polyploid wheat under domestication. Science 2007;316 1862 1866 - 21.
andElsidaig A. A P. K Zwer 1993 Genes for resistance to Russian wheat aphid in PI 294994 wheat. Crop Sci.33 998 1001 - 22.
FAO ( fao.org/index_en.htm)2012 Food and agricultural organization: Global wheat cultivation areas and production (http://www - 23.
Feuillet C S Travella N Stein L Albar andA Nublat B Keller 2003 Map-based isolation of the leaf rust disease resistance geneLr10 from the hexaploid wheat (Triticum aestivum L.) genome. Proc. Natl. Acad. Sci. U.S.A.100 15253 15258 - 24.
andGavloski J. E R. J Lamb 2000 Specific impacts of herbivores: Comparing diverse insect species on young plants. Environ. Entomol.28 1 7 - 25.
andGibson R. W R. T Plumb 1977 Breeding plants for resistance to aphid infestation.473 500 In K.F. Harris and K. Maramorosch (ed.) Aphids and virus vectors. Academic Press, New York, NY. - 26.
Gilchrist L. I andR Rodriguez-montessoro P. A Burnett 1984 The extent of Freestate streak andDiuraphis noxia in Mexico.157 163 In: P. A. Burnett (ed.), Barley Yellow Dwarf, A Proceedings of a Workshop, CIMMYT, Mexico, December 6-8, 1983. CIMMYT, Mexico. - 27.
andGrant J. F C. R Patrick 1993 Distribution and seasonal phenology ofcereal leaf beetle (Coleoptera: Chrysomelidae) on wheat in Tennessee.Journal of Entomological Science. 28 363 369 - 28.
Griffiths E Wratten S. D 1979 Intra- and inter-specific differences in cereal aphid low-temperature tolerance.Entomologia Experimentalis et Apphcata 26 161 167 - 29.
andGuppy J. C D. G Harcourt 1978 Effects of temperature on development of the immature stages of the cereal leaf beetle,Oulema melanopus. Canadian Entomologist. 10 257 63 - 30.
H. L. U, J. C Rudd andJ. D Burd Y Weng 2010 Molecular mapping of greenbug resistance genes Gb2 and Gb6 in T1AL.1RS wheat-rye translocations. Plant Breeding129 472 476 - 31.
Hahn S. K 1968 Resistance of barley (Hordeum vulgare L. Emend. Lam.) to cereal leaf beetle (Oulema melanopus L.). Crop Sci.8 461 464 - 32.
Haile F. J L. G Higley andX Ni S. S Quisenberry 1999 Physiological and growth tolerance in wheat to Russian wheat aphid (Homoptera: Aphididae) injury. Environ. Entomol.28 787 794 - 33.
andHarvey T. L H. L Hackerott 1969 Recognition of a greenbug biotype injurious to sorghum. J. Econ. Entomol.62 776 779 - 34.
andHaynes D. L S. H Gage 1981 The cereal leaf beetle in North America. Ann. Rev. Entomol.26 259 287 - 35.
Helgesen R. G 1969 The within generation population dynamics of the cereal leaf beetle, Oulema melanopus (L.), Ph.D. dissertation. Michigan State University, East Lansing, Michigan. - 36.
andHelgesen R. G D. L Haynes 1972 Population dynamics of the cereal leaf beetle Oulema melanopus (Coleoptera Chrysomelidae) a model for age specific mortality. Canadian Entomologist.104 797 814 - 37.
Karren.Herbert D. A Jr J. W Van Duyn M. D Bryan andJ. B 2007 Cereal Leaf Beetle,120 In G. D. Buntin, K. S. Pike, M. J. Weiss, and J. A. Webster (eds.), Handbook of small grain insects. Entomological Society of America, Lanham, MD - 38.
Hopper K. R D Coutinot K Chen D. J Kazmer G Mercadier S. E Halbert R. H Miller andK. S Pike L. K Tanigoshi 1998 Exploration for natural enemies to controlDiuraphis noxia (Homoptera: Aphididae) in the United States.166 182 In: S. S. Quisenberry and F. B. Peairs (eds.), A response model for an introduced pest-the Russian wheat aphid. Thomas Say Publ. Entomol., Entomol. Soc. Am., Lanham, MD. - 39.
andHughes R G Maywald 1990 Forecasting the favourableness of the Australian environment for the Russian wheat aphid,Diuraphis noxia (Homoptera: Aphididae), and its potential impact on Australian wheat yields. Bul. Entomol. Res.80 165 175 - 40.
