Open access peer-reviewed chapter
By Jean Bernard Lekana-Douki and Larson Boundenga
Submitted: October 10th 2017Reviewed: March 19th 2018Published: November 5th 2018
DOI: 10.5772/intechopen.76601
Downloaded: 800
Malaria is one the world’s most widespread lethal diseases. Plasmodium falciparum, P. vivax, P. ovale, P. malariae and P. knowlesi induce human pathology. These species could be differentially diagnosed using the genotyping of cytochrome b, Pfdhfr and RNA 18S. The persistence of P. falciparum, the most lethal parasite, is mainly due to antimalarial drug resistance. Indeed, a few years after the start of the ambitious malaria eradication program in 1960, chloroquine resistance emerged in Asia and spread widely in all the endemic areas. It was associated with genotypes in P. falciparum chloroquine resistance transporter (CVIET, SVMNT, CVMNT, CVIDT, SVIET and CVMET). The use of new drugs such as sulfadoxine-pyrimethamine (SP) leads quickly to SP-resistant parasites associated with genotypes on P. falciparum DiHydroFolate reductase (I51-R59-N108-I164) and P. falciparum DiHydroPteroate synthetase (436-437-580-613). Recently, the delay of parasite clearance has been described with artemisinine (the most efficacious antimalarial drug). This resistance was associated with the K13 propeller genotype. Since malaria species and antimalarial drug resistance markers could be characterized using nucleic acid sequences, genotyping is needed for malarial monitoring of species distribution and antimalarial drug resistance.
Malaria remains a major public health problem. More than 40% of the world’s population (3.3 billion) live malarial endemic areas in varying degrees. Despite tremendous efforts in the fight, and though this strategy or plan resulted in significantly decreasing the burden in the last 20 years, Malaria still is persistent in nearly 91 countries (Figure 1). In 2016, the overall incidence was 216 million cases among these and 445,000 deaths were recorded [1]. Africa continues to account for 90% of malaria burden. African children under 5 years of age are the most affected. This infectious disease is due to the invasion of Plasmodium spp. Currently, the five species are known to infect and to induce significantly malaria in humans are Plasmodium ovale, Plasmodium malariae, Plasmodium knowlesi, Plasmodium vivax and Plasmodium falciparum.
Countries endemic for malaria in 2000 and 2016. From WHO [1].
P. falciparum is the most virulent species as it is responsible for more than 90% of malaria deaths [2, 3]. Its specific biology with antigenic variation, sequestration of infected blood cells and interactions with host cells leads to severe malaria [4, 5]. Also, it is the most recent human infection with limited adaptation in the host [6]. P. knowlesi, which is a specific Asian monkey parasite (Macaca genus), was recently transferred to humans, causing high mortality in the south of Asia [7, 8, 9]. One of its differences from other species is the time of its life cycle which is 24 h whereas 40–48 h for other human Plasmodium spp. P. vivax is the most prevalent in Asia and South America. Due to the Duffy-negative statue of Black people, it is the rarest in Black Africa. However, recent studies reported the presence of P. vivax in Blacks with Duffy-negative from some countries of central Africa such as Equatorial Guinea, Congo Republic and so on [10, 11]. P. malariae is less prevalent in Asia, while it is most common in sub-Saharan Africa and southwest Pacific [12]. It often finds minor prevalence compared to P. falciparum. This parasite is thought to be a zoonotic infection because is genetically close to P. brasilianum which infects monkeys of South America [12, 13]. P. ovale is prevalent in Sub-Saharan Africa, South-East Asia, India, Papua New Guinea, Timor and Indonesia [14]. It is the less-prevalent human malarial parasite. However, in most places where P. ovale is observed, it is relatively uncommon and its prevalence rarely exceeds 5% [12].
Decisions concerning malaria treatment depend on the identification of the species causing the disease. Traditionally, this diagnosis was based on the microscopic detection of Plasmodium parasites in Giemsa-stained blood slides. In recent decades, antigen detection assays and molecular detection assays were introduced as alternatives to microscopy [15]. These approaches were very useful; however, they are not very reliable. Indeed, the morphological features and life history traits of a parasite species can vary from one host species to another [16, 17]. For antigen detection assays are mainly aimed at the identification of P. falciparum. Indeed [18], only a few assays are able to identify infections caused by other human malaria parasites [15, 19]. However, the development of molecular tools for the identification of species in diagnosis and genotyping permits a better reading of plasmodial diversity circulating among the human population and allows best highlighting the phenomenon of resistance of Plasmodium than microscopic tools.
