Open access peer-reviewed chapter

Potential of Thermotolerant Ethanologenic Yeasts Isolated from ASEAN Countries and Their Application in High- Temperature Fermentation

By Tomoyuki Kosaka, Noppon Lertwattanasakul, Nadchanok Rodrussamee, Mochamad Nurcholis, Ngo Thi Phuong Dung, Chansom Keo-Oudone, Masayuki Murata, Peter Götz, Constantinos Theodoropoulos, Suprayogi, Jaya Mahar Maligan, Savitree Limtong and Mamoru Yamada

Submitted: March 21st 2018Reviewed: May 28th 2018Published: November 5th 2018

DOI: 10.5772/intechopen.79144

Downloaded: 682


Thermotolerant ethanologenic yeasts receive attention as alternative bio-ethanol producers to traditionally used yeast, Saccharomyces cerevisiae. Their utilization is expected to provide several benefits for bio-ethanol production due to their characteristics and robustness. They have been isolated from a wide variety of environments in a number of ASEAN countries: Thailand, Vietnam, Laos, and Indonesia. One of these yeasts, Kluyveromyces marxianus has been investigated regarding characteristics. Some strains efficiently utilize xylose, which is a main component of the 2nd generation biomass. In addition, the genetic basis of K. marxianus has been revealed by genomic sequencing and is exploited for further improvement of the strains by thermal adaptation or gene engineering techniques. Moreover, the glucose repression of K. marxianus and its mechanisms has been investigated. Results suggest that K. marxianus is an alternative to S. cerevisiae in next-generation bio-ethanol production industry. Indeed, we have succeeded to apply K. marxianus for bio-ethanol production in a newly developed process, which combines high-temperature fermentation with simultaneous fermentation and distillation under low pressure. This chapter aims to provide valuable information on thermotolerant ethanologenic yeasts and their application, which may direct the economic bioproduction of ethanol and other useful materials in the future.


  • thermotolerant yeast
  • high-temperature fermentation
  • genomic aspects

1. Introduction

Worldwide economic growth with the related increase in CO2 emissions from fossil fuels causes global warming. Utilization of renewable energy with low CO2 emission therefore has been getting increased attention. Renewable energy is generated from renewable natural resources, such as sunlight, wind, rain, tides, waves, geothermal heat, as well as biomass. One such important source of renewable energy, bio-ethanol, has been highlighted due to the characteristics of its production from biomass, which is generated by plants using sunlight for CO2 fixation, resulting in carbon neutrality. Bio-ethanol is the name for ethanol produced from biomass by fermentation. This bio-process is thoroughly researched and well-established, and to-date, it produces the most prominent and cost-effective biofuel [1]. Although bio-ethanol production is increasing worldwide and the production of biofuels including ethanol in 2022 is forecasted to be more than 126 billion L [2], biofuels are still more costly than fossil fuels [3]. Therefore, several industrial companies and researchers aim to develop new technologies, enabling the cost-effective production of bio-ethanol from biomass. Since microorganisms are essential for material production through bio-processing, their characteristics and traits are crucial for the production process efficiency. Ethanologenic yeast, Saccharomyces cerevisiae, has been traditionally and widely utilized for the production of alcoholic beverages and bio-ethanol [4, 5]. Industrially common problems in bio-ethanol production related to S. cerevisiaestrains are temperature level (35–45°C) and high ethanol concentration (over 20%) [6]. These two factors inhibit yeast proliferation and fermentation activity if they reach the upper limit. In addition, for cost-effective bio-ethanol production, the production source must be changed from 1st generation biomass (sugarcane, corn, and wheat, which are important food sources) to 2nd generation biomass (lignocellulosic biomass or woody crops, which are agricultural residues or waste) [7]. Lignocellulosic biomass is composed of hemicellulose, cellulose, and lignin, and the first consists of six (e.g., glucose) and five (e.g., xylose) carbon sugars. However, the low efficiency of ethanol production by S. cerevisiaefrom lignocellulosic biomass hydrolyzates is mainly due to its little ethanol productivity from xylose [8]. Although the S. cerevisiaegenome encodes all components necessary for xylose utilization, most of them are rarely expressed [9]. In addition, S. cerevisiaepreferably utilizes glucose while repressing the uptake and catabolism of alternate carbon sources by a mechanism such as glucose repression [10]. This results in the reduction of ethanol production rates from several kinds of biomass. For economically feasible bioethanol production from lignocellulosic biomass, the efficient co-fermentation of glucose and other sugars is also necessary. Therefore, genetic engineering of S. cerevisiaestrains has been extensively performed, and metabolically engineered strains were developed [11], which have showed higher stress tolerance and/or improved xylose utilization [12, 13]. However, the utilization of genetically recombinant strains in industry has been very limited, especially due to the instability of the desirable phenotype and the necessary confinement to a closed system to prevent their leakage into the environment, which can eventually endanger public health or biodiversity. Therefore, the development of new feasible strains for next-generation bio-ethanol production is under way, and new yeast strains have been isolated that may have advantages compared to S. cerevisiae.

Recently, thermotolerant microorganisms were found among mesophiles with optimum growth temperatures that are 5–10°C higher than those of the typical mesophilic strains belonging to the same genus or even to the same species [14]. These thermotolerant mesophiles are mainly and widely distributed in foods, plants, soils, and waters from tropical environments in ASEAN countries [15]. In these environments, relatively high temperature presumably becomes a selective pressure to enrich thermotolerant strains. These thermotolerant strains are expected to provide a benefit for the industries because they are more robust and resistant to many stressors [14]. In addition, some of these thermotolerant microorganisms can produce distinctive enzymes that function under relatively high temperature conditions [16, 17, 18]. Thermotolerant yeasts have been found and isolated from a number of countries [19, 20, 21, 22, 23, 24, 25, 26, 27, 28]. Of these, K. marxianusis a haploid, homothallic, thermotolerant, and hemiascomycetous yeast [29, 30]. One such yeast, K. marxianusDMKU 3-1042 isolated in Thailand, shows relatively high ethanol productivity and fermentation ability at high temperatures [31], assimilates various sugars including xylose and/or arabinose [32], and exhibits relatively weak glucose repression on utilization of some sugars including sucrose [33]. Therefore, K. marxianusis, in comparison to S. cerevisiae,a promising candidate for next-generation bio-ethanol production. In addition, the genomic sequences of K. marxianusare available [34, 35], and genetic technology and tools have also been developed [36]. Moreover, K. marxianushas been a platform for next-generation protein production for structural and biochemical studies [18, 29]. However, it is possible that unidentified and more beneficial thermotolerant yeasts exist in ASEAN countries, especially, thermotolerant high xylose-utilizing and ethanol-producing yeasts, which are needed for 2nd generation biomass utilization. None of the isolated K. marxianusstrains, however, are able to more efficiently convert xylose to ethanol than strains of other xylose-utilizing yeasts, such as Pichia stipitis(Scheffersomyces stipitis) [32, 37].

