Open access

Cancer Gene Therapy via NKG2D and FAS Pathways

Written By

Yanzhang Wei, Jinhua Li and Hari Shankar R. Kotturi

Submitted: October 20th, 2010 Published: August 23rd, 2011

DOI: 10.5772/17386

Chapter metrics overview

2,510 Chapter Downloads

View Full Metrics

1. Introduction

NKG2D (natural-killer group 2, member D) belongs to a sub-family of C type lectin-like receptors. NKG2D is a homodimeric, type II transmembrane glycoprotein (Wolan et al., 2001). The NKG2D gene is located in the NK gene complex which is on chromosome 6 in the mouse (Ho et al., 1998) and chromosome 12 in human (Glienke et al., 1998). Like most activating receptors, NKG2D is a multi-subunit receptor complex. Signaling in NKG2D is mediated by specialized signaling adaptors. In mouse NKG2D associates with two distinct adaptors: DAP-10 and DAP-12/KARAP (Diefenbach et al., 2002a), while in human NKG2D exclusively uses DAP-10 (Rosen et al., 2004). Non-covalent interactions are responsible for these associations (Diefenbach et al., 2002b). One NKG2D homodimer associates with two DAP-10 dimers to form a hexameric complex (Garrity et al., 2005). Two distinct NKG2D isoforms (NKG2D-S and NKG2D-L) are expressed in mouse as a result of alternative exon usage and are responsible for differential adaptor associations. The short (NKG2D-S) and long (NKG2D-L) isoforms differ by their 13 NH2-terminal amino acids. While DAP-10 associates with both NKG2D isoforms, the extended cytoplasmic domain of NKG2D-L prevents the association with DAP-12 (Diefenbach et al., 2002a; Rosen et al., 2004). NKG2D-L is constitutively expressed in resting NK cells. In contrast, the abundance of NKG2D-S increases considerably upon NK cell stimulation with cytokines (Rabinovich et al., 2006).

NKG2D has the ability to interact with a significant number of distinct ligands with affinities ranging from 4 to 800nM (Carayannopoulos et al., 2002a; O’Callaghan et al., 2001; Li et al., 2001). Both chains of the NKG2D homodimer contribute to the interaction with the different monomeric ligands, making contacts with either the α1 or α2 domain of the ligand. Thus, the symmetric, homodimeric NKG2D receptor binds asymmetric ligands, and the contribution of the individual NKG2D chains is unequal (Radaev et al., 2002; Mc Farland et al., 2003). It is surprising that mouse and human NKG2D, which are only 69% identical in their ectodomains, can recognize most ligands of the other species (Mc Farland et al., 2003).

1.1. Expression of NKG2D receptor

The NKG2D receptor is constitutively expressed on most innate immune effector cells of lymphoid origin, including NK cells, most TCR γδ T cells (Jamieson et al., 2002), and a large fraction of NKT cells (Jamieson et al., 2002; Gumperz et al., 2002). Functional NKG2D is also found on murine interferon producing killer dendritic cells (IKDC) which are of myeloid origin (Taieb et al., 2006) interferon producing killer dendritic cells (IKDC) which are of myeloid origin (Taib et al., 2006; Chan et al., 2006). On adaptive immune system cells, NKG2D is constitutively expressed on all human CD8+ T cells and on activated and memory (but not on naive) CD8+ αß T cells in the mouse (Jamieson et al., 2002). NKG2D is not normally expressed on CD4+ T cells (Table 1).

Human Mouse
NK cells All NK cells All NK cells
TCRαβ T cells



Naïve, activated and memory
CD8+ T cells
Subpopulation of Synovial and circulating CD4+ T cells in rheumatoid arthritis patients
Activated and memory CD8+ T cells
Not express on naïve CD8+ T cells
Not express on CD4+ T cells

TCRγδ T cells
Most blood and IEL TCRγδ
T cells
25% of splenic TCRγδ T cells
Large fraction of NKT cells
NKT cells ND
DC ND IKDC subset
Macrophages ND Only mRNA

Table 1.

Pattern of NKG2D receptor expression in human and in mouse. IEL: intestinal intraepithelial lymphocytes. IKDC: interferon producing killer dendritic cells. ND: not determined. (Coudert and Held, 2006).

1.2. Function of NKG2D receptor

Human NKG2D signals exclusively via DAP-10, while mouse NKG2D associates with both DAP-10 and DAP-12. Upon NKG2D engagement, DAP-12 recruits ZAP-70 and Syk protein tyrosine kinases with the help of its immunoreceptor tyrosine-based activation motif (ITAM) (Lanier et al., 1998). It has been observed that mouse deficient for DAP-12 retained significant NKG2D-dependent NK cell mediated killing (Diefenbach et al., 2002a; Zompi et al., 2003). Moreover, NK cells from Syk/ZAP-70 deficient mouse also retained significant lytic activity. In contrast, DAP-10 lacks an ITAM but instead contains a YINM motif. Upon engagement of human NKG2D, the recruitment of the p85 subunit of phosphatidylinositol 3- kinase (PI3-K) (Wu et al., 1999) and of Grb2 to DAP-10 occurs (Chang et al., 1999). Both p85 and Grb2 have to be recruited to DAP-10 for full calcium flux and cell-mediated cytotoxicity (Upshaw et al., 2006). The residual lytic activity observed in DAP-12 deficient mice was abrogated when pharmacological blockade of Src family kinases and PI3-K, which act down-stream of DAP-10, were used (Colucci et al., 2002), indicating that DAP-10 is crucial for NK cell cytotoxicity. The NKG2D/DAP-10 complex triggers granule release and cytotoxicity following NKG2D crosslinking in human NK cells (Billadeau et al., 2003). Thus, ITAM-independent, DAP-10- dependent signaling triggers NKG2D-dependent cytotoxic function in NK cells.

Besides NK cells, NKG2D receptors are constitutively expressed in human CD8+ T cells and upon activation in mouse CD8+ T cells. Since T cells generally lack DAP-12 expression, NKG2D signaling occurs exclusively via DAP-10 in humans and in mice. In T cells, NKG2D serves as co-stimulatory and in some instances, as primary activation function. In CD8+ T cells NKG2D engagement enhances T cell activation rather than induces activation (Groh et al., 2001; Maasho et al., 2005). Prolonged exposure of T cells derived from human intestinal epithelium to high amounts of IL-15 changes NKG2D function and expression by up-regulating DAP-10 (Roberts et al., 2001).

1.3. NKG2D ligands

NKG2D ligands are structurally similar to MHC class I molecules. The number of NKG2D ligands currently known stands at seven both in humans and mice. In humans these ligands are grouped into two families: the MHC-class-I-polypeptide related sequence A (MICA) and MICB protein family and the other family including cytomegalovirus UL16-binding protein (ULBP; also known as RAET1 proteins) consisting of five members (ULBP1–ULBP4 and RAET1G) (Bahram et al., 1994; Chalupny et al., 2003; Bacon et al., 2004). NKG2D ligands are variable in both their amino acid sequence and domain structure. MICA, for example, only shares 20–25% sequence identity with ULBP molecules (Radosavljevic et al., 2002). In mice there are five retinoic acid early transcript 1 (RAE1) proteins and the minor histocompatibility protein H60 and MULT (Diefenbach et al., 2003).

All ligands share an MHC-class-I-like α1α2 domain that binds to NKG2D. The MICA and MICB proteins also have an additional α3 domain. The RAE1 proteins in mice and ULBP1, ULBP2 and ULBP3 in humans are glycosylphosphatidylinositol (GPI)- anchored receptors. By contrast, MICA, MICB, ULBP4, RAET1G, H60 and MULT1 possess transmembrane domains and cytoplasmic tails (Eagle and Trowsdale, 2007). The ULBP genes are clustered in the telomeric region of human chromosome 6; a corresponding region with NKG2D ligands is found on mouse chromosome 10. The MICA and MICB genes are localized within the human HLA locus on chromosome 6, which also harbors orthologous MHC class I related Rae genes (Radosavlievic et al., 2002). Some NKG2D ligands are polymorphic, over 70 distinct alleles have been identified in MIC genes (Radosavljevic et al., 2002). Even though the number of NKG2D ligands in humans and mice are same, phylogenetic analysis shows that these ligands have almost certainly diversified independently from each other (Raulet et al., 2003).

1.4. NKG2D ligand expression

The expression of NKG2D ligands are induced by a wide variety of stimuli referred as “cellular stress”, which includes tumorigenesis (Gasser et al., 2005), infection by a variety of pathogens (Lodoen et al., 2006), classic cell-stress stimuli such as heat shock (Venkataraman et al., 2007) and, also, as a result of Toll-like receptor (TLR) signaling (Nedvetzki et al., 2007). The aberrant expression of NKG2D ligands has also been linked with autoimmune diseases, including rheumatoid arthritis, coeliac disease and autoimmune diabetes (Hue et al., 2004). Not much is know about the precise mechanisms that lead to upregulation of NKG2D ligands. In cancer, NKG2D ligand expression has been associated with activation of the DNA-damage response pathways by genotoxic stress (Gasser et al., 2005). The triggers for switching on of NKG2D-ligand expression during infection have not yet been well defined (Eagle and Trowsdale, 2007).

1.5. NKG2D ligands and tumor

A large fraction of tumor cells express NKG2D ligands constitutively. MICA/B expression is detected on many types of epithelial tumor cell lines of different tissue origins (Bauer et al., 1999; Jinushi et al., 2003; Groh et al., 1999; Groh et al., 1998). In contrast, ULBPs are preferentially expressed on T cell leukemia cell lines (Pende et al., 2002) as well as on freshly isolated lymphoid leukemia cells. RAE-1 and H60 are up-regulated in skin treated with carcinogens (Girardi et al., 2001) and are found on skin, renal and lung carcinoma cell lines (Girardi et al., 2001; Smyth et al., 2002). The murine NKG2D ligands H60 and RAE-1 are also found on numerous hematopoietic tumor cell lines (Lowin-Kropf et al., 2002). In some cases, NKG2D ligand up-regulation has been observed to be associated with transformation, having both oncogene and tumor suppressor roles. Embryonic fibroblasts deficient for JunB show an enhanced expression of RAE-1є and MULT1. JunB exerts tumor suppressor activity through the negative regulation of c-jun function (Deng et al., 1993). The chronic activity of the DNA damage response pathways have also been implicated to be responsible for the constitutive expression of NKG2D ligands such as RAE-1, MULT1 in mouse lymphoid tumor cell lines (Gasser et al., 2005).

1.6. MULT1 ligand

Murine ULBP-like transcript 1 (MULT1) is a ligand of NKG2D receptor. NKG2D receptors present on the effector cells recognize and bind to MULT1 on target cells. The cDNA sequence of MULT1 consists of a full length open reading frame (ORF) of 1.1 Kb and encoding a protein with a molecular weight of 37.1 KD. MULT1 protein is a type I transmembrane protein with an N-terminal signal sequence of 25 aa, two class I MHC like α domains (89 aa and 91 aa, respectively), a transmembrane domain 17 aa and a cytoplasmic domain of 109 aa. Compare to other NKG2D ligands MULT1 lacks α3- like domain and the GPI trans amidation site (Diefenbach et al., 2003).

MULT1 protein is a glycoprotein with two ectodomains containing four N-glycosylation sites and one O-glycosylation site. Sequence alignments of MULT1 with other known mouse NKG2D ligands such as H60, Rae1ß and other known human NKG2D ligands such as MICA, ULBP1 and MHC-1, reveals that MULT1 protein is distantly related to known NKG2D ligands, which are in turn distantly related to MHC class I proteins. The sequence identity of MULT1 with known human ligands like MICA and ULBP1, are 16.7% and 29.9% respectively, thus MULT1 is closely related to the members of human ULBP family (Diefenbach et al., 2003).

1.6.1. Expression of MULT1 ligand

MULT1 mRNA is detected in a wide variety of tissues such as thymus, spleen, lymph nodes, and to a lesser extent liver and heart, but is not detected in kidney or brain. However, surface expression of MULT1 is not detected in lymph node, liver or kidney cells, suggesting that MULT1 may be regulated post-transcriptionally (Diefenbach et al., 2003).