Plasmodium species like several other genera have specific genetic markers such as 18S rRNA, ITS, cytochrome b and so on, used in studying speciation. These markers play an important role in molecular analysis of genotyping and monitoring antimalarial drug resistance. The persistence of malaria burden is partly due to the emerging and widespread nature of the antimalarial drug resistance. Indeed, in the 1950s, WHO launched the malaria eradication program, with chloroquine and dichloro-diphenyl-trichloroethan (DDT). But in the early 1960s, chloroquine resistance emerged [20, 21]. Antimalarial drug resistance is defined as the parasite’s ability to survive after the absorption of drug doses is greater than patient-tolerated doses. This chapter described the methods of genotyping the malaria for species diagnosis that helps to monitor drug resistance.
The genotyping of Plasmodium spp. infections allows for the characterization of distinct species and subpopulations present in hosts. The genotyping techniques presented in the following allow for the characterization of different Plasmodium species by sizing the polymerase chain reaction (PCR) product of the polymorphic marker gene merozoite surface protein.
rRNA is one of the ribosome components. Among rRNA, the 18S rRNA gene is the most frequently cited marker for malaria detection. It is composed of highly conserved regions which can be targeted for a qualitative detection of Plasmodium spp. and of variable zones allowing species identification. Early in the 1990s, Snounou and colleagues reported high-sensitivity methods for the detection of plasmodium species using nested PCR [22]. This method was based on the conversion of 18S rRNA among human plasmodium and the specificity of 18S rRNA from each parasite. So, the method includes the first PCR with primers named rPLU1/5 and rPLU3/4 that match with human plasmodium. This step is followed by the amplification of the product of primary PCR separately with the four species-specific primer pairs: rFAL1 and rFAL2, rVIV1 and rVIV2, rMAL1 and rMAL2 and rOVA1 and rOVA2 to identify the species P. falciparum, P. vivax, P. malariae and P. ovale, respectively. The primary PCR with rPLU1/5 and rPLU3/4 gives a 1100 bp band in a 2% agarose gel electrophoresis (Figure 2), in the presence of Plasmodium.
Specificity and sensitivity of the PCR detection assay. (a) Nested PCR amplification for the demonstration of the specificity of the primers employed. Control genomic DNA from P. falciparum (F), P. vivax (V), P. malariae (M), P. ovale (O) and human blood (H); (b) nested PCR assay for the detection of in vitro cultured P. falciparum ring-stage parasites; (c) nested PCR amplification using diluted control DNAs; (d) product of amplification of diluted control DNAs, using the PCR assay (Source: Snounou et al. [22]).
The nested PCR rFAL1 and rFAL2 generate a 205 bp in presence of the P. falciparum parasite. The nested PCR rVIV1 and rVIV2 generate a 120 bp in presence of the P. vivax parasite. The nested PCR rMAL1 and rMAL2 generate a 144 bp in presence of the P. malaria parasite. The nested PCR rOVA1 and rOVA2 generate an 800 bp in presence of the P. ovale parasite [22, 23].
Nucleic acid sequence-based amplification (NASBA) is a method in molecular biology, which is used to amplify RNA sequences. This novel approach of genotyping, based on the amplification of nucleic acid sequence (real-time QT-NASBA), was developed by Compton [24]. Immediately after its discovery, the NASBA method was used for the rapid diagnosis and quantification of HIV-1 in patients [25]. Some years later, Schooner et al. [26] developed a real-time quantitative nucleic acid sequence-based amplification (real time QT-NASBA) for the detection of Plasmodium falciparum 18S rRNA with a sensitivity of 10–50 parasites/ml [26, 27]. Thus, NASBA method that uses primers and probes were selected on the basis of the sequence of the small subunit 18S rRNA gene [26, 28], to characterize or identify the different human Plasmodium species [18]. For NASBA, Schooner et al. have defined primers Plas-1F (59-TCAGATACCGTCGTAATCTTA-39) and Plas-2R T7 (59-AATTCTAATACGACTCACTATAGGGAGAGAACTTTCTCGCTTGCGCGAA-39) which were used [26]. The RNAs from P. falciparum, P. malariae, P. vivax and P. ovale are specifics and they should all be amplified by the NASBA isolates with these primers. Therefore, detection is done by capture probe (59-ACCATAAACTATG CCGACTAGG-39) which is bound to magnetic beads. Finally, samples are hybridized separately to ruthenium-labeled WT (59-CCTTATGAGAAATCAAAGTC 39) and Q (59-AATAACTGCACCAGTGTATA-39) detection probes, followed by ECL detection in a NucliSens ECL reader [26, 29]. The NASBA method is very sensitive and specific. It can be used for the detection, identification and quantitative measurement of low parasitaemia of Plasmodium species, that is, the lower detection limit of the assay is 100–1000 molecules in vitro RNA for all human malaria parasites.