Thermotolerant strains allow the development of high-temperature fermentation (HTF) technology, which enables fermentation at 5–10°C higher than the traditional fermentative process [38, 39]. HTF is thus expected to reduce cooling costs, running costs at the simultaneous saccharification and fermentation (SSF) stage, and contamination risks [6, 31, 38, 39, 40], therefore offering a promising technology for bio-ethanol production. Moreover, thermotolerant yeast can also be applied for temperature-uncontrolled fermentation, hence offering another economical advantage. A combination of efficient bioreactors and robust hosts, such as thermotolerant strains, leads to lowest energy consumption and emission of CO2 in biofuel production [41].

In this chapter, we outline a number of thermotolerant yeasts including K. marxianusspecies isolated in Thailand and their characteristics, including utilization of various sugars, glucose repression, and genetic information, that are beneficial for high-temperature fermentation. In addition, new strains of thermotolerant yeasts that have been isolated in Indonesia, Vietnam, and Laos are summarized. Subsequently, the trial results of HTF with some of these strains for ethanol production are presented.


2. Various ethanologenic thermotolerant yeasts and their characteristics

Increasing global energy demand that exceeds the finite supply of fossil fuel has spurred scientific research to deliver alternative fuels. Microbial fermentation and efficient conversion technologies now allow the extraction of biofuels from biomass, such as wood, crops, and waste materials. Supplies of ethanol have increased tremendously and are expected to continue rising rapidly in both developed and developing countries [41]. A variety of feedstocks from the 1st, 2nd, and 3rd generation have been used in bioethanol production [42]. First-generation bioethanol involves feedstocks rich in sucrose (sugar cane juice, molasses, and sweet sorghum) and starch (corn, wheat, cassava, and potato). Second-generation bioethanol comes from lignocellulosic biomass such as wood, straw, and other agricultural wastes. Third-generation bioethanol is derived from algal biomass including microalgae and macroalgae [43, 44]. The process of ethanol production depends on the types of feedstocks used. Generally, there are three major steps in ethanol production: decomposition of biomass, fermentation, and product recovery. During fermentation, the cooling of fermenters is one of the major energy consuming steps because the metabolism of yeast releases a large amount of heat. Therefore, the application of thermotolerant yeasts can significantly reduce the cooling cost and help prevent contamination [38]. High-temperature ethanol fermentation will also benefit a simultaneous saccharification and fermentation process.

Many thermotolerant yeasts have been isolated from various natural habitats and tested for their capability to produce ethanol at high temperatures (Table 1). Many strains of K. marxianus, Pichia kudriavzevii, and S. cerevisiaewere often isolated as ethanol-producing yeasts at high temperatures. Of these, K. marxianuswas found to be the most thermotolerant yeast. Limtong et al. [31] isolated K. marxianusDMKU 3-1042 in Thailand and found optimum ethanol production at 40°C. The strain was compared with other K. marxianusstrains including NCYC587, NCYC1429, and NCYC2791 and found to be the best ethanol producer at 45°C [36]. Kumar et al. [45] isolated Kluyveromycessp. IIPE453 from a soil sample in a sugar mill, which showed high ethanol production rate at 45–50°C. Yanase et al. [46] reported that K. marxianusNBRC1777 efficiently produced ethanol corresponding to 92.9% of the theoretical yield. K. marxianusDBKKUY-103, that was recently isolated, achieved the maximum ethanol concentration of 83.5 g/L, corresponding to 96.6% of the theoretical yield [47]. Nitiyon et al. [37] reported that K. marxianusBUNL-21 is a highly competent yeast for high-temperature ethanol fermentation with lignocellulosic biomass. When compared with the strain DMKU 3-1042, the strain BUNL-21 had stronger ability for conversion of xylose to ethanol and tolerance to various stresses including high temperature and hydrogen peroxide.

Yeast strainTemp. (°C)P (g/L)Qp(g/L/h)T.Y (%)Refs.
Kluyveromyces marxianus
DMKU 3-10424067.81.1360.4[31]
Pichia kudriavzevii
DMKU 3-ET154078.63.2885.4[20]
Saccharomyces cerevisiae

Table 1.

Thermotolerant yeasts used in bioethanol production.


P, ethanol concentration; Qp, volumetric ethanol productivity; T.Y, fraction of theoretical yield; nd, no data.

Recently, there have been several reports on ethanol production at high temperatures using P. kudriavzevii(formerly known as I. orientalis). Several P. kudriavzeviistrains were reported to grow and produce high levels of ethanol at high temperatures. The strain DMKU 3-ET15 was isolated from traditional fermented pork sausage in Thailand by an enrichment technique in a medium supplemented with 4% ethanol at 40°C. The strain produced 78.6 g/L ethanol from 180 g/L glucose at 40°C [20]. The strain KVMP10 that was isolated from soil located beneath apple trees for ethanol production from orange peel achieved 54 g/L ethanol at 42°C [48]. Strain RZ8-1 that was recently isolated from various samples collected from plant orchards in Thailand produced 33.8 g/L ethanol from 160 g/L glucose at 40°C [49].

Several S. cerevisiaestrains were also isolated for high-temperature ethanol fermentation. Sree et al. [50] reported a strain VS3 that could grow at 40°C and produced ethanol up to 60 g/L. Auesukaree et al. [51] reported a strain C3867 that produced 38.8 g/L of ethanol at 41°C. Recently, Nuanpeng et al. [52] and Techaparin et al. [53] isolated S. cerevisiaeDBKKUY-53 and KKU-VN8, respectively, in Thailand. The former strain produced the maximum ethanol concentration and volumetric ethanol productivity of 85.0 g/L and 2.83 g/L h, respectively, at 40°C, and the latter strain produced the maximum ethanol concentration of 89.3 g/L with a productivity of 2.48 g/L h and a theoretical ethanol yield of 96.3% from sweet sorghum juice at 40°C.

Table 1 shows a number of ethanologenic thermotolerant yeasts. A temperature of 40°C was found to be the best condition for most strains to produce ethanol.