Hunter S. J 1909 The greenbug and its enemies. Univ. Kans. Bul.9 1 163 - 41.
Ivie M. A 2001 On the geographic origin of the wheat stem sawfly (Hymenoptera: Cephidae): a new hypothesis of introduction from northeastern Asia. American Entomologist,47 84 97 - 42.
andIvie M. A Zinovjev A. G 1996 Discovery of the wheat stem sawfly (Cephuscinctus Norton) (Hymenoptera: Cephidae) in Asia, with the proposal of a new synonymy. The Canadian Entomologist,128 347 348 doi:10.4039/Ent128347-2. - 43.
Kazemi M. H Talebi-chaichi P Shakiba M. R Jafarloo M. M 2001 Biological responses of Russian wheat aphid, Diuraphis noxia (Mordvilko) (Homoptera: Aphididae) to different wheat varieties. J. Agric. Sci. Technol.3 249 255 - 44.
Keen N. T 1990 Gene-for-gene complementarity in plantpathogen interactions. Annu. Rev. Genet. 24: 425Ð429. - 45.
Kharrat I D Bouktila M. M Khemakhem andH Makni M Makn 2012 Biotype characterization and genetic diversity of the greenbug, - 46.
Kher S. V L. M Dosdall H. A Carcamo 2011 The cereal leaf beetle: Biology, distribution, and prospects for control. Prairie soil and crop science Journal4 - 47.
Kieckhefer R. W Gustin R. D 1967 Cereal aphids in South Dakota. I. Observations of autumnal bionomics.-Ann. ent. Soc. Am. 60 514 516 - 48.
andKieckhefer R. W B. H Kantack 1988 Yield losses in winter grains caused by cereal aphids (Homoptera: Aphididae) in South Dakota. J. Econ. Entomol.81 317 321 - 49.
Kieckhefer R. W 1975 Field populations of cereal aphids in South Dakota spring grains.-J. econ. Ent. 68 161 164 - 50.
Kindler S. D T. L Harvey G. E Wilde R. A Shufran andH. L Brooks P. E Sloderbeck 2001 Occurrence of greenbug biotype K in the field. J. Agric. Urban. Entomol.18 23 34 - 51.
Kong L Ohm H. W Cambron S. E Williams C. E 2005 Molecular mapping determines that Hessian fly resistance gene H9 is located on chromosome 1A of wheat. Plant Breeding124 525 531 - 52.
Kostov K 2001 Breeding wheat lines for host-plant resistance to cereal leaf beetle by using the cross mutation method. Bulgarian J. Agric. Sci.7 7 14 - 53.
Lamb R. J J. R Tucker andI. L Wise M. A. H Smith 2000 Trophic interaction betweenSitodiplosismosellana (Diptera: Cecidomyiidae) and spring wheat: implications for seed production. Can. Entomol.132 607 625 - 54.
Lapitan N. L. V andJ Peng V Sharma 2007b A high density map and PCR markers for Russian wheat aphid resistance geneDn7 on chromosome 1RS/1BL. Crop Sci.47 811 820 - 55.
Lees A. D 1966 The control of polymorphism in aphids.Advances in Insect Physiology 3 207 277 - 56.
LeSage L., E.J. Dobesberger, and C.G. Majka.2007 Introduced leaf beetles of Maritime Provinces, 2: The cereal leaf beetleOulema melanopus (Linnaeus) (Coleoptera: Chrysomelidae). Proc. Entomol. Soc. Wash.109 286 294 - 57.
Owuoche, Chen MS.Liu X. M Brown-guedira G. L Hatchett J. H 2005 Genetic characterization and molecular mapping of a Hessian fly-resistance gene transferred fromT. turgidum ssp.dicoccum to common wheat. Theoretical and Applied Genetics,111 1308 1315 - 58.