Cytochrome b (Cyt-b) is one of the respiratory chain systems present in mitochondria. It is highly conserved in Plasmodium species. But some of its region shows diversities and species specificities. It is also in multiple copies (20–100 copies) in the haploid genome, suggesting the increase of sensitivity. So, the alignment of Cyt-b sequences obtained after amplification by the nested PCR portion of mitochondrial DNA using couples of primers (Table 1) allows distinguishing the Plasmodium species present in the host (Figure 3).
Amplification primers of the cytochrome b gene (Cyt-b). Cyt-b is amplified by nested PCR.
The tree of relationship of Plasmodium species. This tree was built with a portion of Cyt-b sequences characterized among some patients and other Cyt-b sequences from Genbank (accession numbers AB489194, EU880499, GU723548 and GU723532). The tree was built using maximum likelihood with Cyt-b sequences of 925pb sizes.
The first round of PCR (PCR1) and use of the primers DW2/F and DW4/R produce the fragments of 1253 bp. In the second round of PCR (PCR2), primers Cyt-b1F and Cyt-b2R are used and this generates PCR fragments of 939 bp [30]. This approach was used more for the characterization of malaria parasites in primates (human and non-human) [31, 32] because it allows to identify all species known or unknown circulating in vertebrates [33].
Due to the specie specificity and diversity of Cytochrome b, it could be digested with the restriction enzyme Alu I leading to species-specific patterns [34]. In this case, a nested PCR is used. Primers Plas 1 (5′-GAGAATTATGGAGTGGATGGTG-3′) and Plas 2 (5′-GTGGTAATTGACATCCWATCC-3′) are used for primary PCR producing an 816 bp fragment, following by a nested with Plas 3 and Plas 4 primers. The n-PCR produces a 787 bp fragment. The digestion with Alu I gives 159 and 640 bp fragments; 187, 249 and 381 bp fragments; 111, 169, 187, 249 and 270 bp; and 224 and 584 bp fragments for P. falciparum, P. malariae, P. vivax and P. ovale, respectively, on agarose gel electrophoresis (Figure 4).
Illustration of a digestion cytochrome fragment using Alu enzyme.
Figure 5 shows the equation of transformation of dihydrofolate to tetrahydrofolate. The dihdrofolate reductase is one of the important malaria proteins involved in the plasmodium folate synthesis. This gene is coded in chromosome 4 and is highly conserved between distantly related species, like plasmodium species. Its linker region revealed significantly a higher sequence diversity than the relatively conserved enzymatic diversity. Different species of Plasmodium are characterized by a unique linker sequence. So, it has been used to identify human plasmodium species [35]. Nonsynonymous mutations on DHFR are associated with pyrimethanime resistance. Using primers ATGGARSAMSTYTSMGABGTWTTYGA and AAATATTGRTAYTCTGGRTG for primary PCR gives a 1000 bp fragment. The nested PCR species specific with primers shown in Table 2 allow to amplify specifically 160, 177, 144, 231/237/243 and 134 bp fragments for P. falciparum, P. malariae, P. vivax, P. ovale and P. knowlesi.