3. Utilization of various sugars in thermotolerant yeasts

Bioethanol significantly contributes to the reduction of crude oil consumption and environmental pollution. Thus, it has been identified as the mostly used biofuel worldwide [42]. Feedstocks for biofuel currently seem to be the option for sustainable development in the context of economical and environmental considerations. There are various types of feedstocks for ethanol production [54], and accordingly, different processes including biomass pretreatment are required. Feedstock rich in sugar that mainly contains sucrose is readily fermented to ethanol. Feedstock rich in starch must first be hydrolyzed to glucose monomers by the action of enzymes [55]. Lignocellulosic and algal biomass needs further pretreatment and hydrolysis before liberating simple sugars, which can be readily converted to ethanol by microorganisms [56, 57, 58]. The resulting hydrolysates of these raw materials contain various sugars depending on the type of biomass [59]. In case of algal biomass, the sugar composition varies largely, based not only on algal species but also on their environmental and nutritional conditions [43, 56]. Lignocellulosic biomass is a complex mixture of carbohydrate polymers, and the biomass hydrolysate mainly contains hexoses (D-galactose, L-galactose, and D-mannose) and pentoses (D-xylose and L-arabinose) [60]. Glucose and xylose are the most abundant monosaccharides in this biomass taking up 60–70% and 30–40% of the total hydrolysate, respectively [61, 62]. Predominant pentose sugars derived from the hemicellulose of most feedstocks are xylose and arabinose. Like in higher plants, algae biomass is comprised of rigid cellulose-based cell walls and various complex polysaccharides, which can be hydrolyzed to sugars and subsequently fermented to ethanol [43, 63]. However, algae biomass contains a low percentage of lignin and hemicellulose compared to other lignocellulosic plants [64].

Microorganisms are the key factor in the conversion of sugars to ethanol. One of their several desired characteristics is thermotolerance. Ethanol production at high temperatures by thermotolerant yeasts has earned much interest due to several advantages as described above [38]. There are several ethanologenic yeasts that have been characterized and classified as thermotolerant yeasts such as K. marxianus[31, 37, 47], P. kudriavzevii(formally known as I. orientalis) [20, 48, 49, 65, 66], Hansenula polymorpha[67], and some strains of S. cerevisiae[21, 52, 68, 69, 70]. However, for cost-effective and efficient ethanol production, not only thermotolerance but also a broad spectrum in sugar assimilation and fermentation capability is beneficial for the conversion of a variety of raw materials containing various sugars to ethanol, especially xylose, which is the most common pentose sugar and the second most abundant after glucose in lignocellulosic biomass and algal biomass [71, 72].

S. cerevisiaeis commonly employed in ethanol production due to its high ethanol productivity and high ethanol tolerance [73]. It is capable of converting different types of sugars, such as glucose, mannose, galactose, fructose, sucrose, and maltose to ethanol via the glycolysis pathway under anaerobic conditions [55]. Unfortunately, it is not able to ferment other carbon sources from plant or algal hydrolysates such as D-xylose, L-arabinose, and L-rhamnose [59]. A few types of yeasts can ferment both glucose and xylose but their performance regarding the rate of ethanol production from xylose, and the yield is lower than those from the main hexose sugars (for example, S.(Pichia) stipitis[74], Scheffersomyces(Candida) shehatae[75], Pachysolen tannophilus[76], H. polymorpha[67], and K. marxianus[32, 37]). Among these xylose-fermenting yeasts, it seems that K. marxianushas the potential for practical application in high-temperature ethanol fermentation because of its thermotolerance and ability to utilize a variety of sugars.

K. marxianus’s most important characteristics in this respect are thermotolerance to temperatures between 45 and 52°C, efficient ethanol production at temperatures between 38°C and 45°C, and a rapid growth rate that is twice as high as that of S. cerevisiaein rich media. Moreover, it has a broad spectrum of sugar assimilation, which includes glucose, mannose, galactose, fructose, arabinose, xylose, xylitol, sucrose, raffinose, cellobiose, lactose, and inulin [32, 36]. However, there has been little ethanol production from xylose and none from arabinose [32]. This strain can utilize a wide variety of industrially relevant substrates and efficiently converts substrates to ethanol. Especially, with lignocellulosic raw materials, it resulted in 78–98% of the theoretical ethanol yield (Table 2).

FeedstockSubstrateOrganismTemp. (°C)P (g/L)T.Y (%)Refs.
Sugar containing materialsSugar cane juiceK. marxianusDMKU 3-10424067.860.4[31]
Jerusalem artichokeK. marxianusDBKKU-Y1024097.592[77]
Sweet sorghum juiceK. marxianusDBKKUY-1034083.5100[47]
Palm sapK. marxianusTISTR 59254045.492.2[39]
Jerusalem artichokeK. marxianusPT-14073.690[21]
Starchy materialsTaro wasteK. marxianusK214043.894.2[78]
Lignocellulosic biomassKanlow switchgrassK. marxianusIMB34522.586[79]
SwitchgrassK. marxianusIMB44516.678[80]
Solka-flocK. marxianusL. G.4237.698[81]
Rice strawK. marxianusNRRLY-68604521.586[82]

Table 2.

Ethanol production of K. marxianusfrom various substrates at high temperatures.

P, ethanol concentration; T.Y, fraction of theoretical yield.

4. Complete genome sequence of thermotolerant yeast K. marxianusDMKU 3-1042 and transcriptomic analysis

High-temperature fermentation technology with thermotolerant microbes has been expected to reduce the cost of bioconversion of biomass to fuels or chemicals. K. marxianuswas included in GRAS (FDA) and QPS (EU) lists of safe microorganisms for use in foods [83, 84]. The capacity of K. marxianusto utilize a wide variety of sugars reflects its potential for biotechnological applications [29, 84], which has been indicated by many studies with diverse substrates such as whey permeate, crop plants, and lignocellulosic biomass [32, 33, 78, 85, 86]. K. marxianusis also distinguished by its thermotolerance [36, 87] and the highest growth rate in eukaryotes [88]. In recent years, interest also increased in several new applications such as production of biomolecules [89, 90], biocatalysts [91, 92], and heterologous protein expression [93, 94].

Genomic and transcriptomic studies have started to shed light on K. marxianus, and a growing number of genome sequences of K. marxianusstrains are now available. Those include KCTC 17555 [34], DMB1 [95], CCT 7735 [96], NBRC1777 [97], DMKU 3-1042 [35], B0399 [98], UFS-Y2791 [99], and other nine strains: L01, L02, L03, L04, L05, CBS397, NBRC0272, NBRC0288, and NBRC0617 [100].

4.1. Genomic information and comparative genomics

The genome sequence of K. marxianusDMKU 3-1042 as one of the most efficient thermotolerant strains was determined, and the complete genome sequence of 11.0 Mb including all centromeric regions and boundary regions containing up to one to several sequence repeats (GGTGTACGGATTTGATTAGTTATGT) of telomeres was obtained [35]. The genome was composed of eight chromosomes in total, including mitochondrial DNA. Annotation of the genome of DMKU 3-1042 revealed a total of 4952 genes. UniProt and KAAS assignments led to the assignment of homologous genes of about 86.4% of predicted genes and KEGG Orthology numbers of 50.5% respectively.