MULT1 mRNA expression has been observed in multiple tumor cell lines like YAC-1, WEH17.1, A20, P815, S49.1, BW5147 and TRAMP-C1. In WEHI7.1, S49.1 and BW5147 T cell lymphomas, and the P815 mastocytoma, MULT1 is the only known NKG2D ligand expressed in the cells. Other cell lines such as A20 B cell lymphoma and TRAMP-C1 prostate carcinoma coexpress MULT1 and RAE1 ligands (Diefenbach et al., 2003). The finding that MULT1, like RAE1 and H60 family members, is expressed by multiple tumor cell lines suggests that MULT1 contributes to immune surveillance in tumors (Diefenbach et al., 2002b).

1.6.2. Function of MULT1 ligand

High-level expression of NKG2D ligand on a tumor cell helps the tumor cell to overcome class 1-mediated inhibition of NK cells resulting in its cell lysis (Carayannopoulos et al., 2002). Tumor cells expressing high levels of MULT1 are highly susceptible to NK mediated lysis and strongly induce IFN-γ production in freshly isolated, as well as IL-2 expanded, NK cells. MULT1 also induces the production of nitric oxide in activated macrophages. When ectopically expressed by tumor cells, MULT1 induces a very potent antitumor response in vivo resulting in strong rejection of the transduced tumor cells in syngeneic B6 mice. Interestingly, the MULT1-transduced tumor cells have been observed to prime the mice, rendering them immune to the tumor antigens of the parental tumor cell (Diefenbach et al., 2003). Tumor cells expressing different NKG2D ligands such as MULT1, RAE1ß and/or H60 can induce protective immunity against multiple tumor cell lines such as RMA, B16-BL6 and EL4 (Hayakawa et al., 2002).

MULT1 protein has a KD of 6 nM and Koff of ~0.006 S-1 which is several times lower than RAE1є and H60 (KD ~ 10-30 nM ). MULT1 has a t 1/2 of ~ 2 min, longer than either H60 (~ 20 s) or RAE1 α-δ (~ 5s). These results indicate that MULT1 binds NKG2D with the highest affinity of all known ligands and has a half life longer than all known NKG2D ligands (Carayannopoulos et al., 2002a). Thus, three distinct MHC class 1-like molecules in the mouse, H60, RAE1є and MULT1 bind NKG2D with high affinity despite low mutual sequence identity (<20%).

Evolutionary advantage of selecting such a complicated receptor ligand system is two-fold. First, the functional consequences of NKG2D engagement are pleiotropic, involving T cell co-stimulation, NK cell activation, macrophage stimulation, and possibly regulation of fetal development (Diefenbach et al., 2000; Groh et al., 2001). Precise execution of these diverse functions requires multiple genes with distinct promoter/enhancer sequences, posttranslational controls, and even kinetics of binding. Second, microbes exert enormous selective pressure to diversify immune-related functions, albeit at differing rates (Klein et al., 1993; Khakoo et al., 2000). Recent evidence suggests that human CMV interferes with the NKG2D system using the UL16 gene product to bind ULBP1 and ULBP2 (Cosman et al., 2001) also, mouse CMV gp40 downregulates H60 (Krmpotic et al., 2002). Pathogen-encoded factors such as these might have selected for NKG2D-binding partners which retain receptor specificity but lack susceptibility to interference or subversion (e.g., ULBP3, which does not bind to UL16), resulting in the current repertoire of dissimilar NKG2D ligands (Carayannopoulos et al., 2002).

1.7. Escape mechanism by tumors

Tumors have developed many distinct mechanisms that would allow them to escape the detection by NKG2D expressing effector cells. As cancer progresses, immune pressure on the tumor may lead to selection of cells devoid of NKG2D ligands. It has been observed in cancer patients that most primary tumors seem to express NKG2D ligands, whereas more advanced tumors and metastases express very low level ligand (Vetter et al., 2004; Raffaghello et al., 2005). This leads to selection of variants with low levels of NKG2D ligands.

NKG2D ligand cleavage has been observed in some tumors. Metalloproteinases can cleave MICA/B off the cell surface of tumor cells (Doubrovina et al., 2003) reducing their cell surface levels and limiting recognition by NKG2D-expressing effector cells. In addition, soluble NKG2D ligands such as MICA in the serum, upon binding to NKG2D, induce the internalization and lysosomal degradation of the NKG2D receptor on CD8+ T cells and NK cells (Doubrovina et al., 2003; Jinushi et al., 2003), reducing the efficiency of NKG2D recognition.

TGF-ß, a major immunosuppressive cytokine produced by tumor cells also decreases the surface expression of MICA, effecting tumor cell recognition by CD8+ T and NK cells (Friese et al., 2004). In vitro experiments have shown that NK cells cultured in the presence of TGF-ß down-regulated NKG2D receptor expression (Lee et al., 2004). It has been reported that IFN-γ can render certain susceptible target cells resistant to NK cell responses in vitro and in vivo. This has been attributed to an up-regulation of MHC class I molecules, which are recognized by inhibitory NK cell receptors (Bui et al., 2006).

Research has also shown that sustained NKG2D ligand encounters can promote NK cell dysfunction in vitro and in vivo. The enforced constitutive expression of NKG2D ligands such as RAE-1ß, RAE-1є and MICA as transgenes in mice impair NKG2D functions in vivo (Wiemann et al., 2005). This observed NKG2D dysfunction also raises the possibility that CD8+ T cells and human NK cells may similarly be susceptible to inactivation.

1.8. NKG2D ligands diversity

Even though NKG2D ligands are not functionally equivalent, their roles are redundant to some extent (Komatsu et al., 1999). The evolutionary advantage for the presence of diverse NKG2D ligands can be explained with 3 possible reasons: 1) escaping immune recognition, 2) evading tumor responses and 3) tissue specific function (Eagle and Trowsdale, 2007).

1.8.1. Escaping immune recognition

In nature, both host and pathogen are under natural selection pressure to diversify and refine their defense strategies in response to improvements made by their competitor. It has been observed that viruses, such as human cytomegalovirus (HCMV), MCMV, Influenza A, and Epstein–Barr virus, induce NKG2D ligands in infected cells (Draghi et al., 2007; Pappworth et al., 2007). As an escape mechanism HCMV deploys immunoevasin proteins such as UL16 that can bind to MICB, ULBP1, ULBP2 and RAET1G and prevent the expression of NKG2D ligands, helping the virus to escape immune recognition (Cosman et al., 2001; Chalupny et al., 2003; Bacon et al., 2004). Since viruses have evolved mechanisms to evade immune system, the host responds by developing variants of NKG2D ligands by gene duplication and going beyond the reach of the virus (Zhou et al., 2005; Chalupny et al., 2006).

1.8.2. Evading tumor responses

One of the main functions of NKG2D is to participate in antitumour immune response and immune surveillance (Diefenbach et al., 2001; Smyth et al., 2005). Tumors have evolved many mechanisms that would allow them to avoid NKG2D-mediated immune attack. Some of these mechanisms are shedding soluble NKG2D ligands like MIC from their cell surface or down regulating MICA expression, producing TGF-β, effectively anergizing NKG2D-mediated immune recognition, and switching off the expression of NKG2D ligands as they progress (Groh et al., 2002; Vetter et al., 2004). Possessing multiple NKG2D ligands under the control of different cancer-related stress-response would provide the host with a fail-safe alert mechanism. Since expression of an individual NKG2D ligand may be lost as part of a cancer immunoediting process, the advantage of having more than one NKG2D ligand is that it would be much more difficult for the cancer to switch off multiple NKG2D ligands at once and help a host in detecting tumors (Eagle and Trowsdale, 2007).

1.8.3. Tissue specific functions

In humans, MICA and RAET1G proteins are expressed constitutively in the polarized epithelial-cell layer of the gut where they are likely to come in contact with pathogens (Groh et al., 1996). MICA and ULBP1–ULBP3 are expressed by normal airway epithelial cells (Borchers et al., 2006). RAE1 transcripts were reported in mouse embryonic tissues such as embryonic brain (Nomura et al., 1996). MICA has a specialized role in the gut, whereas ULBP4 may have a related but equally specialized role in the skin (Groh et al., 1996).

NKG2D ligands, like RAE-1 or MICA/B are not expressed in most tissues in healthy adult mice and humans (Nomura et al., 1996; Groh et al., 1996). ULBP1-3 mRNA is expressed in various healthy tissues (Cosman et al., 2001) and ULBP4 mRNA expression is detected in the skin (Jan Chalupny et al., 2003). Likewise, MULT1 mRNA is expressed in a wide variety of tissues such as thymus, spleen, lymph node, liver and heart (Carayannopoulos et al., 2002b; Diefenbach et al., 2003). RAE-1ß and RAE-1δ mRNA expression is detected in the early embryos, particularly in the brain (Nomura et al., 2006). Bone marrow cells express low levels of RAE-1 and H60 but not MULT1 (Ogasawara et al., 2003). Some NKG2D ligands are constitutively expressed in a restricted number of normal cells, indicating that they may have evolved unique tissue-specific functions that are not necessarily relate to their role in immune surveillance. Hence, it seems that NKG2D-ligand diversity may have allowed for the evolution of individual ligands with functional specialties that are specific for different cell types and tissues (Eagle and Trowsdale, 2007).

1.9. NKG2D dependent immunotherapy

As NKG2D receptor recognizes ligands that are constitutively expressed on many transformed but not on most normal cells, this provides an opportunity for their use in immunotherapy of cancer. Many different therapeutic strategies are being developed using NKG2D receptor-ligand interactions (Coudert and Held, 2006). Chimeric anti-tumor mAb/NKG2D-ligand, with the antibody portion of the chimeric protein specific to tumor cell targeting, while the NKG2D ligand re-directs NKG2D-expressing effector cells to the site of tumor have been generated. An anti-CEA (carcinoembryonic antigen)/MICA chimera and H60/anti-CEA specifically bind CEA+ human tumor cells and enhanced the in vitro lysis by NK cells in a NKG2D-dependent manner (Zhou et al., 2005). NKG2D receptor fused to the cytoplasmic portion of CD3ζ has been expressed in splenic T cells. This chimeric NKG2D receptor/CD3ζ protein confers primary activation function to T cells in response to NKG2D ligand-bearing tumor cells in vitro and induces memory response to NKG2D ligand-negative tumor cells (Zhang et al., 2005).

Cytokines, such as IL-21, IL-12 and IFN-α, exert anti-tumor effects by up-regulating NKG2D cell surface expression have been used in some tumor models with positive results. Mice treated with IL-21 have been observed to reject tumors cells more efficiently than control mice. IL-21 up-regulated NK cell mediated NKG2D-dependent tumor cell lysis in vitro and the rejection of grafted tumor cells in vivo (Takaki et al., 2005). Similar results were observed with IL-12 and IFN-α (Zhang et al., 2005).

Irradiation or alkylating compounds commonly used in chemotherapy treatment of cancer activate the DNA damage response pathway and can induce the expression of NKG2D ligands in mouse and human cells. ULBP3 and MICA are up-regulated by transretinoic acid in patients with chronic B cell lymphocytic leukemia (B-CLL) (Poggi et al., 2004). These treatments rendered tumor cells susceptible to killing by autologous NKG2D expressing effector cells and can be used as part of the combination therapy regime with any of the above discussed approaches (Coudert and Held, 2006).

NKG2D recognition of multiple stress-inducible host proteins is of considerable research interest since this system has potential to be manipulated for therapeutic purposes. Tumor cells expressing NKG2D ligands have been shown to be susceptible to NK cell mediated lysis, to induce a very potent antitumor response, and to provide protective immunity in vivo (Carayannopoulos et al., 2002a; Carayannopoulos et al., 2002b; Diefenbach et al., 2003; Kotturi et al., 2008; Eagle and Trowsdale, 2007). NKG2D recognition system has potential as a promising entry point to induce and/or improve immune responses against cancer for the following reasons. First, NKG2D ligands are generally poorly and only transiently expressed on healthy tissues, while they are constitutively expressed at significant levels on tumor cells. Second, NKG2D ligands are expressed on a broad variety of tumor cells of distinct tissue origins. Third, in situations where NKG2D ligands are poorly expressed, it may be possible to enhance their expression using radiation and/or chemotherapies. Fourth, NKG2D is expressed on all NK cells and also on a substantial fraction of T lymphocytes, providing a large number of potential effector cells. Fifth, cytokines may be used to improve NKG2D function. Finally, NKG2D-mediated adoptive immunotherapy should, in principal, be applicable to all individuals as the NKG2D receptor is monomorphic (Coudert and Held, 2006).