The equation of the DHF-THF reaction. Dihydrofolate reductase is an enzyme that catalyzes the NADPH-dependent reduction of dihydrofolate to tetrahydrofolate. This reaction is essential for the de novo synthesis of purines and certain amino acids. This enzyme is essential for rapid growth and is the target for the action of the important antimalarial drugs pyrimethamine and proguanil.
| Primer | Species | Sequence (5′–3′) | Annealing (°C) | No. of cycles | Product (bp) |
|---|---|---|---|---|---|
| Pla-DHFR-F Pla-TS-R | Plasmodium sp. | ATGGARSAMSTYTSMGABGTWTTYGA AAATATTGRTAYTCTGGRTG | 50 | 30 | 1000 |
| Pla-DHFR-NF Pla-TS-R | Plasmodium sp. | AAATGYTTYATYATWGGDGG AAATATTGRTAYTCTGGRTG | 55 | 35 | 509–587 |
| PF-Lin-F PF-Lin-R | P. falciparum | AAAAGGAGAAGAAAAAAATAA AAAATAAACAAAATCATC | 50 | 35 | 160 |
| PM-Lin-F PM-Lin-R | P. malariae | GACCCAAGAATCCCTCCC CCCATGAAGTTATATTCC | 50 | 35 | 177 |
| PV-Lin-F PV-Lin-R | P. vivax | CGGGAGCACTGCGGACAGCG CACGGGCACGCGGCGGGGC | 55 | 35 | 144 |
| PO-Lin-F PO-Lin-R | P. ovale | GACACACAAAATGATGGGGA ATTGTCCTTTCCTTGACTCG | 55 | 35 | 231, 237 or 243 |
| PK-Lin-F PK-Lin-R | P. knowlesi | CGATGGATATGGATAGTGG CGCGGGAGAGCATTTCCTC | 58 | 35 | 134 |
Primer sequences and the PCR condition for detection of Plasmodium spp. that infect humans.
Antimalarial drug resistance is the ability of P. falciparum to survive after absorption of the drug at concentrations greater than concentrations tolerated by the patient. Drug resistance arises rarely because it is the result of some non-lethal mutations, but it spreads relatively quickly. The clinical failure treatment is the lasted event in the long way of changes in parasites genes. Antimalarial drug resistance markers are genes associated with antimalarial drug resistance. Among them, the most characterized are Pfcrt (P. falciparum chloroquine resistance transporter), Pfmdr1 (P. falciparum multidrug resistance 1), Pfdhfr (P. falciparum dihydrofolate reductase), Pfdhps (P. falciparum dihydropteroate synthase), Pfmrp (P. falciparum multidrug resistance protein), Pfatpase 6 (P. falciparum atpase 6) and PfK13 (P. falciparum kelch 13).
Pfcrt is an ATP binding cassette (ABC) protein, able to fixe and hydrolyze ATP. The general structure of the ABC transporter contains cytosolic nucleotide binding domains (NBDs), a nucleotide hydrolysis site and transmembrane segments. These transporters extrude effective drugs from the digestive vacuole and function as an efflux pump leading to the decrease of intracellular accumulation of drugs in the parasite. The genetic cross-experiment between chloroquine-sensitive and chloroquine-resistance strains allowed the identification of P. falciparum chloroquine-resistance transporter (Pfcrt) in 2000 [20, 36]. It is a 45 kDa protein coding in chromosome 7, containing 10 predicted transmembrane domains located on the membrane of the digestive vacuole (Figure 6).
The predicted structure and representative haplotypes of P. falciparum chloroquine-resistance transporter. PfCRT is predicted to have 10 transmembrane domains, with its N and C terminals located on the cytoplasmic side of the digestive vacuole membrane. Mutations identified in the Pfcrt cDNA sequences from CQR lines (black circles), the crucial K76T mutation common to all CQR strains (red) and the S163R mutation identified in the amantadine- and halofantrine-resistant parasites (yellow circle) are indicated (this figure was pulled in [40]).