A total of 202 tRNAs and 8 rDNAs were identified. According to the optical mapping experiment, 140 rDNA copies were observed on chromosome 5 instead of 6 rDNA copies found in the genome sequence in the database. The rDNA copy number and the thermotolerance were expected to positively relate. However, there was no such correlation among 10 K. marxianusstrains, which exhibited different growth at different temperatures, and at least 31 copies of rDNA are sufficient to support its thermotolerance [35].

The yeast shares 1552 genes with other hemiascomycetous yeasts, including K. lactis, Ashbya gossypii, Candida glabrata, S. cerevisiae, Ogataea parapolymorpha, Debaryomyces hansenii, S. stipitis, Clavispora lusitaniae, Yarrowia lipolytica,and Schizosaccharomyces pombe[101, 102, 103, 104, 105]. K. marxianuswas found to be phylogenetically closest to K. lactis. There are 193 genes specific to K. marxianus, which may be responsible for its species-specific characteristics [35]. The 422 genes shared between K. marxianusand K. lactismay be related to their genus-specific characteristics, such as production of β-galactosidase [106], assimilation of a wide variety of inexpensive substrates [84], efficient productivity of heterologous proteins [107, 108, 109], and synthesis of a killer toxin against certain ascomycetous yeasts [110, 111].

The two attractive traits of K. marxianusfor fermentation applications were the thermotolerance and pentose assimilation capability. The thermotolerant ability was also found in O. parapolymorpha, and 30 genes were found to be shared between the two thermotolerant yeasts, including genes for three siderophore-iron transporters and three vacuolar proteins. For pentose assimilation capability, there are 27 putative genes for sugar transporters in the K. marxianusgenome, and some of them (KLMA_60073, KLMA_70145 and KLMA_80101) were induced by xylose. The initial xylose catabolism after its uptake in K. marxianusis accomplished by three reactions catalyzed by enzymes, xylose reductase (XYL1), xylitol dehydrogenase (XYL2), and xylulokinase (XKS1), which are involved in the conversion of xylose to xylulose-5-phosphate as an intermediate in the pentose phosphate pathway (PPP). Genes for utilization of various other sugars and alcohol dehydrogenases were also found [35, 112, 113].

4.2. Ploidy variation in K. marxianus

K. marxianusshowed a high level of phenotypic variation. Recently, the single nucleotide polymorphisms (SNIPs) in 14 strains of K. marxianuswere analyzed [100]. On the basis of SNIP analysis and flow cytometry, it was found that the isolates included haploid, diploid, and triploid strains. All isolates from dairy environments were diploid or triploid, whereas most isolates (6 out 7 isolates) from nondairy environments were haploid.

4.3. Transcriptomic analysis

A major potential future application of K. marxianusmay be ethanol production from lignocellulosic biomass, which is an anaerobic or oxygen-limited process where both glucose and xylose may be present. Detailed transcription start site sequencing (TSS Seq) to explore the response of K. marxianusDMKU 3-1042 was reported for four different conditions: shaking condition in rich medium at 30°C (30D) or 45°C (45D), static condition in rich medium at 30°C (30DS), and shaking condition in xylose-containing rich medium at 30°C (30X) [35].

Under the 30DS condition, there were 159 and 154 significantly upregulated and downregulated genes, respectively. In brief, K. marxianusmay increase the turnover of RNAs and proteins in addition to suppression of transporters that depend on mitochondrial respiratory activity. Most genes for several oxygen-dependent biosynthetic pathways (Figure 1), such as those for heme, sterols, unsaturated fatty acids, pyrimidine, and deoxyribonucleotides [114], are crucial for the cellular metabolism under the static condition.

Figure 1.

Oxygen-related metabolism in budding yeast. Oxygen is used for the biosynthesis of unsaturated fatty acids, ergosterol, heme, pyrimidine, and deoxyribonucleotides, as well as during disulfide bond formation and fatty acid oxidation. Oxygen is also the final electron acceptor for the electron transport chain, which oxidizes reduced equivalents of nicotinamide adenine dinucleotide (NADH) and flavin adenine dinucleotide (FADH2) for the synthesis of ATP. However, ROS are produced as a by-product during some of these processes. The ROS can cause damage to DNA, proteins, and lipids.

Under the 45D condition, there were 199 and 508 significantly upregulated and downregulated genes, respectively. K. marxianusseems to drastically change metabolic pathways under the 45D condition, that is, the enhancement of PPP and the attenuation of TCA cycle after the fumarate-producing step (Figure 2). Several genes for homologous recombination and nonhomologous end joining, which function in the repair of DNA-double stranded breaks, were also upregulated. As expected, heat shock proteins and chaperones, such as Hsp26, Hsp60, Hsp78, Hsp82, Ssa3, and Cpr6, are crucial for survival at high temperatures. The thermotolerance of K. marxianusis likely achieved by systematic mechanisms consisting of various strategies. The yeast prevents reactive oxygen species (ROS) generation by minimizing mitochondrial activity and mainly acquires ATP from glycolysis rather than from TCA cycle at high temperatures.

Figure 2.

Difference of metabolism under the 45D condition from that under the 30D condition inK. marxianusDMKU 3-1042 (see more detail in Ref. [35]).

Under the 30X condition, there were 89 and 79 significantly upregulated and downregulated genes, respectively. This condition may stimulate the degradation of lipids in the peroxisome and keep a low level of amino acid synthesis, indicating the possibility that fatty acids could be a subsidiary intracellular carbon source in xylose medium (Figure 3). Similarly, Schabort et al. [99] also reported that peroxisomal fatty acid catabolism was dramatically upregulated in a defined xylose mineral medium without fatty acids, along with mechanisms to activate fatty acids and transfer products of β-oxidation to the mitochondria. It is known that K. marxianustends to suffer from cofactor imbalance in xylose medium [115, 116]. Redox balancing mechanisms between the cytoplasm and mitochondria are probably used to resolve the NADH/NADPH imbalance owing to lack of transhydrogenases [117]. In S. cerevisiae, five cytosolic-mitochondrial redox shuttles have been proposed [118]. Of these, genes for enzymes related to ethanol-acetaldehyde, citrate-oxoglutarate, and oxaloacetate-malate shuttles were relatively upregulated under the 30X condition, which were different from those found in S. cerevisiaeand S. stipitis[103, 119].

Figure 3.