Liu X. M Gill B. S Chen M. S 2005 Hessian fly resistance gene H13 is mapped to a distal cluster of resistance genes in chromosome 6DS of wheat.. In: Theoretical and Applied Genetics111 243 249 - 59.
and F. Du Toit.Marais G. F 1993 A monosomic analysis of Russian wheat aphid resistance in the common wheat PI 294994. Plant Breed.111 246 248 - 60.
and F. Du Toit.Marais G. F M Horn 1994 Intergeneric transfer (rye to wheat) of a gene(s) for Russian wheat aphid resistance. Plant Breed.113 265 271 - 61.
Markkula M Rautapaa J 1963 PVC rearing cages for aphid investigations.-Annls agric. fenniae 2 208 211 - 62.
Mcpherson R. M 1983b Seasonal abundance of cereal leaf beetles (Coleoptera: Chrysomelidae) in Virginia small grains and corn. Journal of Economic Entomology. 76 1269 1272 - 63.
andMerritt D. L J. W Apple 1969 Yield reduction of oats caused by thecereal leaf beetle. Journal of Economic Entomology.62 298 301 - 64.
andMetcalf R. L R. A Metcalf 1993 Destructive and useful insects: their habits and control, 5th ed. McGraw-Hill, Inc., New York - 65.
Michuad J. P 2010 Implication of climate change for cereal aphids on the great plains of North America. P. Kindlmann et al. (eds.), Aphid Biodiversity under Environmental Change, 69DOI - 66.
Miles P. W 1999 Aphid saliva. Biol. Rev.74 41 85 - 67.
Miller H D Porter J Burd andD Mornhinweg R Burton 1994 Physiological effects of Russian wheat aphid (Homoptera: Aphididae) on resistant and susceptible barley. J.Econ. Entomol.87 493 499 - 68.
andMorrison W. P F. B Peairs 1998 Introduction: response model concept and economic impact.1 11 In: S. S. Quisenberry and F. B. Peairs (eds.), A response model for an introduced pest-the Russian wheat aphid. Thomas Say Publ. Entomol., Entomol. Soc. Am., Lanham, MD. - 69.
Morrison W F Baxendale L Brooks C Burkhardt J Campbell G Johnson W Massey D Mcbride andF Peairs J Schultz 1988 The Russian wheat aphid: a serious new pest of small grains in the Great Plains. Great Plains Agricultural Council Pub. 124, 5 p. - 70.
Nansen C Macedo T. B andWeaver D. K Peterson R. K. D 2005 Spatiotemporal distributions of wheat stem sawfly eggs and larvae in dryland wheat fields. The Canadian Entomologist,137 428 440 doi:10.4039/N04-094. - 71.
and inheritance of resistance to Russian wheat aphid inNkongolo K. K J. S Quick andA. E Limin D. B Fowler 1991a Sources Triticum species, amphiploids andTriticum tauschii . Can. J. Plant Sci.71 703 708 - 72.
Peairs F. B 1998a Aphids in small grains. Colorado State Univ. Service in Action FactSheet 5.568. - 73.
Peairs F. B 1998b Cultural control tactics for management of the Russian wheat aphid (Homoptera: Aphididae).288 296 In: S. S. Quisenberry and F. B. Peairs (eds.), A response model for an introduced pest-the Russian wheat aphid. Thomas Say Publ.Entomol., Entomol. Soc. Am. - 74.
Pierre J. S 1987 Investigation of explanatory climatic variables with a view to forecasting outbreaks of insects. Utilization of a delayed integral correlation method. Bull SROP10 109 118 - 75.
Pimentel D Houser J Preiss E White O Fang H Mesnick L Barsky T Tariche S andSchreck J Alpert S 1997 Water resources: agriculture, the environment, and society.BioScience. 47 2 97 106 - 76.
andPorter D. R J. A Webster 2000 Russian wheat aphid-induced protein alterations in spring wheat. Euphytica111 199 203 - 77.
Porter D. R andB Friebe J. A Webster 1994 Inheritance of greenbug biotype G resistance in wheat. Crop Sci.34 625 628 - 78.