Several mutations have been identified in this transporter. The main mutation T76 allows for the abolition of accumulation of the drug chloroquine in the digestive vacuole. The association of mutations in codons 72, 73, 74, 75 and 76 defined different haplotypes. These haplotypes show a spatio-temporal specificity. CVMNK is the wild-type haplotype that is found in chloroquine-sensitive parasites. In Africa, the most prevalent chloroquine-resistance haplotype is the CVIET. It was also found with less prevalence in South America and in Southeast of Asia. Another Pfcrt resistance haplotype, named South American haplotype, is the SVMNT. That is rarely found in Africa and Asia, has relatively little fitness cost and was associated with the emergence of amodiaquine resistance too [37, 38]. The other main Pfcrt-resistance haplotypes were CVMNT, CVMET, SVIET and CVIDT. CVMNT is most prevalent in South America and in Asia but rarely found in Africa [39, 40]. CVMET is the rarest haplotype found in Asia whereas SVIET is the South American haplotype. CVIDT is the specific haplotype from Asia. Haplotypes CVIET and SVMNT were also associated with the plasmodial resistance against amodiaquine and lumefantrine [41]. In our recent study from Gabon and Congo we found new haplotypes. But the involvement of these in antimalarial resistance is needed yet (unpublished yet). The withdrawal of chloroquine has led to the decrease of the T76 genotype. Furthermore, recent data showed that the use of artemisinine-based combination therapies, mainly artemether-lumefantrine, selected the wild-type K76 genotype. Other polymorphisms in Pfcrt were described including A144F, I194T, A220S, Q271E and N326S [40].
For the genotype haplotype 72–76 of Pfcrt, PCR sequencing and PCR-RFLP are used. That is based on nested PCR with several primers (Table 3). The RFLP pattern indicates a specific genotype for each codon.
| Genes, codons | Primer names | Primers | T°C | Restriction enzyme | Sizes (bp)* |
|---|---|---|---|---|---|
| Pfcrt, C72S | CRT72MS | TTTATATTTTAAGTATTATTTATTTAAGTGGA | 55 | Mbo I | 55 + 38 |
| 76-D2 | CAAAACTATAGTTACCAATTTTG | ||||
| Pfcrt, M74I | CRT745MS | TAAGTATTATTTATTTAAGTGTATGTGTCAT | 55 | Nla III | 53 + 31 |
| 76-D2 | CAAAACTATAGTTACCAATTTTG | ||||
| Pfcrt, N75M | CRT745MS | TAAGTATTATTTATTTAAGTGTATGTGTCAT | 50 | BspHI | 53 + 31 |
| 76-D2 | CAAAACTATAGTTACCAATTTTG | ||||
| Pfcrt, 76 | Pfcrt-76A | GCGCGCGCATGGCTCACGTTTAGGTGGAG | 55 | Apo I | 136 + 56 |
| Pfcrt-76B | GGGCCCGGCGGATGTTACAAAACTATAGTTACC |
Sequences of primer sets and restriction enzymes used to characterize polymorphisms.
Sizes* indicate the sizes of fragments generated after restriction enzyme digestions. T°C= hybridization temperature during PCR program.
P. falciparum multidrug resistance 1 is a homologous of the bacterial multidrug resistance 1 protein. It is one of the main antimalarial drug resistance markers. Like Pfcrt, Pfmdr1 is also an ABC transporter, located in the membrane of a digestive vacuole, coded in chromosome 5 by the 4758 bp gene. Its structure shows two homologous parts containing six transmembrane domains plus a nucleotide binding domain (Figure 7).
Genetic polymorphisms in P. falciparum multidrug resistance-1. PfMDR1 has two homologous halves, each with six predicted transmembrane domains and a nucleotide-binding pocket. The nucleotide-binding domains (NBD1 and NBD2; orange boxes) are each formed by large cytoplasmic domains. Polymorphic amino acids found in the K1 allele (N86Y) and the 7G8 allele (Y184F, S1034C, N1042D and D1246Y) are indicated. The D1246Y mutation is located in the predicted NBD2 (this figure was pulled, from Ref. [40]).
Some isolates exhibit multicopies of Pfmdr1. Polymorphisms in codons 82, 184, 1034, 1042 and 1246 (N86Y, Y184F, S1034C, N1042D and D1246Y) were associated with antimalarial resistance against mefloquine, lumefantrine, artemether, halofantrine, quinine and chloroquine [36, 42]. Copy number and polymorphisms of the pfmdr1 gene have been investigated as molecular markers of mefloquine resistance. With the treatment of artemether-lumefantrine, a selection of N86 genotype was reported [43]. That was confirmed in areas where this ACT was implemented [44]. In same way, it was shown that ACT led to the selection of haplotypes NFD, NYD in codons 86, 184, 1246.