A great deal has yet to be understood about the involvement of NKG2D ligands in disease. A lot is known about the function of MICA; however, investigation of the expression and function of other NKG2D ligands with transmembrane domains and cytoplasmic tails is needed. A better understanding of the differences in the functional properties of NKG2D ligands and the pathways that regulate NKG2D ligand expression could help us develop better therapeutic interventions that could induce NKG2D-mediated immune responses and more efficient therapeutic strategies in the future (Eagle and Trowsdale, 2007).

1.10. Fas/CD95

CD95/APO-1/Fas receptor is a member of the tumor necrosis factor (TNF) superfamily of receptors. Its main function in signaling is the induction of apoptosis (Schulze-Osthoff et al., 1998). CD95/Fas receptor is expressed on various human cells, including myeloid cells, T lymphoblastoid cells, and diploid fibroblasts. Fas is a 48-kDa type I transmembrane receptor of 319 amino acids with a single transmembrane domain of 17 amino acids, an N-terminal cysteine-rich extracellular domain and a C-terminal cytoplasmic domain containing 145 amino acids relatively abundant in charged amino acids. The cytoplasmic portion of Fas contains a domain called “death domain” of about 85 amino acids. The “death domain” is very crucial as it plays a role in transmitting the death signal from the cell’s surface to intracellular pathways and mediates signaling through protein–protein interactions (Nagata, 1997). The tertiary structure of the Fas death domain consists of six antiparallel, amphipathic α helices. Helices α1 and α2 are centrally located and flanked on each side by α3/α4 and α5/α6. This leads to an unusual topology in which the loops connecting α1/α2 and α4/α5 cross over each other. The presence of a high number of charged amino acids in the death domain is responsible for interactions between death domains (Mollinedo and Gajate, 2006). CD95 receptors are expressed on the surface of cells as preassociated homotrimers (Siegel et al., 2000). These interactions were found to be mediated by a domain in the N-terminus, within the first of the cysteine-rich domains called PLAD (preligand binding assembly domain) (Siegel et al., 2000). CD95 receptors only function as trimers (Kischkel et al., 1995).

CD95 contains a protein–protein interaction domain in its cytoplasmic region termed the death domain (DD) (Peter et al., 1999). When the preassociated receptor is ligated, CD95 becomes competent to form the death-inducing signaling complex (DISC). In the DISC, the adaptor molecule Fas-associated DD containing protein (FADD) binds to CD95 through homotypic interaction of its DD with the DD of CD95 (Kischkel et al., 1995). In addition to its DD, FADD contains another protein–protein interaction domain at its N-terminus, termed the death effector domain (DED). This domain recruits caspases containing these DED domains to the DISC. Both the DD and DED enable proteins containing the same domains to interact with one another. FADD interacts with procaspase-8 through its DED (Boldin et al., 1996). Thus, activation of Fas results in receptor aggregation and formation of DISC (Kischkel et al., 1995), containing trimerized Fas, FADD and procaspase-8. The apoptotic caspases perform different roles. The effector caspases, which include caspases 3, 7, and 6 are responsible for most of the cleavage of proteins characteristic of apoptosis and are responsible for cleavage of proteins which induce the major morphological changes observed during programmed cell death (Ernshaw et al., 1999). Caspase-8 is a main initiator caspase and transduces the first signals of apoptosis in CD95 signaling and is expressed as two isoforms, caspase-8/a and -8/b, which are both recruited to the activated CD95 receptor (Scaffidi et al., 1997). Two molecules (FADD and caspase-8) are the key components of the CD95 DISC. Once procaspase-8 associates with FADD, the high local concentration of procaspase-8 leads to its autoproteolytic cleavage and activation (Salvesan and Dixit, 1999). Following the autoproteolytic cleavage of the enzyme, caspase-8 is released from the DISC as an active heterotetramer (Peter and Krammer, 2003).

1.11. Fas ligand (FasL)

FasL belongs to the TNF family and can be found as a 40-kDa membrane-bound or a 26-kDa soluble protein (Nagata, 1997). Rat FasL has no signal sequence at the N-terminus, but has a domain of hydrophobic amino acids in the middle of the molecule, indication that it is a type 11 membrane protein with the COOH-terminal region outside the cell. Mouse and human FasL are 76.9% identical at the amino acid sequence level and are functionally interchangeable. A stretch of about 150 amino acids in the extracellular region of FasL show significant homology to the corresponding region of other members of the TNF family which includes TNF, lymphotoxin (LT), CD40 ligand, CD27 ligand, CD30 ligand and OX40 ligand. A single FasL gene is located on human and mouse chromosome 1 in the neighborhood of the OX40 ligand gene. Fas/FasL system is the major regulator of apoptosis at the cell membrane in mammalian cells through a receptor/ligand interaction (Mollinedo and Gajate, 2006).

1.11.1. Expression of fasL

FasL has been found to be expressed on cells of the lymphoid/myeloid lineage, including activated T cells and natural killer (NK) cells, where it plays an important role in immune homeostasis, T cell and NK cell-mediated toxicity (Brunner et al., 2003). FasL is also found to be expressed in sites such as the eye (Griffith et al., 1995) and testis (Bellgrau et al., 1995) contributing to immune privilege by inducing apoptosis of infiltrating proinflammatory immunocytes (Houston and O’Connell, 2004). FasL expression has also been observed in a variety of tumor cells indicating a possibility that FasL could mediate immune privilege in human tumors by inducing apoptosis of anti-tumor lymphocytes and also, stimulate proliferation of tumor cells (Houston and O’Connell, 2004). Tumor expression of FasL was first demonstrated in the colon carcinoma cell line SW620, where it could induce apoptosis of Fas-sensitive lymphoid cells in vitro (O’Connell et al., 1996). A functional FasL expression has also been reported on numerous tumors of varying origin including colon (Okada et al., 2000), gastric (Zheng et al., 2003), lung (Niehans et al., 1997) carcinoma, and astrocytoma (Saas et al., 1997). Tumor cells expressing FasL demonstrated the ability to kill Fas-sensitive target cells when co-cultured in vitro. Apoptosis of tumor-infiltrating lymphocytes (TILs) has also been detected in situ within FasL-expressing human tumors such as esophageal carcinoma (Houston and O’Connell, 2004; Okada et al., 2000; Zheng et al., 2003; Niehans et al., 1997).

FasL expression was found to be higher in metastatic tumors than in primary ones. In breast and cervical tumors, high FasL expression was significantly associated with lymph node metastases (Kase et al., 2003) whereas, stronger FasL expression was found in liver metastases of colon cancer relative to the primary tumor (Houston and O’Connell, 2004).

1.11.2. Inhibition of apoptosis

One of the hallmarks of cancer is resistance to apoptosis (Hanahan and Weinberg, 2000). Most cancer cells are relatively resistant to apoptosis mediated through Fas. Fas-mediated apoptosis can be inhibited at different points in the apoptotic signaling pathway. Cells may secrete soluble ‘decoy’ receptors, such as sFasL or DcR3, which can bind to FasL and inhibit FasL-induced apoptosis (Pitti et al., 1998). FADD-like interleukin-1ß-converting enzyme inhibitory protein (cFLIP) binds to the DISC and prevents the activation of caspase-8 (Irmler et al., 1997). Reduced expression of FADD (Tourneur et al., 2003) or caspase-8 (Fulda et al., 2001) can also inhibit Fas signaling. IAPs present in the cytosol can bind to and inhibit caspases and upregulation of Bcl-2 or Bcl-xL can render type II cells resistant to Fas-mediated apoptosis. Cytochrome c and inhibitor-of-apoptosis protein (IAP) can inhibit apoptosis (Igney and Krammer, 2002). Thus, because of their insensitivity to Fas-mediated apoptosis, tumor cells can express FasL without undergoing apoptosis (Houston et al., 2003). It has been observed that resistance to Fas-mediated apoptosis protects tumor cells not only from tumor-expressed FasL but also from FasL expressed as a cytotoxic mediator by infiltrating anti-tumor T cells and NK cells (Houston and O’Connell, 2004).

1.12. Immunotherapy

Death receptors are members of the tumor necrosis factor (TNF) receptor gene superfamily, consisting of more than 20 proteins with a broad range of biological function, including regulation of cell death, survival, differentiation or immune regulation (Debatin and Krammer, 2004). Death receptors share regions of high homology including cysteine-rich extracellular domains and a cytoplasmic domain of about 80 amino acids called death domain (DD), which plays a crucial role in transmitting the death signal from the cells surface to intracellular signaling pathways (Mollinedo and Gajate, 2006).

The death receptors which have potential to induce apoptosis are Fas, TNF receptor 1 (TNFR1), TNF-related apoptosis-inducing ligand receptor 1 (TRAIL-R1), TRAIL-R2, death receptor 4 (DR4) and death receptor 5 (DR5). Due to their potential to induce apoptosis, ligands such as TNF, Fas ligand (FasL) and TRAIL are interesting candidates for antitumor therapy (Shankar and Srivastava, 2004; Mollinedo and Gajate, 2006). However, ligands of the TNF family and their cognate receptors have been found to play a key role in liver pathogenesis and have become a major challenge for the clinical application of death receptor-targeted therapy (Hohenberger and Tunn, 2003; Ogasawara et al., 1993; Nesterov et al., 2002).

Conventional chemotherapy is based on the perception that malignant cells have uncontrolled proliferation. The rather modest impact of antiproliferative drugs in the clinic is not surprising since many tumors have a low growth capacity. In addition, exposure of normal tissues that have a high rate of cellular proliferation, such as the bone marrow, the gastrointestinal epithelial cells and the cells of the hair follicles, to anti-proliferative drugs leads to major toxicities. The effectiveness of anticancer drugs reflects the ability of tumor cells to detect and respond to the perturbation induced by the drug (Mashima and Tsuruo, 2005). The failure of some tumor cells to die following drug treatment and their resistance to drugs is due to their resistance to apoptosis as tumors cells have defects in triggering their own death by apoptosis (Mollinedo and Gajate, 2006). If liver toxicity could be circumvented, Fas would be a worthy anticancer target due to its potent proapoptotic activity and widespread expression in tumor cells (Mollinedo and Gajate, 2006).

1.13. Adenovirus and cancer gene therapy

Different viral vectors like lentivirus, retrovirus, pox virus, herpes simplex virus-1, vaccinia virus, adeno-associated virus (AAV) and adenovirus have been used for experimental cancer gene therapy (Young et al., 2006). These viral vectors have been used individually and in combination with conventional therapies to treat cancers that are refractory to just conventional therapy (surgery, radiation, and chemotherapy). Of all the vectors used, adenoviruses are one of the most widely accepted viral agents for cancer gene therapy. The features of adenovirus that make them well suited for gene therapy are: its capacity for gene transfer (up to 7-8 Kb), in vivo stability, inability to integrate into host genome, ability to transduce dividing and non dividing cells, a well characterized genome and relative ease of production, purification and manipulation. From a clinical point of view, adenovirus is endemic in the human population and its natural pathogenicity is associated with mild respiratory infections, and therefore, manifests a well defined safety profile (Gomes and Tong, 2006 ; Young et al., 2006).

Adenovirus was first isolated and cultured from human tonsils and adenoid tissues (Garnett et al., 2002). Currently, 51 human adenovirus serotypes have been identified and grouped into six subgroups (A-F) of which the most widely studied serotype are group C types 2 and 5. Adenovirus is a non-enveloped icosohedral particle which carries a 36 Kb double stranded DNA genome. The capsid consists of three main components: hexon, penton and fiber. Hexon is the most abundant structural protein which appears to play a role in coating the virus. The pentameric structure called penton is known to mediate viral internalization. The fiber protrudes from the penton bases and appears to play a role in viral attachment to the cellular receptor namely coxsackie adenovirus receptor (CAR). Attachment via knob-CAR interactions is followed by interactions between cellular integrins and an arginine-glycine aspartic acid motif (RGD-motif) located at the penton base. This binding leads to the formation of endosomes, viral internalization, disassembly and the release of viral nucleic acid. Thereafter viral DNA is transported to the nucleus where the genes are expressed and viral replication occurs. The adenoviral genome can be divided into immediately early (E1A), early (E1B, E2, E3, E4), intermediate (IX, IVa2) and late genes. The early genes are expressed prior to viral replication consisting of mainly regulatory proteins that prepare the host cell for virus DNA replication and block antiviral mechanisms. The late viral genes encode for viral structural proteins. Importantly, E3 region encodes a variety of proteins involved in immune response evasion. Adenoviruses with deletions in E1 and/or E3 regions have been developed to provide cloning sites for transgene insertion (Gomes and Tong, 2006 ).