Difference of metabolism under the 30X condition from that under the 30D condition inK. marxianusDMKU 3-1042 (see more detail in Ref. [35]).

TSS seq analysis revealed that the oxidative stress-response genes were highly induced under the three conditions tested, indicating that ROS is accumulated in the cytoplasm, mitochondria, and peroxisome under the 30DS and 30X conditions and in the cytoplasm and mitochondria under the 45D condition.

Moreover, K. marxianushas been exploited as a cell factory to produce valuable enzymes, showing retention of the activity in a broad temperature range [120]. The 30X condition showed high expression of INU1for inulinase, which is useful for the production of recombinant proteins [108, 109, 121]. These useful characteristics may allow simultaneous production of ethanol and valuable proteins, thus generating additional revenue from ethanol production.

In conclusion, the transcriptome analyses clarified distinctive metabolic pathways under three different growth conditions, static culture, high temperature, and xylose medium, in comparison to the control condition of a glucose medium under a shaking condition at 30°C. Interestingly, the yeast appears to overcome the issue of ROS, which tend to accumulate under all three conditions. Nicotinamide adenine dinucleotide phosphate (NADPH) synthesis from several reactions is the key for cells to cope with ROS (Figure 4).

Figure 4.

Generation and utilization of NADPH in budding yeast. A major source of cellular-reduced NADPH is thought to be produced via the oxidative branch of the pentose phosphate pathway. Oxidation of isocitrate, malate, and acetaldehyde generates NADPH. NADPH is consumed during the synthesis of amino acids and lipids. The reducing power of NADPH is also used to regenerate a variety of antioxidants and antioxidant enzymes, which protect the cell from ROS and engage in deoxyribonucleotide triphosphate (dNTP) synthesis. Abbreviations: G6P, glucose-6-phosphate; 6PGL, 6-phosphogluconolactone; 6PG, 6-phosphogluconate; Ru5P, ribulose-5-phosphate.

5. Glucose repression in thermotolerant yeast K. marxianus

Glucose repression is a general phenomenon in organisms including yeasts, by which glucose prevents the assimilation of other sugars [122, 123]. This process will disturb the fermentation of mixed sugars like hydrolysate of cellulosic biomass. As mentioned in the previous sections, K. marxianusis a well-known budding yeast, which has potential for production of bioethanol, hydrolytic enzymes, food biomass, and food additives [29, 31, 124]. K. marxianusDMKU 3-1042 is a thermotolerant yeast from Thailand and efficiently produces ethanol at high temperatures [31]. Although the strain can utilize various sugars including xylose [32, 35, 125], it has an intrinsic system of glucose repression like other microbes. In this section, we describe glucose repression in thermotolerant yeast, K. marxianus, and in conventional yeast, S. cerevisiae.

5.1. Mechanism of glucose repression in S. cerevisiae

Glucose repression in S. cerevisiaehas been well studied. Mig1 and Hxk2 play as the main regulator of glucose repression in this species [126]. The former is a C2H2 zinc finger protein [127], and the latter is a bi-functional protein acting as a hexokinase and transcriptional regulator, which is localized in both the cytoplasm and the nucleus [128, 129]. Hxk2 activity in glucose repression mechanism is influenced by the concentration of glucose. Under high concentrations of glucose, Hxk2 in the cytoplasm moves to the nucleus and, as a complex with dephosphorylated Mig1, Cyc8, and Tup1 [126], represses the transcription of several genes including respiratory and gluconeogenic genes. As a result of Hxk2 binding to Mig1, serine 311 in Mig1 is dephosphorylated, resulting in maintenance of repressive conditions [130]. On the other hand, in the presence of a low concentration or absence of glucose, Hxk2 and Mig1 remain in the cytoplasm, where neither Mig1 nor Hxk2 can repress Mig1-regulated genes [126]. In this situation, Hxk2 does not interact with Mig1 but still interacts with Snf1. No interaction between Hxk2 and Mig1 facilitates phosphorylation of serine 311 in Mig1 by the Snf1 kinase. Snf1 is phosphorylated by Sak1 and forms a complex with Snf4 and Gal8 to become activated. The Snf1 complex inhibits formation of a complex of Mig1-Hxk2-Cyc8-Tup1. In this situation, since Mig1 is also phosphorylated or inactive and absent in the nucleus, Mig1-regulated genes are de-repressed [130].

5.2. Mechanism of glucose repression in K. marxianus

K. marxianusDMKU 3-1042 exhibits almost no glucose repression on sucrose assimilation unlike S. cerevisiae[33]. To acquire glucose repression-defective strains in K. marxianus, some researchers performed spontaneous isolation on 2-deoxyglucose (2-DOG) plates or random insertion of kanMX4 [131, 132]. According to the characteristics of sugar consumption abilities, cell growth and ethanol accumulation along with cultivation time, only one of 33 isolates of 2-DOG-resistant mutants showed enhanced utilization of xylose in the presence of glucose. Further analysis revealed that this isolate had a single nucleotide mutation to cause amino acid substitution (G270S) in RAG5encoding hexokinase and exhibited very low activity of the enzyme [132]. Another technique for obtaining glucose repression-defective strains showed one group of 2-DOG-resitant mutants with intragenical insertion of KanMX4. This group also exhibits enhanced utilization of xylose in the presence of glucose, presumably due to a defect in the glucose-repression mechanism [131].

On the other hand, Zhou et al. focused on the function of Mig1 in K. marxianusand showed that the MIG1mutation increased hydrolysis of lactose [133] and production of inulinase [134]. Nevertheless, information on the function of Rag5 as a transcriptional regulator is hardly available, and thus construction of the complete disrupted mutation of RAG5and its analysis become a challenge. Thus, disrupted mutants of genes for Mig1 and Rag5 were constructed, and their characteristics were compared with those of the corresponding mutants of S. cerevisiae. MIG1and RAG5mutants exhibited more resistance to 2-DOG in YP plates containing sucrose. RAG5and HXK2mutants showed more resistant to 2-DOG than the corresponding MIG1mutants [135].

Several attractive characteristics of MIG1and RAG5mutants of K. marxianusDMKU 3-1042 were uncovered. MIG1mutants consumed almost two times faster xylose and accumulated glycerol and xylitol much more than those of the parental strain and the RAG5mutant in the liquid media YPX (containing 20 g/L of xylose) and YPDX (containing 20 g/L of glucose and 20 g/L of xylose) at 30°C. The accumulation of glycerol and xylitol may be due to accumulation of NADH. RAG5mutants exhibited very slow utilization of glucose in the liquid media of both YPD (containing 20 g/L of glucose) and YPDS (containing 20 g/L of glucose and 20 g/L of sucrose). However, with this mutant, high amounts of fructose (about 11.9 g/L in YPDS at 30°C for 96 h) were accumulated. MIG1and HXK2mutants of S. cerevisiaealso accumulated high amounts of fructose in the same medium, but after 12 h, fructose was consumed.