To the genotype Pfmdr1, followed primers and restriction enzymes are used for PCR-RFLP or for PCR followed by sequencing gene. Digestion of PCR products gives fragments of 126 and 165 bp for mutant 86Y whereas wild type N86 is not digested by restriction enzyme Afl III. In codon 1246, wild-type D1246 is digested by restriction enzyme Bgl II, giving fragments of 113 and 90 bp, whereas the mutant is not digested (Table 4). For codon 184, the genotype is assessed using the PCR followed by sequencing.
| Genes, Codons | Primer names | Primers | T°C | Restriction enzyme | Sizes (bp)* |
|---|---|---|---|---|---|
| Pfmdr1, N86Y | mdr86D1 | TTTACCGTTTAAATGTTTACCTGC | 45 | Afl III | 126 + 165 |
| mdr86D2 | CCATCTTGATAAAAAACACTTCTT | ||||
| Pfmdr1, D1246Y | mdr1246D1 | AATGTAAATGAATTTTCAAACC | 45 | Bgl II | 113 + 90 |
| mdr1246D2 | CATCTTCTCTTCCAAATTTGATA |
Sequences of primer sets and restriction enzymes used to characterize Pfmdr1 polymorphisms.
Sizes* indicate the sizes of fragments generated after restriction enzyme digestions. T°C = hybridization temperature during PCR program.
P. falciparum dihydrofolate reductase is mainly involved in the synthesis of the thymidine base. This enzyme is the target of pyrimethamine which blocked the synthesis of DNA and lead to the death of the parasite. After implementation of this drug, isolates with resistance against it were described. This parasite carried the mutations in the Pfdhfr gene. Among these, the mutation of serine to asparagine in codon 108 is the main resistance mutation. Additional mutations in codons 16, 51, 59 and 164 contribute to the increase of the resistance level of the parasite against pyrimethamine. The double mutant 108N + 51I and 108N + 59R increased the IC50 of parasites from 2 to 16 times, compared to the simple mutant N108 [45, 46]. In this way the triple mutant 51I + 59R + 108N or 59R + 108N + 164R shows the highest resistance level compared to the double mutant. Quadruple mutants exhibit a higher level of resistance compared to the triple mutant [47]. In Africa, the AIRNI haplotype is the most prevalent. PCR-RFLP was developed to genotype Pfdhr codons associated with pyrimethamine resistance. For these, primers and restriction enzyme are contained in Table 5..
Primer sets and RFLP conditions to genotypes PfDHFR and PfDHPS.
P. falciparum dihydropteroate synthase (Pfdhps) is one of the enzymes involved in the line of thymidine synthesis. It transforms pteridine to dihydropteroate in the presence of pABA. It is coded by the gene located in chromosome 8 of P. falciparum. The implementation of sulfadoxine to treat malaria led to P. falciparum isolates’ resistance against this drug. Genotype analysis reported the association of Pfdhps mutations with sulfadoxine resistance [48]. So, mutations S436A, A437G, K540E, G581A and A613S were reported [49]. The mutation A437G increased the IC50 of isolates by five times [50]. Isolates with triple mutations S436A + A437G + K540E and S436A + A437G + A613S showed the level of sulfadoxine resistance around 9–24 times higher than the single mutant.
Triple mutant I51R59N108 in Pfdhfr and double mutants G437E540 and G437S581S in Pfdhps increase the risk of failure when treated with sulfadoxine-pyrimethamine [51]. The drug resistance against sulfadoxine and pyrimethamine could be monitored by genotyping Pfdhfr and Pfdhps according to the PCR-RFLP conditions shown in Table 5.
The sarcoplasmic/endoplasmic reticulum Ca2+-ATPase, ortholog of P. falciparum (PfSERCA or PfATPase6), is an active Ca2+ protein transporter. This is a part of P-type ATPases enzymes that transport ions across biological membranes with the energy provided by the ATP hydrolysis. Several P-type ATPases, that were reported in P. falciparum and Pfserca, correspond to type 6. The gene coding this protein is located in chromosome 1 and contains 3687 bp. The protein allows the trafficking of calcium though the sarcoplasmic-endoplasmic membrane. Several polymorphisms such as S769N, Y243H, K431E, G110A, A2694T or E623A were reported in PfATPase 6.