Prokrym D. R andK. S Pike D. J Nelson 1998 Biological control ofDiuraphis noxia (Homoptera: Aphididae): implementation and evaluation of natural enemies.183 208 In: S. S. Quisenberry and F. B. Peairs (eds.), A response model for an introduced pest-the Russian wheat aphid. Thomas Say Publ. Entomol., Entomol. Soc. Am., Lanham, MD. - 79.
Puthoff D. P Sardesai N Subramanyam S andNemacheck J. A Williams C. E 2005 Hfr-2, a wheat cytolytic toxin-like gene, is upregulated by virulent Hessian fly larval feeding. Mol. Plant Pathol.6 411 423 - 80.
Quick J. S J. A Stromberger S Clayshulte B Clifford J. J Johnson F. B Peairs andJ. B Rudolph K Lorenz 2001 Registration of ‘Prowers’ wheat. Crop Sci.41 928 929 - 81.
Rautapaa J 1970 Preference of cereal aphids for various cereal varieties and species of Gramineae, Juncaceae and Cyperaceae.-Annls agric. fenniae 9 261 211 - 82.
Rider SD Jr Wilde GE (1998 Variation in fecundity and sexual morph production among insecticide-resistant clones of the aphidSchizaphis graminum (Homoptera: Aphididae). J Econ Entomol91 388 391 - 83.
Riedell W. E Blackmer T. M 1999 Leaf reflectance spectra of cereal aphid-damaged wheat. Crop Sci.39 1835 1840 - 84.
Riedell W. E R. W Kieckhefer S. D Haley andM. A. C Langham P. D Evenson 1999 Winter wheat responses to bird cherry-oat aphid and barley yellow dwarf virus infection. Crop Sci.39 158 163 - 85.
Riedell W. E andS. L Osborne A. A Jaradat 2007 Crop mineral nutrient and yield responses to aphids or barley yellow dwarf virus in spring wheat and oat. Crop Sci.47 1553 1560 - 86.
andSaidi A J. S Quick 1996 Inheritance and allelic relationships among Russian wheat aphid resistance genes in winter wheat. Crop Sci.36 256 258 - 87.
Schizaphis graminum (Hemiptera: Aphididae) in north Tunisia. Revista Colombiana de Entomología38 1 87 90 - 88.
Sebesta E. E Hatchett J. H Friebe B Gill B. S Cox T. S Sears R. G 1997 Registration of KS92WGRC17, KS92WGRC18, KS92WGRC19, and KS92WGRC20 winter wheat germplasms resistant to Hessian fly.. In: Crop Science, 1997, 37(2):635. - 89.
andShanower T. G Hoelmer K. A 2004 Biological control of wheat stem sawflies: past and future. Journal of Agricultural and Urban Entomology,21 197 221 - 90.
andStarks K. J R. L Burton 1977 Preventing greenbug outbreaks. USDA Leafl. 309 - 91.
andStarks K. J R. L Burton 1977a Preventing greenbug outbreaks. USDA Leafl. 309. - 92.
determining biotypes, culturing, and screening for plant resistance with notes on rearing parasitoids. USDA Tech. Bul. 1556. andStarks K. J R. L Burton 1977b Greenbugs - 93.
Stern V. M 1967 Control of the aphids attacking barley and analysis of yield increases in the Imperial Valley, California. J. Econ. Entomol.60 485 490 - 94.
Subramanyam S Sardesai N Puthoff D. P Meyer J. M Nemacheck J. A andGonzalo M Williams C. E 2006 Expression of two wheat defense-response genes, Hfr-1 and Wci-1, under biotic and abiotic stresses. Plant Sci.170 90 103 - 95.
Ullah F Peters D. C 1996 Sexual reproduction capabilities of greenbugs (Homoptera: Aphididae). J Kans Entomol Soc69 153 159 - 96.
Ulrich W andA Czarnecki T Kruszynski 2004 Occurrence of pest species of the genusOulema (Coleoptera: Chrysomelidae) in cereal fields in Northern Poland. Electronic J. Polish Agric. Uni. 7:4. - 97.
andVickerman G. P S. D Wratten 1979 The biology and pest status of cereal aphids (Hemiptera: Aphididae) in Europe: A review. Bull. Entomol. Res.69 1 32 - 98.