The fructose accumulation in RAG5mutants is probably due to the inability of this mutant to uptake fructose or the lack of kinase activity. To further analyze this phenomenon, Enzyme activitiesa and gene expression levels of inulinase and kinase in MIG1- and RAG5-disrupted mutants and the parental strain were measured (Table 3) [135]. RAG5mutants showed very high activities of inulinase, about 77 times higher than those of the parental strain, but almost no activities of hexokinase and glucokinase that are encoded by RAG5and GLK1, respectively. The inulinase activity in RAG5mutant was consistent with the gene expression level of INU1, being about 22 times higher than that of the parental strain. However, the expression level of GLK1in this mutant was higher, which was inconsistent with glucokinase activity. It is thus likely that there is a post-transcriptional regulation for glucokinase. MIG1mutants showed no significant increase in inulinase activity, but INU1transcriptional expression was eight times higher than that of the parental strain. This inconsistence may also be due to post-transcriptional regulation for inulinase. These results suggest that Mig1 and Rag5 are related to the glucose repression mechanism in K. marxianusand share some functions with Mig1 and Hxk2, respectively, in S. cerevisiae.

StrainsEnzyme activitiesaGene expression levels
Inulinase (U/mg DCW)Gluco-hexokinase (U/mg)Hexokinase (U/mg)INU1/ACT1GLK1/ACT1RAG1/ACT1
DMKU 3-1042127.381.1070.6620.0870.1360.916
MIG1 mutant160.11.4660.7740.6960.1410.266
RAG5 mutant9838.160.0070.0051.9271.4950.051
RAG1 mutant4229.230.2030.0271.2340.6060.091

Table 3.

Comparison of enzyme activities and gene expression levels in MIG1-and RAG5-disrupted mutants of K. marxianusin YPD liquid medium.

aThe data are from Ref. [135].

In conclusion, Mig1 and Rag5 in K. marxianusshare some functions with Mig1 and Hxk2, respectively, in S. cerevisiae. Mig1 and Rag5 in K. marxianusmay form a complex similar to that consisting of Mig1 and Hxk2 in S. cerevisiae.


6. Thermotolerant and ethanologenic yeasts in Vietnam

In Vietnam, ethanol is a compound in many different products from fermentation technology including alcoholic drinks and biofuel. In the national strategy with a vision to 2025 designed by the government, the technology of biofuel production in Vietnam using the various raw material resources that are abundantly available, e.g., pineapple, cassava, sugarcane, etc., will reach the advanced worldwide level. For the scheme on the development of Vietnam’s alcoholic beverages with a vision to 2025, the Mekong Delta is one of the top national areas for the improvement of such products. In addition, nowadays due to global warming, the exploration of thermotolerant yeasts for ethanol fermentation at high temperature also falls in the potential priorities in Vietnam.

6.1. Characteristics of thermotolerant and ethanologenic yeasts

Recent research studies under international programs, such as the Asian Core Program (2008–2012) and the Core-to-Core Program (2014–2018), have addressed the exploration of useful thermotolerant ethanologenic yeasts isolated from Vietnam and their applications for fermentation technology at high temperature. The diversity of yeast isolates with high capacities and stability for the controlled processing of alcoholic winemaking and ethanol production from cheap and available raw materials in the region has been studied.

A total of 712 yeast isolates were purified from many different kinds of raw material sources in the Mekong Delta, Vietnam, such as ripe fruits, flowers of fruit-tree, cocoa, fermented products, alcoholic fermentation starters, sugarcane, molasses, sawdust, agricultural by-products, and soil samples. All of these yeast isolates could grow well at 37°C and about 80, 45 and 10% of these yeasts could grow at 40, 43 and 45°C, respectively. More than 80% of yeasts were able to grow in a medium containing 9% (v/v) of ethanol, this number decreased to about 40% of yeasts growing in a medium supplemented with 12% (v/v) of ethanol. For conservation, all pure yeast isolates have been stored at −20 and −80°C in stock culture of glycerol freezing broth.

A bank collection of genetically diverse yeasts with thermotolerant ethanologenic capacity at high temperatures was developed and systemized. The full data of morphological, physiological, and biochemical characteristics, as well as the nucleotide sequencing analyses of the 88 selected yeasts, have been established. Some predominantly abundant identified species include Candida tropicalis, S. cerevisiae, P. kudriavzevii, and C. glabrata(Table 4). Besides, a number of other species was also characterized, such as Torulaspora globosa, Candida nivariensis, Pichia manshurica, C. lusitaniae, Hanseniaspora opuntiae, and Meyerozyma caribbica.

NoIsolated yeast speciesVietnamLaosIndonesia
1Blastobotrys adeninivorans2
2Candida glabrata72
3Candida manshurica2
4Candida nivariensis4
5Candida stellimalicola1
6Candida tropicalis162616
7Clavispora lusitaniae1
8Cyberlindnera rhodanensis2
9Hanseniaspora opuntiae1
10Issatchenkia orientalis1
11Kluyveromyces marxianus63
12Meyerozyma caribbica1
13Meyerozyma guilliermondii2
14Pichia kudriavzevii35471
15Pichia manshurica2
16Saccharomyces cerevisiae191
17Torulaspora globosa2
Not identified6247056

Table 4.

Isolated yeast strains from Vietnam, Laos, and Indonesia.

With the aim to pave the way for the application of useful thermotolerant ethanologenic yeasts toward industrial fermentation technology, ethanol production, and winemaking by using the selected thermotolerant yeasts, investigations at laboratory-scale and pilot-scale were performed. The optimum fermentation conditions at different temperatures (37, 40, and 43°C) were also tested in a factorial design with three factors including yeast inoculum, initial sugar concentration, and fermentation time. For wine manufacture, different kinds of fruits were employed as raw materials such as: pineapple, watermelon, dragon fruit, guava, jackfruit, rambutan, tangerine, and three-leaved wild vine. The highest ethanol concentration of the final wine product reached about 12% (v/v) and up to 7% (v/v) during the fermentation at 37 and 40°C, respectively. For ethanol production, a number of raw materials were tested including molasses, sugarcane juice, sugarcane waste, and pineapple waste hydrolysate. The highest ethanol concentration could be found at about 7% (v/v) and up to 4% (v/v) during the fermentation at 37 and 40°C, respectively.