1.14. Conditional replicative and oncolytic adenovirus for cancer therapy

Research has shown that adenovirus can be safely used for gene delivery. Adenoviruses have been modified by replacing early genes, E1A and E1B or E3 with the gene of interest. Since the E1 unit is essential for viral replication, the recombinant vector is replicative defective and its replication requires helper functions provided by a packaging cell line with complementing E1 genes. However, these recombinant constructs have been useful mainly at local/ regional stage. Their therapeutic limitation has been the incomplete infection of tumor cells, transient expression of the transgene, and a lack of systemic efficacy. Recently, conditional replicative oncolytic adenoviruses have been shown to replicate and kill tumor cells without harming normal cells. The tumor specificity of these viruses has been manifested through the incorporation of tissue or tumor specific promoters that limit viral gene (Tong, 2006; Gomes and Tong, 2006 ).

A recent study indicates that the use of adenoviral vectors for clinical gene therapy is widespread. As of July 2006, adenoviral vectors are used in 26% of the 1,192 current worldwide gene therapy clinical trials. Of the 301 clinical trials involving the use of Ad vectors, 76% are for the treatment of cancer followed by vascular disease and monogenic disorders at 14% and 7%, respectively (http://www.wiley.co.uk/ genetherapy /clinical/) (Campos and Barry. 2007).

Adenoviral gene therapy approaches have shown promising results in clinical trials. Adenovirus mediated delivery of NTR (nitroreductase enzyme) from E. Coli by direct intratumoural injection in patients with primary or secondary liver cancer showed appropriate levels of NTR expression in tumor cells. The early clinical trial data of the NTR/CB1954 system in patients with liver cancer or prostate cancer are extremely encouraging (Palmer et al., 2004). Adenoviral delivery of TRAIL (tumor necrosis factor-related apoptosis-inducing ligand) showed significant anti-tumor efficacy in animal models of aggressive primary and metastatic cancer (Ma et al., 2005). Clinical trials of a recombinant adenovirus expressing interleukin-12 (IL-12) in patients with advanced digestive tumors have produced evidence of antitumor effects (Sangro et al., 2004).

Advertisement

2. Hypothesis and objectives

2.1. Hypothesis

A novel fusion protein consisting of MULT1 extracellular domain and Fas transmembrane and intracellular domains (MULT1E/FasTI) when expressed on a cell, would activate NKG2D expressing cells such as NK cells from its MULT1E extracellular region, upon binding of MULT1E to NKG2D receptor on NK cells. At the same time the engagement of the fusion protein with NKG2D receptor would send death signals into the cells that express the fusion protein and induce apoptosis of the cell (Fig.1).

2.2. Objectives

The work presented here is a two pronged approach of using a novel fusion protein consisting of MULT1 extracellular domain and Fas transmembrane and intracellular domains for cancer therapy. First, the construction and expression of MULT1E/FasTI fusion protein is examined. Second, in vitro and in vivo activity of the fusion protein is tested. Finally, the adenoviral vector mediated delivery and in vivo therapeutic effect of the novel fusion protein is evaluated.

Figure 1.

Schematic representation of proposed mechanism of novel fusion protein MULT1E /FasTI.

Advertisement

3. Construction and evaluation of fusion protein MULT1E/FasTI

3.1. Plasmid construction of pMULT1E/FasTI

Thymus glands from 4-day old newborn C57BL/6J mice were removed and stored in liquid nitrogen. The glands were homogenized using a tissue homogenizer and total RNA was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA). Primers were designed for amplification of the extracellular domain of MULT1 (Genebank accession # NM_029975) from 236bp to 868bp. The sequence of the 5’ primer is CCCAAGCTTATGGAGCTG ACTGCCAGTAACAAGGTCC and that of the 3’ primer is CGGGATCCGGTACTGAAA GATCCTGCAGGCTCCAG. At the 5’ end of the upstream primer, a HindIII enzyme site was created and at the 5’ end of downstream primer, a BamHI site was created. cDNA was synthesized from the extracted total RNA using an RT-PCR kit (Promega, Madison, WI). The fragment was excised and gel purified using a Qiagen gel purification kit (Valencia, CA). Double enzyme digestion was performed on the purified fragment using HindIII and BamHI. The enzyme digested fragment was then ligated into a pcDNA3.1 (+) vector (Invitrogen, CA). The full MULT1 cDNA sequence in the new vector, pMULT1E, was confirmed by DNA sequencing.

The cDNA clone of the Fas receptor in pDNR-LIB (ATCC # 10088798) was purchased from American Type Collection Centre (ATCC, Manassas, VA). A pair of primers was designed for amplification of the transmembrane and intracellular domains of Fas from 524 bp to 1013bp (Genebank accession# BC061160). The 5’ primer used was CGGGATCCCCC AGAA ATCGCCTATGGTTGTTGTTGACC and the 3’ primer was CGGAATTCTCACTCCAGACA TTGTCCTTCATTTTC. At the 5’ end of upstream primer, a BamHI enzyme site was created and at the 5’ end of downstream primer, an EcoRI enzyme site was created. DNA PCR was performed to amplify the Fas transmembrane and intracellular domains from pDNR-LIB. The gel purified fragment was treated with BamHI and EcoRI enzymes and ligated into the pcDNA3.1 (+)/Zeo vector to create pFasTI. The DNA sequence of the transmembrane and intracellular domains of Fas in vector pFasTI was confirmed by DNA sequencing.

The cDNA fragment encoding the MULT1 extracellular domain was cut out from pMULT1E by HindIII and BamHI enzyme digestion and ligated into the pFasTI. The resulting vector was named pMULT1E/FasTI (Fig.2) and used for transfection.

Figure 2.

Construction of the MULT1E/FasTI plasmid.

3.2. Expression of pMULT1E/FasTI

Lung carcinoma TC-1 tumor cells were transfected with pMULT1E/FasTI. Three clones that were zeocin resistant were selected and labeled as L-5, L-7 and L-10. An in vitro cell growth study showed that all the clones grew at a similar rate as TC-1 cells. The cells of these clones were stained with anti-mouse MULT1 antibody and analyzed by fluorescence-activated cell sorting (FACS). The result showed that TC-1 cells and clone L-7 cells were negative, whereas clones L-5 and L-10 cells were strongly positive (Fig. 3). To confirm that MULT1E of the fusion protein can indeed bind to NKG2D, the cells were incubated with NKG2D/Fc, a recombinant fusion protein, and then stained with anti-mouse NKG2D antibody conjugated with fluorescein isothiocyanate (FITC). TC-1 cells and clone L-7 cells were dimly positive, whereas clones L-5 and L-10 cells were strongly positive (Fig. 4) with L-10 cells the strongest. The results indicate that clones L-5 and L-10 are MULT1E/FasTI-positive clones, whereas TC-1 and clone L-7 are negative for the fusion protein, but express some endogenous MULT1 protein.

Figure 3.

FACS analysis of MULT1E/FasTI expression. A total of 5x105 cells of TC-1 and clones L5, L7 or L10 were stained with purified rat anti-mouse MULT1 antibody followed by goat anti-mouse IgG F(ab’)-FITC. The dashed lines are isotype controls.

Figure 4.

FACS analysis of MULT1E/FasTI expression. A total of 1x106 cells of TC-1 and clones L-5, L-7 or L-10 were first treated with NKG2D/Fc and then stained with anti-mouse NKG2D antibody conjugated with FITC. The cells were analyzed on FACS Calibur with CellQuest software. Dashed lines are controls without NKG2D/Fc incubation.

3.3. Fusion protein MULT1E/FasTI induces apoptosis of cells

To confirm the concept that when bound to its ligand NKG2D fusion protein MULT1E/FasTI can send death signals through its Fas portion into the cells, TC-1 cells and clones L-5, L-7, L-10 were treated with recombinant protein NKG2D/Fc and analyzed by Annexin V staining and caspase-3 activation assay. The treatment of NKG2D/Fc increased both Annexin V-positive cells and Annexin V/propidium iodide (PI) double-positive cells in clones L-5 and L-10, but not in TC-1 cells or clone L-7 (Fig. 5). After the NKG2D/Fc treatment, not only apoptotic cells (Annexin V-positive cells and Annexin V/PI double- positive cells), but also the necrotic cells (PI-positive/Annexin V-negative cells) in clone L-5 and L-10 were significantly higher than those of TC-1 or clone L-7 (Fig. 6 A and 6B). Similarly, caspase-3 activities in cells of clones L-5 and L-10 were significantly higher than those of TC-1 or clone L-7 (Fig. 6C). The treatment of NKG2D/Fc induced more apoptotic cells in clone L-10 than clone L-5 (Fig. 6 A and 6C).

3.4. Cells expressing MULT1E/FasTI activate NK cells

It is critical to know whether fusion protein MULT1E/FasTI can activate NKG2D-expressing cells, such as NK cells. Cells from TC-1 or clones L-5, L-7 and L-10 were co-cultured with NK cells isolated from mouse spleen. Intracellular interferon-γ (IFN- γ) was detected by FACS analysis (Fig. 7A). The percentage of the NK cells that express IFN- γ was significantly increased in wells that contained cells of clone L-5 or L-10 compared to those co-cultured with TC-1 (P<0.05). Although the percentage of NK cells expressing IFN-γ in wells that contained cells of clone L-7 increased slightly compared to those co-cultured with TC-1 cells, it was not statistically significant (Fig. 7B).

Figure 5.

MULT1E/FasTI induces apoptosis. A total of 1x106 cells of TC-1 and clones L-5, L-7 and L-10 were treated with 1 µg/ml NKG2D/Fc for 16 h. The cells were then analyzed for apoptosis and necrosis using Annexin V staining and PI. This figure is an example of the FACS data.

Figure 6.

MULT1E/FasTI induces apoptosis. A total of 1x106 cells of TC-1 and clones L-5, L-7 and L-10 were treated with 1 µg/ml NKG2D/Fc for 16 h. The cells were then analyzed for apoptosis and necrosis using Annexin V staining (A, B) or caspase-3 assay (C). The statistical analyses were conducted between the controls (open bars) and NKG2D/Fc-treated cells (solid bars) using two-way analysis of variance (ANOVA). The difference between NKG2D/Fc-treated L-5 cells and NKG2D/Fc-treated L-10 cells was also compared using Student’s t-test. *P<0.05; **P<0.01 and ***P<0.001.

Figure 7.

MULT1E/FasTI activates natural killer (NK) cells. A total of 1x106 cells of TC-1 and clones L-5, L-7 and L-10 were co-cultured with NK cells for 3 h. The cells were stained with anti-NK1.1-FITC and were then permeabilized and fixed, and stained with antimouse IFN-γ-PE. The cells were analyzed on FACS Calibur with CellQuest software. (A) represents an example of the FACS data and (B) is the summery of the data from three separate experiments. *P<0.05.

3.5. In vivo antitumor effect of fusion protein MULT1E/FasTI

The in vivo therapeutic effect of the fusion protein was evaluated in a subcutaneous tumor model as well as a pulmonary metastasis model. Two hundred thousand cells of TC-1 and clones L-5, L-7 and L-10 in 0.2 ml Hank’s balanced salt solution (HBSS) were injected subcutaneously into 6- to 8-week-old mice and tumor size was measured twice weekly with a caliper and tumor volume was calculated. The tumor growth of clone L-7 was slightly, but not significantly (P>0.05) slower when compared to that of TC-1 cells. At day 18, the growth of clones L-5 and L-10 was significantly slower (P<0.01, P<0.01) when compared to that of TC-1 cells. At day 24, the difference of tumor growth between TC-1 and clone L-10 was even more significant (P<0.001), whereas the difference of tumor growth between TC-1 and clone L-5 remained the same (P<0.01; Fig. 8). An even better antitumor effect of the fusion protein was observed in the pulmonary metastasis model. Four weeks after i.v. tumor cell injection, the mice were euthanized and lungs were excised (Fig. 9A). The total weight of the lungs with the tumors was measured (Fig. 9B) and the tumor nodules on the surface of the lungs were counted (Fig. 9C). The lungs isolated from mice injected with TC-1 cells were fully covered with tumors and weighed an average 0.82 g. All the four lungs have more than 200 tumor nodules each. The lungs isolated from mice injected with clone L-7 cells are covered with many tumors as well and weighed averagely 0.48 g. There are 118, 89, 67, 125 tumor nodules on the lungs. The lungs isolated from mice injected with clones L-5 and L-10 were almost tumor free and weighed much less (0.15 and 0.14 g, respectively) than those of mice injected with either TC-1 cells or clone L-7 cells. The average weight of lungs from normal mice was 0.14 g.