PfATPase 6 has been associated with antimalarial drug resistance [52]. The most important paper on this protein was the report of its involvement in artemisinin resistance [53]. But, the role of PfATPase 6 in artemisinin resistance was strongly disputed. S769 N was associated with artemether resistance in French Guinea [53]. However, several articles investigating PfATAPase 6 in artemisinin drug resistance failed to confirm this point [54, 55, 56]. Genotyping using PCR followed by sequencing is usually used to monitor antimalarial drug resistance. Primers used are previously described by Tahar et al. [57].
P. falciparum multidrug resistance protein is another marker of antimalarial drug resistance. It belongs to the C subfamily of ABC transporters containing two NBDs, two membrane-spanning domains and six transmembrane domains. Pfmrp can transport glutathione, glucuronate, as well as glucuronide and sulfate-conjugated compounds that increased susceptibility to several antimalarial drugs like chloroquine, quinine or artemisinin [58]. Pfmrp1 and Pfmrp2 are expressed in the plasma membrane in all asexual stages of the parasite. Their expression is upregulated by mefloquine and chloroquine. Pfmrp1 is a 215 kDa protein coding on chromosome 1. Mutations on codons H191Y and S437A were associated with quinoline resistance [59]. But no association was found between these polymorphisms and resistance against pyronaridine [60]. The hypothetic mechanism of involving of Pfmrp on antimalarial drug resistance is the pump efflux mechanism associated with the extrusion of glutathione. The genotyping of Pfmrp 1 and Pfmrp2 is achieved using PCR followed by sequencing. The primers used for amplification and sequencing are pfmrp-501F 5′-TTT CAA AGT ATT CAG TGG GT-3′ and pfmrp-1409R 5’-GGC ATA ATA ATT GAT GTA AA-3′.
Chinese populations used Artemisia annua to treat malaria for a long time. Over the years, artemisinin was extracted from this plant. That is a sesquiterpene lactone. Now, artemisinin is one of the best antimalarial drugs. So, WHO recommends the use of this drug in association with other antimalarial drugs, artemisinin combination therapy (ACT) for the treatment of uncomplicated malaria. Since the 1990s, the use of artemisinin was highly intensified in Asia. Consequently, the delay of P. falciparum clearance was reported after treatment with artemisinin which translates to artemisinin resistance [56]. These slow clearance rates are associated with enhanced survival rates of ring-stage parasites briefly exposed in vitro to dihydroartemisinin. Recently, a large-scale study identified molecular markers of this resistance: polymorphisms on propeller kelch 13 (K13) [61]. That is a region on chromosome 13 (Figure 8) [62].
P. falciparum kelch13 (K13) protein. The parasite K13 protein consists of plasmodium-specific sequences, a BTB-POZ domain and six kelch domains that are predicted to form a six-blade propeller. In the structural model, the original M476I mutation discovered by Ariey et al. [61] and six other mutations associated with artemisinin resistance (all details of this figure was pulled of Fairhurst and Dondrop [62]) are shown.
Several investigations on K13 genotyping reported that mutations M476I, Y493H, R539T, I543T, P553L and C580Y conferred a greater artemisinin resistance [63]. Other mutations F446I and A578S were described in PfK13. A578S, widespread in Africa, is not associated with artemisinin resistance. These genotypes are investigated by PCR sequencing.
Due to the nucleotide specificities of each Plasmodium species and the molecular changes associated with antimalarial drug resistance, genotyping is used for Plasmodium species diagnosis and monitoring antimalarial drug resistance. This genotyping could be achieved by specific PCR, PCR-RFLP, PCR-sequencing or RT-PCR of some molecular markers.
800total chapter downloads
Login to your personal dashboard for more detailed statistics on your publications.
Access personal reportingBy Imran Shahid, Munjed Mahmoud Ibrahim, Muhammad Usman Nawaz, Mohammad Tarque Imam and Waleed H. AlMalki
We are IntechOpen, the world's leading publisher of Open Access books. Built by scientists, for scientists. Our readership spans scientists, professors, researchers, librarians, and students, as well as business professionals. We share our knowledge and peer-reveiwed research papers with libraries, scientific and engineering societies, and also work with corporate R&D departments and government entities.
More About Us