The research findings on the diversified collection of thermotolerant ethanologenic yeasts isolated from Vietnam and the high ethanol yields as well as and fermentation efficiencies by using the selected yeast isolates indicate the promising application of such newly isolated functional thermotolerant yeasts for the controlled ethanol production at high temperatures from agricultural by-products and the winemaking manufacture from different available fruit resources in the region. Further advanced research on the expression levels of the selected genes and the metabolic pathways will be performed to explore the regulation of these genes to get maximum benefits of the superior thermotolerant yeasts for high-temperature ethanol production.

7. Thermotolerant and ethanologenic yeasts in Laos

Ethanol production in Lao PDR is generally used for human consumption and household use, rather than for small or large-scale industries. Until now, no ethanol as a substitute of energy in Lao PDR is produced in the industry. The raw material used to make ethanol for drinking is mostly sticky rice and the starter culture used for fermentation contains sticky rice and many other herbs. Drinking alcohol in Lao PDR is available in all provinces, mainly for consumers in their own province. Currently, alcoholic beverages are still very productive and the most popular products to customers are produced in the Saravan province in Meuangkhong district. High quality ethanol used for medicine, hospitals or laboratories are imported from neighboring countries.

The National Economic Research Institute under the Ministry of Planning and Investment reported that production of ethanol in 2010–2011 was increased 3.2 times compared to 2001. Lao government plans to develop other sources of renewable energy, which have been investigated by the private sector. Demonstration projects including a bio-diesel oil from Jatropha plant and biofuel (bio-gasoline and bioethanol) from Palm and Carmelina plants have been developed. In 2011, the Savannakhet sugar factory has been established by a Thai company to produce biogas and biomass energy. In 2013, a Vietnam company started a biomass power and ethanol production plant in Phouwong District, Attapeu Province.

7.1. Characteristics of thermotolerant and ethanologenic yeasts

Isolation of yeasts was first attempted from fruits, vegetables, leaves and soils in four provinces, Louang Phrabang, Xayaburi, Xiengkhouang, and Vientiane of Lao PDR. The attempt was carried out at 37°C by an enrichment culture. Samples (5–10 g) of fruits pressed in small pieces, leaves cut in small portions, and mashed soil were transferred into 100-mL Erlenmeyer flasks containing 10 mL of YPD (1% yeast extract, 2% peptone and 2% glucose) medium and incubated at 37°C for 3 days with occasional shaking. The cultures were then streaked on YPD agar plates and incubated at 37°C for 24–48 h. As a result, 43 strains were isolated, and their ethanol fermentation ability was characterized under various conditions including different sugars and different temperatures. A second isolation was attempted from similar kinds of samples described above in four provinces, Bolikhamxay, Champasak, Louang Phrabang, and Oudomxay, and 116 strains were obtained after enrichment culture as described above except that 4% ethanol was added in YPD medium. Of a total of 159 strains, 89 were identified by nucleotide sequencing of D1/D2 domains and analysis on MALDI-TOF/MS [28]. Fermentation experiments allowed to classify them into two groups: the first bears an ethanol-fermenting ability at high temperature (116 strains) and the second the converting ability of xylose to ethanol at 37°C or more (43 strains). In fermentation of ethanol, the first group can use glucose, sucrose, sugar cane juice, and molasses as carbon sources, producing a maximum of ethanol concentrations of 7.9% (w/v), 6.7% (w/v), 7.3% (w/v), and 4.0% (w/v) from 16% sugar concentration, respectively. The second group produced 1.2–1.7% (w/v) ethanol from 4% xylose at 37°C. Species identification revealed that isolates include nine species including C. tropicalis, P. kudriavzevii, and K. marxianus(Table 4).

7.2. Characteristics of newly isolated K. marxianusstrains

Out of six isolated K. marxianusstrains, BUNL-17 was found to be the most efficient ethanol producer at high temperature [28]. Comparison with DMKU 3-1042, which is one of most thermotolerant K. marxianusstrain isolates from Thailand, revealed that BUNL-17 possesses an efficient conversion activity of xylose to ethanol, resistance to 2-deoxyglucose and tolerance to various stresses including temperature, high sugar concentration, and hydrogen peroxide [37]. Compared to S. stipitisthe fermentation activity toward xylose of BUNL-21 is slightly lower at around 30°C and much higher at higher temperatures. BUNL-21 is thus a highly competent yeast for high-temperature ethanol fermentation with lignocellulosic biomass. Interestingly, the fermentation activity was shown to be significantly enhanced by over-expression of KmADH2for alcohol dehydrogenase 2 [37].

8. Thermotolerant and ethanologenic yeasts in Indonesia

Ethanol production in Indonesia is generally performed for medical, industrial processes, and beverages. Several potential biomass resources for bioethanol production in Indonesia are (1) sugar-based materials including sugar cane (molasses), (2) starch-based including root (cassava and sweet potato) and grain (corn and sorghum), and (3) lignocellulosic-based including bagasse, straw, stalk, wood waste, corn cob, and sap of several plants or trees. The main biomass used for bioethanol production in Indonesia is molasses [136] probably because Indonesia is one of the largest sugarcane producers in the world. Annual cane production in Indonesia is about 32–35 million tons with an average cane productivity of 70–85 ton/ha. Sugar production is about 2.2–2.7 million tons, including molasses with about 1.3–1.5 million tons. Molasses are mainly used for monosodium glutamate production in the ethanol industry and for export to other countries [137].

Bioethanol development for fuel in Indonesia was started from 2006. Its road map until 2010 showed production of 99.5% ethanol as a fuel grade ethanol (FGE), which can be mixed with petroleum for gasohol E10 (10% ethanol and 90% petroleum). For the first period, biomass used for bioethanol production was molasses and cassava and bioethanol supply was about 1.48 mil kL (million kiloliters) or equal to 10% of total gasoline consumption. In the period 2011–2015, bioethanol supply was estimated to increase to 2.78 mil kL or equal to 15% of total gasoline consumption. Until 2025, bioethanol supply is predicted to be 6.28 mil kL or 20% of total gasoline consumption [138]. The application of bioethanol for fuel in Indonesia is E5, and only two bioethanol filling stations are operating in two cities, Malang and Semarang [139]. However, because of some obstacles such as limitation of fuel grade ethanol market, inconsistency supply, insufficient demand, and price volatility, there is almost no fuel ethanol production since 2010 [136].