Figure 8.

Subcutaneous tumor study. A total of 2x105 tumor cells of TC-1 or clones L-5, L-7 and L-10 in 0.2 ml HBSS were subcutaneously injected into C57BL/6J mice (four mice per group). Tumor growth was measured and presented as 1/2LW2. **P<0.01; ***P<0.001.

Figure 9.

Pulmonary metastatic tumor study. A total of 2x105 tumor cells of TC-1 or clones L-5, L-7 and L-10 in 0.5 ml HBSS were i.v. injected into C57BL/6J mice (four mice per group). Four weeks after tumor cell injection, mice were killed and their lungs were dissected (A). The lungs were weighted (B) and the tumor nodules on the lungs were counted (C). *P<0.05; ***P<0.001.

3.6. Construction of adenoviral vectors

In order to effectively deliver the fusion protein into cells, especially tumor cells, adenovirus vectors were chosen. Ad-MULT1E/FasTI, Ad-MULT1E and Ad-Lac-Z adenovirus were generated using the ViraPower Adenoviral Expression System (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. The full-length cDNAs of MULT1E/FasTI or MULT1E (Section 3.1) were cloned into the pCR ®8/GW/TOPO® vector. The pCR ®8/GW/TOPO® vector with MULT1E/FasTI or MULT1E inserts were used as entry clone vectors and transferred into the destination vector pAd/CMV/V5-DEST (Invitrogen, Carlsbad, CA) using the Gateway LR Clonase II enzyme mix according to the manufacturer’s directions (Invitrogen, Carlsbad, CA) to generate pAd/CMV/ MULT1E/FasTI/V5 and pAd/CMV/MULT1E/V5. The vectors were linearized with PacI enzyme and transfected into 293A cells using LipofectamineTM 2000 reagent as per manufacturer’s directions. The 293A cells were maintained in DMEM medium until a cytophathic effect was apparent 5–7 days post-transfection. Cells were collected and lysed by subjecting them to four freeze/thaw cycles. The cell debris was pelleted at 3000 x g for 15 min and the supernatant was collected and stored at -80º C as crude viral lysate. Fifty microliters of crude viral lysate were added into each 293A cell culture dish and incubated for 2-3 days until an 80-100% cytophathic effect was observed. Two recombinant adenoviruses (Ad-MULT1E/FasTI and Ad-MULT1E) were harvested and purified using the Adeno-X TM virus Mini Purification Kit according to the manufacturer’s directions (Clontech, Mountain View, CA) and stored at -80º C. Ad-Lac-Z was purchased directly from the manufacturer (Clontech) and amplified as per the above method. Titers of Ad-MULT1E/FasTI, Ad-MULT1E and Ad-Lac-Z stocks were determined using an Adeno-X TM Rapid Titer Kit as per manufacturer’s directions (Clontech).

3.7. Adenoviral vector effectively delivers MULT1E/FasTI into cultured TC-1 cells

Three adenoviral vectors were constructed: 1) Ad-MULT1E/FasTI containing the full fusion protein sequence of MULT1E extracellular domain and FasTI transmembrane and intracellular domains; 2) Ad-MULT1E containing only the MULT1E extracellular domain; 3) Ad-Lac-Z containing the Lac-Z gene as control adenoviral vector. The adenoviral vectors were linearized using Pac1 and transfected into 293A cells to generate adenoviral stocks. The titer of these adenoviral stocks are in the range of 1010 PFU/ml.

TC-1 tumor cells were infected with Ad-MULT1E/FasTI viral particles with different multiplicities of infection (MOI): 500, 250, 100, 25, and 0 for 24 hours. The fusion gene expression was detected by RT-PCR (Fig. 10) and FACS analysis (Fig. 11). Both assays not only demonstrate the fusion gene expression in the infected cells, but also show a clear dose dependent expression manner.

Figure 10.

RT-PCR analysis of AD-MULT1E/FasTI expression at different MOIs. RNAs were isolated from infected cells and RT-PCR was performed. Lanes 2, 4, 6, 8, 10 and 12 are 1134bp RT-PCR product of total RNA from TC1 cells infected with Ad-MULT1E/ FasTI at MOIs 500, 250, 100, 50, 25 and 0, amplified with MULT1E forward and Fas reverse primers; Lanes 3, 5, 7, 9, 11 and 13 are ß-actin controls; and lanes 1 and 14 are 1 kb markers.

Figure 11.

FACS analyses of AD-MULT1E/FasTI expression at different MOIs. 5 x 105 TC1 cells were harvested from each group that were infected with Ad-MULT1E/FasTI at MOIs 500, 250, 100, 50, 25, 0 and stained with purified rat anti-mouse MULT1 antibody followed by goat anti IgG F(ab’)-FITC. Dashed lines represent un-infected TC-1 cells.

3.8. MULT1E/FasTI delivered by adenoviral vector induces apoptosis in TC-1 cells

To confirm the activity of adenoviral vector delivered MULT1E/FasTI fusion protein in TC-1 cells, recombinant NKG2D/Fc ligand was added to the infected cells. As MULT1E binds to its ligand NKG2D, the binding would send apoptotic signal through its FasTI region into TC-1 cells (Kotturi et al., 2008). When TC-1 cells were infected with 100 MOI of Ad-MULT1E/FasTI and treated with NKG2D/Fc, their caspase 3 activity was significantly higher (p<0.001) than the cells that were also infected by Ad-MULT1E/FasTI but not treated with NKG2D/Fc. Ad-MULT1E or Ad-Lac-Z infection showed slightly increased caspase 3 activity (p>0.05) compared with non-infected TC-1 cells (Fig. 12A). The caspase activity in Ad-MULT1E/FasTI infected and NKG2D treated TC-1 cells is adenoviral particle dose

Figure 12.

Ad-MULT1E/FasTI infection induces apoptosis in vitro. A) TC-1 (5x105) cells were infected with Ad-MULT1E/FasTI, Ad-MULT1E and Ad-Lac-Z at 100 MOI. Twenty-four hour after infection, cells were treated with 1µg/ml NKG2D/Fc for 16 hrs. The cells were then analyzed for apoptosis by caspase-3 assay. B) TC-1 (5x105) cells were infected with Ad-MULT1E/FasTI at different MOIs: 500, 250, 100, 50, 25. Twenty-four hour after infection, cells were treated with 1µg/ml NKG2D/Fc for 16 hrs. The cells were then analyzed for apoptosis by caspase-3 assay. The data represented are summaries of three separate experiments. *p< 0.05; **p< 0.01 and ***p< 0.001.

dependent: 500 MOI infection generated the highest caspase activity, while a 25 MOI infection did not show any increased caspase 3 activity compared with un-infected TC-1 cells (Fig. 12B).

3.9. Intratumor delivery of MULT1E/FasTI by adenoviral vector

To observe the antitumor activity of MULT1E/FasTI delivered by adenoviral vector, subcutaneous TC-1 tumors were grown in C57BL/6J mice. When the tumor reached about a size of 40 mm3, Ad-MULT1E/FasTI, Ad-MULT1E or Ad-Lac-Z at a dose of 1x109 pfu/tumor in 0.05ml HBSS was injected into the tumors. Control mice received HBSS only. The injections were repeated every other day for 4 times. The size of the tumors was measured every two days. At day 22 after tumor cell injection, the mice were sacrificed and the tumors were collected and measured. Although tumors received Ad-MULT1E or Ad-Lac-Z grew slightly slower than tumors received only HBSS, tumors received Ad-MULT1E/FasTI showed the slowest growth rate (Fig. 13A). The end point tumor measurement confirmed the conclusion that Ad-MULT1E/FasTI treatment significantly slowed the tumor growth (P<0.01, Fig. 13B).

Figure 13.

MULT1E/FasTI delivered by adenoviral vector inhibits in vivo tumor growth. TC-1 cells (2 x 105) in 0.2ml HBSS were subcutaneously injected into flanks of C57BL/6J mice (n = 6). One week after tumor cell injection, various viral vectors at a dose of 1 x 109 pfu/tumor were intratumorally injected on every other day for a total of 4 injections. Control animals received injections of 50µl HBSS. Tumor growth was measured and presented as 1/2LW2 (A). At the end of this experiment, the mice were sacrificed and tumors were harvested and measured (B). *P< 0.05

3.10. MULT1E/FasTI delivered by adenoviral vector induces apoptosis in tumor

In order to confirm that MULT1E/FasTI delivered by adenoviral vector slows tumor growth by inducing tumor cell to undergo apoptosis, two days after last adenoviral particle injection, some mice were i.v. injected with FLIVOTM in vivo apoptosis detection reagent. Thirty minutes later, the tumor tissues were collected and 7 µm frozen sections were produced. The slides were examined under fluorescent microscope and the green fluorescent cells were counted. The number of apoptotic cells in tumors receiving Ad-MULT1E/FasTI is significantly higher than that of tumors receiving either Ad-MULT1E or Ad-Lac-Z. There are no significantly more apoptotic cells in tumors receiving Ad-MULT1E or Ad-Lac-Z when compared with tumors that received just HBSS (Fig. 14).

Figure 14.

MULT1E/FasTI delivered by adenoviral vector induces apoptosis in vivo. Two days after the last intratumor virus injection, 100µl of FLIVOTM in vivo apoptosis detection reagent (green) was injected into mice. Thirty minutes later, the mice were sacrificed and tumors collected. Frozen sections were made from the tumor tissues and examined under fluorescent microscope. The data presented are the sum of apoptotic cells from 12 random fields of each section. *** P < 0001

Advertisement

4. Conclusion

Tumor cells have developed multiple mechanisms to subvert and suppress immune responses by regulating cell-surface expression of Fas (Ivanov et al., 2003) and Fas ligand (Zheng et al., 2003) and shedding NKG2D ligands such as MULT1 (Raffaghello et al., 2004), resulting in escape from killing by infiltrating antitumor NK cells and T cells (Elsasser-Beile et al., 2003). As NKG2D ligand surface levels critically determine the susceptibility to NKG2D-mediated NK cell lysis, stable expression of NKG2D ligands on tumors would help increase NK cell lysis of tumors (Diefenbach and Raulet, 2001). In this study, we enhanced the cell-surface expression of MULT1, one of the mouse NKG2D ligands, by anchoring the extracellular domain of MULT1 on tumor cells using a transmembrane sequence of Fas. We also introduced the DD of Fas in the intracellular domain of the fusion protein MULT1E/FasTI, hoping to develop a bifunctional chimeric protein that can send an apoptosis signal to the tumor cells and at the same time activate NKG2D-expressing immune cells such as NK cells.

We cloned the cDNA encoding the extracellular domain of MULT1 gene from thymus of new born mice and ligated it to the transmembrane and intracellular domains of mouse fas cDNA. The resulting fusion cDNA was inserted into a mammalian cell expressing vector under the control of CMV promoter. The vector was then transfected into mouse TC-1 lung epithelial cancer cells, and stable cell lines expressing the fusion protein were established. The transcription of the novel fusion protein MULT1E/FasTI in the transfected cells was confirmed by RT–PCR and its expression was characterized by surface FACS analysis.

One of the key features of the designed fusion protein is to send apoptosis signals into the cells expressing the fusion protein, upon binding to its ligand, NKG2D. Although we do not have direct evidence supporting that the binding of NKG2D can form DISC inside tumor cells, a clear apoptosis signal is sent to the cells as indicated by the increased caspase-3 activity and increased Annexin V-positive cells after treatment with recombinant NKG2D/Fc. Our data shows that fusion protein MULT1E/FasTI, when expressed on cells, not only sends apoptotic signals into cells expressing it, but also activates immune cells that express receptors for MULT1 like NK cells. When co-culutred with NK cells isolated from spleen, the fusion proteins expressing clones activated NK cells by producing IFN-γ.