Voss T. S R. W Kieckhefer B. F Fuller andM. J Mcleod D. A Beck 1997 Yield losses in maturing spring wheat caused by cereal aphids (Homoptera: Aphididae) under laboratory conditions. J. Econ. Entomol.90 1346 1350 - 99.
andWalker C. B F. B Peairs 1998 Influence of grazing on Russian wheat aphid (Homoptera: Aphididae) infestations in winter wheat.297 303 In: S. S. Quisenberry and F. B. Peairs (eds.), A response model for an introduced pest-the Russian wheat aphid. Thomas Say Publ. Entomol., Entomol. Soc. Am., Lanham, MD. - 100.
Walker C. B andF. B Peairs D Harn 1990 The effect of planting date in southeast on Russian wheat aphid infestations in winter wheat.54 62 In: G. Johnson (ed.), Proc. 4th Russian Wheat Aphid Workshop, October 10-12. Ext. Serv., Montana State Univ.,Bozeman, MT. - 101.
Walters M. C 1984 Progress in Russian wheat aphid (Diuraphis noxia Mordw.) research in the Republic of South Africa. Tech.l Commun. 191, Dept. Agr., Republic of South Africa. - 102.
andWebster J. A S Amosson 1995 Economic impact of the greenbug in the western United States:1992 1993 Great Plains Agr. Council Publ. 155. - 103.
Webster J. A andD. H Smith C Lee 1972 Reduction in yield of spring wheat caused by cereal leaf beetles. J. Econ. Entomol.65 832 835 - 104.
andWellso S. G R. P Hoxie 1981 Cereal leaf beetle pupation under controlled temperatures and relative humidities. Environ. Entomol.10:58. - 105.
Weng Y Lazar M. D 2002 Amplified fragment length polymorphism- and simple sequence repeat-based molecular tagging and mapping of greenbug resistance gene Gb3 in wheat. Plant Breeding121 218 223 - 106.
Weng Y. Q P Azhaguvel andG. J Michels J. C Rudd 2007 Cross-species transferability of microsatellite markers from six aphid (Hemiptera: Aphididae) species and their use for evaluating biotypic diversity in two cereal aphids. Insect Mol. Biol.16 613 622 - 107.
andWiktelius S J Pettersson 1985 Simulations of bird cherry-oat aphid population dynamics: A tool for developing strategies for breeding aphid-resistant plants. Agric.Ecosyst. Environ.14 159 170 - 108.
Wilktlius S 1987 The role of grasslands in the yearly life-cycle ofRhopalosiphum padi (Homoptera: Aphididae) in Sweden.-Ann. appl. Biol. 10 9 15 - 109.
Williams C. E Collier N Sardesai C. C Ohm H. W Cambron S. E 2003 Phenotypic assessment and mapped markers for H31, a new wheat gene conferring resistance to Hessian fly (Diptera: Cecidomyiidae). Theoretical and Applied Genetics,107 1516 1523 - 110.
andWilson M. C R. E Shade 1966 Survival and development of larvae of the cereal leaf beetle, Oulema melanopa (Coleoptera: Chrysomelidae), on various species of Gramineae. Annals of the Entomological Society of America.59 170 173 - 111.
andWilson M. C R. E Shade 1964 The influence of various Gramineae on weight gains of postdiapause adults of the cereal leaf beetle,Oulema melanopa . Ann. Entomol. Soc. Am.57 659 661 - 112.
Jr.Wood E. A 1961 Biological studies of a new greenbug biotype. J. Econ. Entomol.54 1171 1173 - 113.
Yu G. T Williams C. E Harris M. O Cai X Mergoum M Xu S. S 2010 Development and Validation of Molecular Markers closely linked to Hessian Fly-resistance Gene H32 in Wheat. Crop Science,50 1325 1332 - 114.
Zaayman D andN. L. V Lapitan A-M Botha 2008 Dissimilar molecular defense responses are elicited inTriticum aestivum L. after infestation by different Diuraphis noxia (Kurjumov) biotypes. Plysiol. Plantarum. 136 209 222