8.1. Characteristics of thermotolerant and ethanologenic yeasts

In international programs including the e-ASIA Joint Research Program, yeast strains were isolated from various samples such as soils, waters, flowers, fruits, vegetables, and fermented foods. The isolation method for thermotolerant and ethanol-producing yeast was similar to that applied in Lao PDR. The enrichment culture was carried out in YPD medium without the addition of ethanol. Most of the isolates can grow at relatively high temperatures ranging from 37 to 48°C. Of those, 52 yeast isolates grow well at 37°C on agar plates containing different types of sugar, such as glucose, xylose, and sucrose. Some can produce around 6% ethanol in a rich medium containing 16% (w/v) glucose at 40°C. These prominent characteristics are important for the development of bioethanol production in Indonesia.

Most yeast strains isolated from Indonesia are able to grow at relatively high temperatures not only in glucose medium but also in xylose and sucrose. However, their growth gradually decreases as temperature increases and is very weak at more than 45°C. Indonesian yeast isolates from fruits and fermented foods seem to be more thermotolerant than those from soils and waters. Most of the isolates grow very well at 40°C. These isolates include C. tropicalis, K. marxianusand P. kudriavzevii(Table 4).

9. High-temperature fermentation technologies with thermotolerant yeast

Currently, biofuel-aimed ethanol fermentation in industry is performed at around 30°C because the most frequently applied yeast is nonthermotolerant S. cerevisiae. In the fermentation process, the temperature in the fermenter increases close to a nonpermissible level for the yeast by metabolic and mechanical heat sources. A cooling system with a large amount of water and/or by a cooling unit is equipped for effective fermentation. The cooling cost tends to be higher in tropical countries or increases in summer time in other many countries, and the electricity problem largely affects productivity of ethanol. The HTF using a thermotolerant microbe is expected to provide several advantages. First, it can reduce the cooling cost. Second, the amount of enzyme used for saccharification can be reduced in the simultaneous saccharification and fermentation at higher temperature. Third, higher temperature causes lower contamination by various germs. Fourth, when the distillation under reduced pressure is applied at around 40°C, fermentation and distillation can be performed by one tank, which reduces the manufacturing time and the cost of equipment. Here, we introduce a fundamental research for an energy-saving fermentation technology using thermotolerant yeast.

9.1. Temperature-noncontrolled fermentation with thermotolerant yeast

For development of the fermentation technology, K. marxianusDMKU 3-1042 was used, which efficiently produces ethanol at high temperatures as mentioned above [32, 33]. The utilization of the thermotolerant yeast is favorable to fermentation in a tropical country because it can be performed under temperature-noncontrolled conditions. When a bench-scale fermentation, 2 L of 9% glucose medium, was tested, DMKU 3-1042 produced ethanol equivalent to that under the temperature-controlled condition at 30°C [39]. In a fermenter-scale fermentation with 4000 L of 18% sugarcane, 7% ethanol production was achieved [39].

9.2. Distillation-connected fermentation with thermotolerant yeast

As an additional challenge, distillation-connected fermentation was attempted. Because the saturated vapor pressure of ethanol is 177.8 mbar at 41°C, where a thermotolerant microbe can grow well, ethanol can be collected from the fermenting culture when pressure is reduced to less than the saturated vapor pressure. The system shown in Figure 5 was constructed and tested, which consists of a fermentation and a distillation tank, the primary and secondary ethanol recovery units, a vacuum pump, and a drain unit. In this system, ethanol is concentrated as the process proceeds from the primary to secondary ethanol recovery units. Due to the set-up of this system, the air in the tank was discharged outside during the vacuum distillation, and some ethanol was trapped in the drain unit. When fermentation with K. marxianusDMKU 3-1042 and distillation at 70 mbar and 41°C was applied, about 35 and 60% were recovered in the primary and secondary bottles [39]. The process of the simultaneous fermentation and distillation under a low pressure was continuously repeated three times, with 12% rice-hydrolysate [39]. Similar performance was achieved with a thermo-adopted strain of Zymomonas mobilisTISTR548, an ethanologenic bacterium [39].

Figure 5.

Apparatus for fermentation and distillation under a low pressure. This apparatus consists of a fermentation and distillation tank, primary and secondary recovery bottles, a drain unit, and a vacuum pump.

That system provides some benefits: (i) microbes avoid exposure to high concentrations of ethanol or acetic acid or strong oxidative stress and (ii) fermentation can be continued during distillation increasing ethanol yields. Although further experiments for its evaluation are required, the system including HTF is expected to be one of next-generation fermentation technologies.



This work was supported by The Core to Core Program, which was granted by the Japan Society for the Promotion of Science, the National Research Council of Thailand, Ministry of Science and Technology in Vietnam, National Univ. of Laos, Univ. of Brawijaya and Beuth Univ. of Applied Science Berlin, supported by Japan Science and Technology Agency, Ministry of Research, Technology and Higher Education of the Republic of Indonesia, Agricultural Research Development Agency of Thailand and Ministry of Science and Technology of Laos as part of the e-ASIA Joint Research Program (e-ASIA JRP), and partially supported by Advanced Low Carbon Technology Research and Development Program, which was granted by Japan Science and Technology Agency.

© 2018 The Author(s). Licensee IntechOpen. This chapter is distributed under the terms of the Creative Commons Attribution 3.0 License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

How to cite and reference

Link to this chapter Copy to clipboard

Cite this chapter Copy to clipboard

Tomoyuki Kosaka, Noppon Lertwattanasakul, Nadchanok Rodrussamee, Mochamad Nurcholis, Ngo Thi Phuong Dung, Chansom Keo-Oudone, Masayuki Murata, Peter Götz, Constantinos Theodoropoulos, Suprayogi, Jaya Mahar Maligan, Savitree Limtong and Mamoru Yamada (November 5th 2018). Potential of Thermotolerant Ethanologenic Yeasts Isolated from ASEAN Countries and Their Application in High- Temperature Fermentation, Fuel Ethanol Production from Sugarcane, Thalita Peixoto Basso and Luiz Carlos Basso, IntechOpen, DOI: 10.5772/intechopen.79144. Available from:

chapter statistics

682total chapter downloads

3Crossref citations

More statistics for editors and authors

Login to your personal dashboard for more detailed statistics on your publications.

Access personal reporting

Related Content

This Book

Next chapter

Enhanced Ethanol Production of Saccharomyces cerevisiae Induced by Cold Plasma at Atmospheric Air Pressure

By Xiao-Yu Dong

Related Book

First chapter

Introductory Chapter: Yeasts in Biotechnology

By Thalita Peixoto Basso, Luiz Carlos Basso and Carlos Alberto Labate

We are IntechOpen, the world's leading publisher of Open Access books. Built by scientists, for scientists. Our readership spans scientists, professors, researchers, librarians, and students, as well as business professionals. We share our knowledge and peer-reveiwed research papers with libraries, scientific and engineering societies, and also work with corporate R&D departments and government entities.

More About Us