This study shows that fusion protein MULT1E/FasTI has antitumor activity in vivo. We used a subcutaneous tumor model and a pulmonary metastatic tumor model in this study. In the subcutaneous tumor study, MULT1E/FasTI expressing clones formed smaller tumors compared to controls; and in the pulmonary metastasis study, mice completely rejected tumor cells expressing the fusion protein. We showed that the fusion protein had a much stronger antitumor effect in the pulmonary metastasis setting than in the subcutaneous setting. This is in agreement with a study demonstrating that NK cells are more effective against blood borne metastasis (Smyth et al., 2002). Previous studies have shown that tumor cells ectopically expressing NKG2D ligands such as MULT1 are potently rejected by NKG2D-expressing lymphocytes (Diefenbach et al., 2001). Our data shows that adding Fas to the MULT1 has a clear additional antitumor effect.

A significant challenge facing cancer gene therapy is how to specifically deliver tumor-killing genes into tumor cells efficiently. The recent development of adenovirus as gene delivery vectors opens a new window for cancer gene therapy (Cohen and Rudin, 2001; Ries and Korn, 2002). We used adenoviruses to deliver the fusion protein MULT1E/FasTI into tumor cells. The findings of this study demonstrate the therapeutic effect of adenovirus-mediated gene therapy of novel fusion protein MULT1E/FasTI. The most encouraging finding from a preclinical viewpoint is that mice receiving treatment with Ad-MULTE/FasTI showed more apoptosis in vivo, formed smaller tumors, and survived longer.

NK cell function is regulated by a balance between activating and inhibiting receptor signals (Trinchieri, 1989; Diefenbach and Raulet, 2001). Several types of inhibitory NK cell receptors recognize MHC class I molecules on target cells and prevent NK cell cytotoxicity toward normal cells (Yokoyama et al., 1995). The expression of ligands for activating receptor on target cells tips the balance toward activation of NK cells and induces NK cell cytotoxicity by formation of NK cell lytic synapse. NK cell cytotoxicity involves the secretion of cytolytic effector molecules known as lytic granules. The induction of NK cell effector functions, such as cytotoxicity, requires the contact between the NK cell and its target cell. The events that occur following the interaction between a cytolytic cell and its target cell, and the formation of the NK cell lytic synapse can be divided into three main stages: 1) initiation stage, 2) effector stage, and 3) termination stage. Initiation stage includes adhesion and initial signaling for cell activation. Effector stage involves actin reorganization, receptor clustering, raft formation, polarization of the microtubule-organizing centre (MTOC) and lytic granule fusion with the plasma membrane. Termination stage includes a period of inactivity and detachment.

Fas receptor activation can occur through different mechanisms. Binding of homotrimers of FasL to Fas can homotrimerize Fas receptor (Papoff et al., 1999; Siegel et al., 2000). A death domain-independent oligomerization domain in the extracellular region of the Fas, mapping to the N-terminal 49 amino acids, can also mediate homo- and heterooligomerization of the death receptor (Papoff et al., 1999). Apoptosis can be triggered in the absence of FasL by overexpression of the Fas cytoplasmic domain or Fas lacking the N-terminal 42 amino acids (Papoff et al., 1999), suggesting that the extracellular oligomerization domain of Fas is not required to initiate signaling and that self-association of the death domain is necessary and sufficient to induce cell death. The intracellular death domains of death receptors show a high tendency to self-associate, and when overexpressed by gene transfer in eukaryotic cells, trigger apoptotic signaling (Boldin et al., 1996). These findings indicate that the Fas receptor plays an active role in its own clustering and that its oligomerization can be achieved in the absence of FasL.

We hypothesize that, when NKG2D expressing cells such as NK cells come in contact with TC-1 cells expressing the MULT1E/FasTI fusion protein, an NK cell lytic synapse would be formed as a result of the receptor-ligand interaction between NK cells and fusion protein expressing target cells. At this NK cell lytic synapse, activated NKG2D receptors bind to MULT1 ligands, cluster together and form lipid rafts. Formation of lipid rafts consisting of receptor-ligand complexes would result in activation of NK cells and NK cell cytotoxicity with the release of lytic granules consisting of granzymes and IFN-γ at the immunological synapse. Binding of NKG2D to the MULT1E region of the fusion protein causes clustering of the fusion protein, and through death domain interactions would trigger formation of microaggregates resulting in larger clusters of FasTI, formation of DISC, caspase-8 activation and apoptosis in cell. Hence, our fusion protein approach is a two pronged approach for activating NK cells as well as inducing apoptosis, when the fusion protein binds to NKG2D receptors. Even though we do not have evidence of the formation of lytic synapses with NK cells and DISC formation in fusion protein expressing cells, our IFN-γ assay using NK cells and caspase-3 ELISA assay confirm the functionality of both MULT1E and FasTI regions in our fusion protein and the dual role of MULT1E/FasTI.

In summary, a bi-functional chimeric protein containing the extracellular domain of MULT1 and the transmembrane and intracellular domains of Fas is created. It may provide a potential avenue for new cancer therapies and supports further investigation of therapeutic strategies using other NKG2D ligands combined with Fas transmembrane and intracellular domains for treating cancer. When combined with adenovirus gene delivery vectors, especially the oncolytic adenovirus vectors, the fusion protein will provide a robust anti-cancer agent.

References

  1. 1. Bacon L. et al. (2004 Two human. U. L. B. P. R. A. E. T. molecules with. transmembrane regions. are ligands. for N. K. G. 2 J Immunol, 173 1078 1084 .
  2. 2. Bahram S. Bresnahan M. Geraghty D. E. Spies T. A. 1994 Second lineage of mammalian major histocompatibility complex class I genes. Proc Natl Acad ScI USA, 91 6259 6263 .
  3. 3. Bauer S. Groh V. Wu J. Steinle A. Phillips J. H. Lanier L. L. Spies T. 1999 Activation of NK cells and T cells by NKG2D, a receptor for stress-inducible MICA. Science, 285 727 729 .
  4. 4. Bellgrau D. Gold D. Selawry H. Moore J. Franzusoff A. Duke R. C. 1995 A role for CD95 ligand in preventing graft rejection. Nature, 377 630 632 .
  5. 5. Billadeau DD, Upshaw JL, Schoon RA, Dick CJ, & Leibson PJ. (2003).NKG2D 10 triggers human NK cell-mediated killing via a Syk-independent regulatory pathway. Nat Immunol, 4 557 564 .
  6. 6. Boldin M. P. Goncharov T. M. Goltsev Y. V. Wallach D. 1996 Involvement of MACH, a novel MORT1/FADD-interacting protease, in Fas/APO-1- and TNF receptor-induced cell death. Cell, 85 803 815 .
  7. 7. Borchers M. T. Harris N. L. Wesselkamper S. C. Vitucci M. Cosman D. 2006 NKG2D ligands are expressed on stressed human airway epithelial cells. Am J Physiol Lung Cell Mol Physiol, 291 222 231 .
  8. 8. Brunner T. Wasem C. Torgler R. Cima I. Jakob S. Corazza N. 2003 Fas (CD95/Apo-1) ligand regulation in T cell homeostasis, cell-mediated cytotoxicity and immune pathology. Semin Immunol, 15 167 176 .
  9. 9. JD Bui Carayannopoulos. L. N. Lanier L. L. Yokoyama W. M. Schreiber R. D. Busche A. Goldmann T. Naumann U. Steinle A. Brandau S. 2006 Natural killer cell-mediated rejection of experimental human lung cancer by genetic overexpression of major histocompatibility complex class I chain-related gene A. Hum Gene Ther, 17 135 146 .
  10. 10. Campos SK, & Barry MA. 2007 Current advances and future challenges in adenoviral vector biology and targeting. Curr Gene Therapy, 7 189 204 .
  11. 11. Carayannopoulos LN, Naidenko OV, Fremont DH, & Yokoyama WM. 2002 Cutting edge: murine UL16-binding protein-like transcript 1: a newly described transcript encoding a high-affinity ligand for murine NKG2D. J Immunol, 169 4079 4083 .
  12. 12. Carayannopoulos L. N. Naidenko O. V. Kinder J. Ho E. L. Fremont D. H. Yokoyama W. M. 2002a Ligands for murine NKG2D display heterogeneous binding behavior. Eur J Immunol, 32 597 605 .
  13. 13. Chalupny N. J. Rein-Weston A. Dosch S. Cosman D. 2006 Down-regulation of the NKG2D ligand MICA by the human cytomegalovirus glycoprotein UL142. Biochem Biophys Res Commun, 346 175 181 .
  14. 14. Chalupny N. Sutherland C. Lawrence W. Rein-Weston A. Cosman D. 2003 ULBP4 is a novel ligand for human NKG2D. Biochem Biophys Res Commun, 305 129 135 .
  15. 15. Chan C. W. Crafton E. Fan H. N. Flook J. Yoshimura K. Skarica M. et al. 2006 Interferon-producing killer dendritic cells provide a link between innate and adaptive immunity. Nat Med, 12 207 213 .
  16. 16. Chang C. Dietrich J. Harpur A. G. Lindquist J. A. Haude A. Loke Y. W. et al. 1999 Cutting edge: KAP10, a novel transmembrane adapter protein genetically linked to DAP12 but with unique signaling properties. J Immunol, 163 4651 4654 .
  17. 17. EE Cohen Rudin C. M. O. N. Y. X-01 2001 Onyx Pharmaceuticals. Curr Opin Investig Drugs, 2 1770 1775 .
  18. 18. Colucci F. Schweighoffer E. Tomasello E. Turner M. Ortaldo J. R. Vivier E. et al. 2002 Natural cytotoxicity uncoupled from the Syk and ZAP-70 intracellular kinases. Nat Immunol, 3 288 294 .
  19. 19. Cosman D. Müllberg J. Sutherland C. L. Chin W. Armitage R. Fanslow W. Kubin M. Chalupny N. J. 2001 ULBPs, novel MHC class I-related molecules, bind to CMV glycoprotein UL16 and stimulate NK cytotoxicity through the NKG2D receptor. Immunity, 14 123 133 .
  20. 20. JD Coudert Held W. 2006 The role of the NKG2D receptor for tumor immnity. Sem Can Biol, 16 333 343 .
  21. 21. Debatin KM, Krammer PH. Death receptors in chemotherapy and cancer. Oncogene 200423 23 2950 2966 .
  22. 22. Deng T. Karin M. 1993 JunB differs from c-Jun in its DNA-binding and dimerization domains, and represses c-Jun by formation of inactive heterodimers. Genes Dev, 7 479 490 .
  23. 23. Diefenbach A. Hsia J. K. Hsiung M. Y. Raulet D. H. 2003 A novel ligand for the NKG2D receptor activates NK cells and macrophages and induces tumor immunity. Eur J Immunol, 33 381 391 .
  24. 24. Diefenbach A. Jamieson A. M. Liu S. D. Shastri N. Raulet D. H. 2000 Ligands for the murine NKG2D receptor: expression by tumor cells and activation of NK cells and macrophages. Nat Immunol, 1 119 126 .
  25. 25. Diefenbach A. Raulet D. H. 2001 Strategies for target cell recognition by natural killer cells. Immunol Rev, 181 170 184 .
  26. 26. Diefenbach A. Tomasello E. Lucas M. Jamieson A. M. Hsia J. K. Vivier E. Raulet D. H. 2002a Selective associations with signaling molecules determines stimulatory versus costimulatory activity of NKG2D. Nat Immunol, 3 1142 1149 .
  27. 27. Diefenbach A. Raulet D. H. 2002b The innate immune response to tumors and its role in the induction of T cell immunity. Immunol Rev, 188 19 21 .
  28. 28. Doubrovina E. S. MM Doubrovin Vider. E. Sisson R. B. O’Reilly R. J. Dupont B. et al. 2003 Evasion from NK cell immunity by MHC class I chain-related molecules expressing colon adenocarcinoma. J Immunol, 171 6891 6899 .
  29. 29. Draghi M. et al. 2007 NKp46 and NKG2D recognition of infected dendritic cells is necessary for NK cell activation in the human response to influenza infection. J Immunol, 178 2688 2698 .
  30. 30. Eagle R. A. Trowsdale J. 2007 Promiscuity and the single receptor: NKG2D. Nat Rev Immunol, 7 737 744 .
  31. 31. Earnshaw WC, Martins LM, & Kaufmann SH. 1999 Mammalian caspases: structure, activation, substrates, and functions during apoptosis. Annu Rev Biochem, 68 383 424 .
  32. 32. Elsasser-Beile U. Gierschner D. Welchner T. Wetterauer U. 2003 Different expression of Fas and Fas ligand in tumor infiltrating and peripheral lymphocytes of patients with renal cell carcinomas. Anticancer Res, 23 433 437 .
  33. 33. MA Friese Wischhusen. J. Wick W. Weiler M. Eisele G. Steinle A. et al. 2004 RNA interference targeting transforming growth factor-beta enhances NKG2D-mediated antiglioma immune response, inhibits glioma cell migration and invasiveness, and abrogates tumorigenicity in vivo. Cancer Res, 64 7596 7603 .
  34. 34. Fulda S. Kufer M. U. Meyer E. van Valen F. Dockhorn-Dworniczak B. Debatin K. M. 2001 Sensitization for death receptor or drug-induced apoptosis by re-expression of caspase-8 through demethylation or gene transfer. Oncogene, 20 5865 5877 .
  35. 35. Garnett C. T. Erdman D. Xu W. Gooding L. R. 2002 Prevalence and quantitation of species C adenovirus DNA in human mucosal lymphocytes. J Virol, 76 10608 10616 .
  36. 36. Garrity D. ME Call Feng. J. Wucherpfennig K. W. 2005 The activating NKG2D receptor assembles in the membrane with two signaling dimers into a hexameric structure. Proc Natl Acad Sci USA, 102 7641 7646 .
  37. 37. Gasser S. Orsulic S. Brown E. J. Raulet D. H. 2005 The DNA damage pathway regulates innate immune system ligands of the NKG2D receptor. Nature, 436 1186 1190 .
  38. 38. Girardi M. Oppenheim D. E. Steele C. R. Lewis J. M. Glusac E. Filler R. et al. 2001 Regulation of cutaneous malignancy by gammadelta T cells. Science, 294 605 609 .
  39. 39. Glienke J. Sobanov Y. Brostjan C. Steffens C. Nguyen C. Lehrach H. et al. 1998 The genomic organization of NKG2C, E, F, and D receptor genes in the human natural killer gene complex. Immunogenetics, 48 163 173 .
  40. 40. Gomes EM, & Tong AW. 2006 Anti-Tumor Properties of CD40 Ligand when Delivered as a Transgene by the Conditional Replicative Oncolytic Adenovirus AdEH to Breast Cancer Cells. PhD disseetation. Baylor University.
  41. 41. Griffith T. S. Brunner T. Fletcher S. M. Green D. R. Ferguson T. A. 1995 Fas ligand-induced apoptosis as a mechanism of immune privilege. Science, 270 1189 1192 .
  42. 42. Groh V. Bahram S. Bauer S. Herman A. Beauchamp M. Spies T. 1996 Cell stress-regulated human major histocompatibility complex class I gene expressed in gastrointestinal epithelium. Proc Natl Acad Sci USA, 93 12445 12450 .
  43. 43. Groh V. Rhinehart R. Randolph-Habecker J. MS Topp Riddell. S. R. Spies T. 2001 Costimulation of CD8 alphabeta T cells by NKG2D via engagement by MIC induced on virus-infected cells. Nat Immunol, 2 255 260 .
  44. 44. Groh V. Rhinehart R. Secrist H. Bauer S. Grabstein K. H. Spies T. 1999 Broad tumor-associated expression and recognition by tumor-derived gamma delta T cells of MICA and MICB. Proc Natl Acad Sci USA, 96 6879 6884 .
  45. 45. Groh V. Steinle A. Bauer S. Spies T. 1998 Recognition of stress-induced MHC molecules by intestinal epithelial gammadelta T cells. Science, 279 1737 1740 .
  46. 46. Groh V. Wu J. Yee C. Spies T. 2002 Tumor-derived soluble MIC ligands impair expression of NKG2D and T-cell activation. Nature, 419 734 738 .
  47. 47. Gumperz J. E. Miyake S. Yamamura T. Brenner M. B. 2002 Functionally distinct subsets of CD1d-restricted natural killer T cells revealed by CD1d tetramer staining. J Exp Med, 195 625 636 .
  48. 48. Hanahan D. Weinberg R. A. 2000 The hallmarks of cancer. Cell, 100 57 70 .
  49. 49. Hayakawa Y. Kelly J. M. Westwood J. Darcy P. K. Diefenbach A. Raulet D. H. MJ Smyth 2002 Tumor rejection mediated by NKG2D receptor-ligand interaction is strictly dependent on perforin. J Immunol, 169 5377 5381 .
  50. 50. Ho E. L. Heusel J. W. Brown M. G. Matsumoto K. AA Scalzo Yokoyama W. M. 1998 Murine Nkg2d and Cd94 are clustered within the natural killer complex and are expressed independently in natural killer cells. Proc Natl Acad Sci USA, 95 6320 6325 .
  51. 51. Hohenberger P. Tunn P. U. 2003 Isolated limb perfusion with rhTNFalpha and melphalan for locally recurrent childhood synovial sarcoma of the limb. J Pediatr Hematol Oncol, 25 905 909 .
  52. 52. Houston A. O’ Connell. J. 2004 The Fas signalling pathway and its role in the pathogenesis of cancer. Cur Opinion Phar, 4 321 326 .
  53. 53. Houston A. Waldron-Lynch F. D. Bennett M. W. Roche D. O’Sullivan G. C. Shanahan F. O’Connell J. 2003 Fas ligand expressed in colon cancer is not associated with increased apoptosis of tumor cells in vivo. Int J Cancer, 107 209 214 .
  54. 54. Hue S. et al. 2004 A direct role for NKG2D/MICA interaction in villous atrophy during celiac disease. Immunity, 21 367 377 .
  55. 55. Igney FH, & Krammer PH. 2002 Death and anti-death: tumour resistance to apoptosis. Nat Rev Cancer, 2 277 288 .
  56. 56. Irmler M. Thome M. Hahne M. Schneider P. Hofmann K. Steiner V. Bodmer J. L. Schroter M. Burns K. Mattmann C. et al. 1997 Inhibition of death receptor signals by cellular FLIP. Nature, 388 190 195 .
  57. 57. Ivanov V. N. Bergami P. L. Maulit G. Sato T. A. Sassoon D. Ronai Z. 2003 FAP-1 association with Fas (Apo-1) inhibits Fas expression on the cell surface. Mol Cell Biol, 23 3623 3635 .
  58. 58. Jamieson A. M. Diefenbach A. Mc Mahon C. W. Xiong N. Carlyle J. R. Raulet D. H. 2002 The role of the NKG2D immunoreceptor in immune cell activation and natural killing. Immunity, 17 19 29 .
  59. 59. Jan Chalupny. N. Sutherland C. L. Lawrence W. A. Rein-Weston A. 2003 Cosman D. ULBP4 is a novel ligand for human NKG2D. Biochem Biophys Res Commun, 305 129 135 .
  60. 60. Jinushi M. Takehara T. Tatsumi T. Kanto T. Groh V. Spies T. et al. 2003 Expression and role of MICA and MICB in human hepatocellular carcinomas and their regulation by retinoic acid. Int J Cancer, 104 354 361 .
  61. 61. Kase H. Aoki Y. Tanaka K. 2003 Fas ligand expression in cervical adenocarcinoma. Relevance to lymph node metastasis and tumor progression. Gynecol Oncol, 90 70 74 .
  62. 62. Khakoo S. I. R. Rajalingam B. P. Shum K. Weidenbach L. Flodin D. G. Muir F. Canavez S. L. Cooper N. M. Valiante L. L. Lanier Parham P. 2000 Rapid evolution of NK cell receptor systems demonstrated by comparison of chimpanzees and humans. Immunity, 12 687 694 .
  63. 63. Kischkel F. C. Hellbardt S. Behrmann I. Germer M. Pawlita M. Krammer P. H. ME Peter 1995 Cytotoxicity-dependent APO-1 (Fas/CD95)-associated proteins form a death-inducing signaling complex (DISC) with the receptor. EMBO J, 14 5579 5588 .
  64. 64. Klein J. Y. Satta C. O’Huigin Takahata N. 1993 The molecular descent of the major histocompatibility complex. Annu Rev Immunol, 11 269 276 .
  65. 65. Komatsu-Wakui M. et al. 1999 MICA polymorphism in Japanese and a MICA-MICB null haplotype. Immunogenetics, 49 620 628 .
  66. 66. Kotturi H. S. R. Li J. Branham-O” Connor. M. Stickel S. L. Yu X. Wagner T. E. Wei Y. 2008 Tumor cells expressing a fusion protein of MULT1 and Fas are rejected in vivo by apoptosis and NK cell activation. Gene Ther, 15 1302 1310 .
  67. 67. Kotturi H. S. R. Li J. Branham-O’Connor M. Yu X. Wagner T. E. Wei Y. 2010 In vitro and in vivo delivery of a novel anticancer fusion protein MULT1E/FasTI via adenoviral vectors. Can Gene Ther, 17 164 170 .
  68. 68. Krmpotic A. Busch D. H. Bubic I. Gebhardt F. Hengel H. Hasan M. AA Scalzo Koszinowski. U. H. Jonjic S. 2002 MCMV glycoprotein gp40 confers virus resistance to CD8+ T cells and NK cells in vivo. Nat Immunol, 3 529 535 .
  69. 69. Lanier L. L. Corliss B. C. Wu J. Leong C. Phillips J. H. 1998 Immunoreceptor DAP12 bearing a tyrosine-based activation motif is involved in activating NK cells. Nature, 391 703 707 .
  70. 70. Lee JC, Lee KM, Kim DW, & Heo DS. 2004 Elevated TGF β1 secretion and down-modulation of NKG2D underlies impaired NK cytotoxicity in cancer patients. J Immunol, 172 7335 7340 .
  71. 71. Li P. Morris D. L. Willcox B. E. Steinle A. Spies T. Strong R. K. 2001 Complex structure of the activating immunoreceptor NKG2D and its MHC class I-like ligand MICA. Nat Immunol, 2 443 451 .
  72. 72. Lodoen MB, & Lanier LL. 2006 Natural killer cells as an initial defense against pathogens. Curr Opin Immunol, 18 391 398 .
  73. 73. Lowin-Kropf B. Kunz B. Schneider P. Held W. 2002 A role for the src family kinase Fyn in NK cell activation and the formation of the repertoire of Ly49 receptors. Eur J Immunol, 32 773 782 .
  74. 74. Ma Liu H. Liu Y. Kung S. Sun H. F. Zheng X. et D. al 2005 Recombinant adeno-associated virus-mediated TRAIL gene therapy suppresses liver metastatic tumours. Int J Cancer, 116 314 321 .
  75. 75. Maasho K. Opoku-Anane J. Marusina A. I. Coligan J. E. Borrego F. 2005 NKG2D is a costimulatory receptor for human naive CD8+ T cells. J Immunol, 174 4480 4484 .
  76. 76. Mashima T. Tsuruo T. 2005 Defects of the apoptotic pathway as therapeutic target against cancer. Drug Resist Updat, 8 339 343 .
  77. 77. Mc Farland B. J. Kortemme T. Yu S. F. Baker D. Strong R. K. 2003 Symmetry recognizing asymmetry: analysis of the interactions between the C-type lectin-like immunoreceptor NKG2D andMHCclass I-like ligands. Structure, 11 411 422 .
  78. 78. Mollinedo F. Gajate C. 1997 Fas/CD95 death receptor and lipid rafts: New targets for apoptosis-directed cancer therapy. Drug Res Upda 2006; 9 51 73 .
  79. 79. Nagata S. Apoptosis by death factor. Cell, 88 88 355 365 .
  80. 80. Nedvetzki S. et al. 2007 Reciprocal regulation of natural killer cells and macrophages associated with distinct immune synapses. Blood, 109 3776 3785 .
  81. 81. Nesterov A. Ivashchenko Y. AS Kraft 2002 Tumor necrosis factorrelated apoptosis-inducing ligand (TRAIL) triggers apoptosis in normal prostate epithelial cells. Oncogene, 21 1135 1140 .
  82. 82. Niehans G. A. Brunner T. Frizelle S. P. Liston J. C. Salerno C. T. Knapp D. J. et al. 1997 Human lung carcinomas express Fas ligand. Cancer Res, 57 1007 1012 .
  83. 83. Nomura M. et al. 1996 Genomic structures and characterization of Rae1 family members encoding GPI-anchored cell surface proteins and expressed predominantly in embryonic mouse brain. J Biochem, 120 987 995 .
  84. 84. CA O’Callaghan Cerwenka. A. Willcox B. E. Lanier L. L. Bjorkman P. J. 2001 Molecular competition for NKG2D: H60 and RAE1 compete unequally for NKG2D with dominance of H60. Immunity, 15 201 211 .
  85. 85. O’Connell J. O’Sullivan G. C. Collins J. K. Shanahan F. 1996 The Fas counterattack. Fas-mediated T cell killing by colon cancer cells expressing Fas ligand. J Exp Med, 184 1075 1082 .
  86. 86. Ogasawara J. Watanabe-Fukunaga R. Adachi M. Matsuzawa A. Kasugai T. Kitamura Y. Itoh N. Suda T. Nagata S. 1993 Lethal effect of the anti-Fas antibody in mice. Nature, 364 806 809 .
  87. 87. Ogasawara K. Benjamin J. Takaki R. Phillips J. H. Lanier L. L. et al. 2003 Impairment of NK cell function by NKG2D modulation in NOD mice. Immunity, 18 41 51 .
  88. 88. Okada K. Komuta K. Hashimoto S. Matsuzaki S. Kanematsu T. Koji T. 2000 Frequency of apoptosis of tumor-infiltrating lymphocytes induced by Fas counterattack in human colorectal carcinoma and its correlation with prognosis. Clin Cancer Res, 6 3560 3564 .
  89. 89. Palmer D. H. Mautner V. Mirza D. Oliff S. Gerritsen W. van der Sijp J. R. M. et al. 2004 Virus-directed enzyme prodrug therapy: intratumoral administration of a replication-deficient adenovirus encoding nitroreductase to patients with resectable liver cancer. J Clin Oncol, 22 1546 1552 .
  90. 90. Papoff G. Hausler P. Eramo A. Pagano M. G. Di Leve G. Signore A. Ruberti G. 1999 Identification and characterization of a ligandindependent oligomerization domain in the extracellular region of the CD95 death receptor. J Biol Chem, 274 38241 38250 .
  91. 91. Pappworth I. Y. Wang E. C. Rowe M. 2007 The switch from latent to productive infection in Epstein-Barr virus-infected B cells is associated with sensitization to NK cell killing. J Virol, 81 474 482 .
  92. 92. Pende D. Rivera P. Marcenaro S. Chang C. C. Biassoni R. Conte R. et al. 2002 Major histocompatibility complex class I-related chain A and UL16- binding protein expression on tumor cell lines of different histotypes: analysis of tumor susceptibility to NKG2D-dependent natural killer cell cytotoxicity. Cancer Res, 62 6178 6186 .
  93. 93. Peter ME, & Krammer PH. 2003 The CD95(APO-1/Fas) DISC and beyond. Cell Death Differ, 10 26 35 .
  94. 94. ME Peter Scaffidi. C. Medema J. P. Kischkel F. Krammer P. H. 1999 The death receptors. Results Problem. Cell Differ, 23 25 63 .
  95. 95. Pitti R. M. Marsters S. A. Lawrence D. A. Roy M. Kischkel F. C. Dowd P. et al. 1998 Genomic amplification of a decoy receptor for Fas ligand in lung and colon cancer. Nature, 396 699 703 .
  96. 96. Poggi A. Venturino C. Catellani S. Clavio M. Miglino M. Gobbi M. et al. 2004 Vδ1 T lymphocytes from B‑CLL patients recognize ULBP3 expressed on leukemic B cells and up‑regulated by trans-retinoic acid. Cancer Res, 64 9172 9179 .
  97. 97. Rabinovich B. Li J. Wolfson M. Lawrence W. Beers C. Chalupny J. et al. 2006 NKG2D splice variants: a reexamination of adaptor molecule associations. Immunogenetics, 58 81 88 .
  98. 98. Radaev S. Kattah M. Zou Z. Colonna M. Sun P. D. 2002 Making sense of the diverse ligand recognition by NKG2D. J Immunol, 169 6279 6285 .
  99. 99. Radosavljevic M. Cuillerier B. MJ Wilson Clement. O. Wicker S. Gilfillan S. et al. 2002 A cluster of ten novel MHC class I related genes on human chromosome 6q24.2-q25.3. Genomics, 79 114 123 .
  100. 100. Raffaghello L. Prigione I. Airoldi I. Camoriano M. Levreri I. Gambini C. et al. 2004 Downregulation and/or release of NKG2D ligands as immune evasion strategy of human neuroblastoma. Neoplasia, 6 558 568 .
  101. 101. Raffaghello L. Prigione I. Airoldi I. Camoriano M. Morandi F. Bocca P. et al. 2005 Mechanisms of immune evasion of human neuroblastoma. Cancer Lett, 228 155 161 .
  102. 102. Raulet DH, Vance RE, & McMahon CW. 2001 Regulation of the natural killer cell receptor repertoire. Annu Rev Immunol, 19 291 330 .
  103. 103. Raulet DH. 2003 Roles of the NKG2D immunoreceptor and its ligands. Nature Rev Immunol, 3 781 790 .
  104. 104. Ries S. Korn W. M. 2002 ONYX-015: mechanisms of action and clinical potential of a replication-selective adenovirus. Br J Cancer, 86 5 11 .
  105. 105. Roberts A. I. Lee L. Schwarz E. Groh V. Spies T. Ebert E. C. et al. 2001 NKG2D receptors induced by IL-15 costimulate CD28-negative effector CTL in the tissue microenvironment. J Immunol, 167 5527 5530 .
  106. 106. Rosen D. B. Araki M. Hamerman J. A. Chen T. Yamamura T. Lanier L. L. 2004 A Structural basis for the association of DAP12 with mouse, but not human, NKG2D. J Immunol, 173 2470 2478 .
  107. 107. Saas P. Walker P. R. Hahne M. Quiquerez A. L. Schnuriger V. Perrin G. French L. Van Meir E. G. de Tribolet N. Tschopp J. et al. 1997 Fas ligand expression by astrocytoma in vivo: maintaining immune privilege in the brain? J Clin Invest, 99 1173 1178 .
  108. 108. Salvesen GS, & Dixit VM. 1999 Caspase activation: the induced-proximity model. Proc Natl Acad Sci USA, 96 10964 10967 .
  109. 109. Sangro B. Mazzolini G. Ruiz J. Herraiz M. Quiroga J. Herrero I. et al. 2004 Phase I trial of intratumoral injection of an adenovirus encoding interleukin-12 for advanced digestive tumours. J Clin Oncol, 22 1389 1397 .
  110. 110. Scaffidi C. Medema J. P. Krammer P. H. ME Peter 1997 FLICE is predominantly expressed as two functionally active isoforms, caspase-8/a and caspase-8/b. J Biol Chem, 272 26953 26958 .
  111. 111. Schulze-Osthoff K. Ferrari D. Los M. Wesselborg S. ME Peter 1998 Apoptosis signaling by death receptors. Eur J Biochem, 254 439 459 .
  112. 112. Shankar S. Srivastava R. K. 2004 Enhancement of therapeutic potential of TRAIL by cancer therapy and irradiation: mechanisms and clinical implications. Drug Resist Updat, 7 139 156 .
  113. 113. Siegel RM, Chan FK, Chun HJ, & Lenardo MJ. 2000 The multifaceted role of Fas signaling in immune cell homeostasis and autoimmunity. Nat Immunol, 1 469 474 .
  114. 114. MJ Smyth Hayakawa. Y. Takeda K. Yagita H. 2002 New aspects of natural killer cell surveillance and therapy of cancer. Nature Reviews Cancer, 2 850 851 .
  115. 115. Smyth MJ et al. 2005 NKG2D function protects the host from tumor initiation. J Exp Med, 202 583 588 .
  116. 116. Taieb J. Chaput N. Menard C. Apetoh L. Ullrich E. Bonmort M. et al. 2006 A novel dendritic cell subset involved in tumor immunosurveillance. Nat Med 12 214 219 .
  117. 117. Takaki R. Hayakawa Y. Nelson A. Sivakumar P. V. Hughes S. MJ Smyth et. al 2005 Tumor cells to specific lysis by natural killer cells. Clin Cancer Res, 11 7516 7552 .
  118. 118. Tong AW. 2006 Oncolytic viral therapy for human cancer: challenges revisited. Drug Development Research, 66 260 277 .
  119. 119. Tourneur L. Mistou S. Michiels F. M. Devauchelle V. Renia L. Feunteun J. Chiocchia G. 2003 Loss of FADD protein expression results in a biased Fas-signaling pathway and correlates with the development of tumoral status in thyroid follicular cells. Oncogene, 22 2795 2804 .
  120. 120. Trinchieri G. 1989 Biology of natural killer cells. Adv Immunol, 47 187 376 .
  121. 121. Upshaw JL, Arneson LN, Schoon RA, Dick CJ, Billadeau DD, & Leibson PJ. 2006 NKG2D-mediated signaling requires aDAP10-bound Grb2-Vav1 intermediate and phosphatidylinositol-3-kinase in human natural killer cells. Nat Immunol, 7 524 532 .
  122. 122. Venkataraman G. M. Suciu D. Groh V. Boss J. M. Spies T. 2007 Promoter region architecture and transcriptional regulation of the genes for the MHC class Irelated chain A and B ligands of NKG2D. J Immunol, 178 961 969 .
  123. 123. Vetter C. S. Lieb W. Brocker E. B. Becker J. C. 2004 Loss of nonclassical MHC molecules MIC-A/B expression during progression of uveal melanoma. Br J Cancer, 91 1495 1499 .
  124. 124. Wiemann K. Mittrucker H. W. Feger U. Welte S. A. Yokoyama W. M. Spies T. et al. 2005 Systemic NKG2D down-regulation impairs NK and CD8 T cell responses in vivo. J Immunol, 175 720 729 .
  125. 125. Wolan D. W. Teyton L. Rudolph M. G. Villmow B. Bauer S. Busch D. H. et al. 2001 Crystal structure of the murine NK cell-activating receptor NKG2D at 1.95 A. Nat Immunol, 2 248 254 .
  126. 126. Wu J. Song Y. Bakker A. B. Bauer S. Spies T. Lanier L. L. et al. 1999 An activating immunoreceptor complex formed by NKG2D and DAP10. Science, 285 730 732 .
  127. 127. Yokoyama W. M. Daniels B. F. Seaman W. E. Hunziker R. Margulies D. H. Smith H. R. et al. 1995 A family of murine NK cell receptors specific for target cell MHC class I molecules. Semin Immunol, 7 89 101 .
  128. 128. Young L. S. Searle P. F. Onion D. Mautner V. 2006 Viral gene therapy strategies: from basic science to clinical application. J Pathol, 208 299 318 .
  129. 129. Zhang T. BA Lemoi Sentman C. L. 2005 Chimeric NK-receptor-bearing T cells mediate antitumor immunotherapy. Blood, 106 1544 1551 .
  130. 130. Zheng HC, Sun JM, Wei ZL, Yang XF, Zhang YC, 2003 Xin Y. Expression of Fas ligand and caspase-3 contributes to formation of immune escape in gastric cancer. World J Gastroenterol, 9 1415 1420 .
  131. 131. Zhou H. Luo Y. Lo J. F. Kaplan C. D. Mizutani M. Mizutani N. et al. 2005 DNA-based vaccines activate innate and adaptive antitumor immunity by engaging the NKG2D receptor. Proc Natl Acad Sci USA, 102 10846 10851 .
  132. 132. Zompi S. Hamerman J. A. Ogasawara K. Schweighoffer E. Tybulewicz V. L. Di et J. P. al N. K. G. 2 triggers cytotoxicity in mouse NK cells lacking DAP12 or Syk family kinases. Nat Immunol 2003; 4 565 572 .

Written By

Yanzhang Wei, Jinhua Li and Hari Shankar R. Kotturi

Submitted: October 20th, 2010 Published: August 23rd, 2011