Open access peer-reviewed chapter

Transcriptional Regulation of the Human Genes that Encode DNA Repair- and Mitochondrial Function-Associated Proteins

By Fumiaki Uchiumi, Steven Larsen and Sei-ichi Tanuma

Submitted: June 16th 2014Reviewed: October 20th 2014Published: November 18th 2015

DOI: 10.5772/59588

Downloaded: 1034

1. Introduction

Mitochondria are thought to be evolved from primeval prokaryotes after symbiosis in anearobic cells, and they have their own circular DNAs (mtDNAs) and transcription/translation systems [1-3]. However, most of the genes (99%) that encode mitochondrial proteins and components of protein complexes are contained in nuclear genomes [3]. Previous researches revealed that mitochondria play important roles in the regulation of vital biological events, namely production of energy [4]. More importantly, recent studies showed that mitochondria exert signals to affect cell death [5], cellular senescence [6], and DNA repair systems [7]. These observations imply that mitochondria and nuclei are communicating each other to protect nuclear DNAs that encode 99% of mitochondrial proteins [8]. Furthermore, mitochondria also play roles in the responses to various stresses, including immunological reaction [9, 10].

Previously, we surveyed the human genomic DNA data-base and found that promoter regions of several DNA-repair-associated genes, including ATM, BRCA1, FANCD2, PARG, and TP53, which encode proteins that regulate mitochondrial functions, contain duplicated GGAA-motifs [11]. Moreover, numbers of DNA repair and mitochondrial function-associated genes are linked with partner genes by bidirectional promoter regions containing duplicated GGAA motifs [12]. These observations suggest that expression of the DNA repair and mitochondrial function associated factor-encoding genes are commonly regulated by GGAA-motif binding transcription factors (TFs).

In this chapter, we will focus on and discuss transcriptional mechanisms that regulate both DNA repair and mitochondrial functions. Not only DNA repair systems, but also several metabolic enzyme reactions that depend on an inner cellular NAD+/NADH ratio, including TCA (Citrate/Krebs) cycle and poly (ADP-ribosyl)ation, are thought to be dys-regulated in cancer or tumor cells. We therefore, propose a novel cancer therapy by introducing GGAA-motif binding TFs or their expression vectors, activating both DNA repair and mitochondrial functions.

2. Relationships between DNA-repair, mitochondrial functions and Immune responses

Telomeres are the specific region of chromosomes that regulate cellular senescence and chromosomal integrity [13]. It has also been indicated that mitochondrial function is regulated by telomeres [6]. Several nuclear DNA-repair factors are suggested to play roles in the maintenance of mitochondrial DNAs (mtDNAs), and damaged mtDNAs in turn exert signals to regulate nuclear transcription [7]. Some of the DNA repair factors have been shown to localize in mitochondria. Furthermore, immune system has been suggested to be under the regulation of DNA repair [14]. Therefore, understanding the co-operation of the telomere-mitochondria-DNA repair-immune response might contribute to reveal molecular mechanism of cellular senescence, cancer and immunological diseases.

2.1. Characterization of the promoter regions of genes encoding enzymes that regulate human poly(ADP-ribose) metabolism

We have found duplicated GGAA-motifs in the bidirectional promoter of the human PARG and TIM23B genes that encode a poly(ADP-ribose) degrading enzyme and a mitochondrial inner membrane translocase 23B, respectively [11, 15, 16]. Isoforms of the PARG protein localize in the mitochondria [17]. PARP1 enzyme synthesizes poly(ADP-ribose)s on various target proteins, including p53 [18, 19] and PARP1 itself to regulate DNA-repair synthesis [20]. Interestingly, duplicated GGAA motifs are also contained in the promoter region of the human PARP1 gene [21, 22]. PARP1 and PARP2 enzymes influence mitochondrial function and oxidative metabolism [23]. It has been shown that PARP1 protein localizes in mitochondria to maintain mitochondrial DNA integrity [24]. These observations imply that several DNA-repair factors localize in mitochondria, and that their gene expression may be partly controlled by the GGAA-motif binding protein factors.

2.2. DNA-repair factors and mitochondrial functions

It is widely known that damage on DNAs activates p53, which is transcribed from the TP53 gene, allowing it to bind to 5’-regulatory elements and activate genes encoding cell cycle regulators, apoptosis- and autophagy-inducers [25, 26]. The p53 protein does not only act as a “guardian of the genome”, but also serves as a metabolism regulator [27, 28]. Moreover, p53 has been reported to accumulate in mitochondria in response to stress [26]. One recent study revealed that mitochondrial disulfide relay causes translocation of p53 into mitochondria to facilitate its function for repairing oxidative damage to mitochondrial DNA [29]. However, overexpression of p53 in mitochondria would lead to depleted mitochondrial DNA abundance and a reduction in oxidative stress [30]. Oncogenic RAS-induced mitochondrial dysfunction, which causes oncogene induced senescence, is dependent on either p53 or RB [31]. As a tumor suppressor protein, RB plays a role in linking cell cycle exit with mitochondrial biogenesis [32]. RB is widely known to control cell cycle progression, maintenance of genome stability and apoptosis by interacting with the E2F family of TFs [33]. Recently, it was reported that mutation of E2F1 leads to mitochondrial defects in human cells [34].

Besides p53 and Rb, various DNA repair factors have been reported to localize in mitochondria or regulate their biological functions. For example, mutations of the BRCA1 gene have become one of the hallmarks for diagnosis of breast cancer [35, 36]. BRCA1 protein, which plays a part in the repair synthesis of double-strand DNA breaks [37], is also involved in the mitochondrial genome maintenance to be trans-located into mitochondria especially when it is phosphorylated [38]. Deficiency of BRCA1, which interacts with FANCD2 protein, leads to phenotypes that resemble to Fanconi amaemia (FA) [39]. A number of additional DNA repair factors associate with FA proteins [40]. Recent study of transcripts from bone marrow cells revealed that FA patients have deficiencies in mitochondrial, redox and DNA repair pathways [41, 42]. Another DNA-repair deficient disease is Ataxia Telangiectasia (AT) that is caused by mutations on the ATM gene [43]. Recently, it was reported that lack of ATM causes reduced mitochondrial DNA integrity and mitochondrial dysfunction [44]. Moreover, it was suggested that mitochondria are required for the oxidative activation of ATM [45]. The duplicated GGAA-motifs are present in the 5’-upstream regions of the BRCA1, FANCD2, and ATM, which have bi-directional partner genes NBR2, CIDECP, and NPAT, respectively [11]. Although BRCA2, which encodes a tumor suppressor to repair double-strand DNA breaks [46, 47], has no bi-directional partner gene, the duplication of the GGAA-motif is present near its transcription start site (TSS) [11].

2.3. Apoptosis is executed by signals from mitochondria

Execution of apoptosis or programmed cell death is mediated by mitochondria in response to various stresses including DNA-damage and immunological stress signals [48, 49]. Previously, we reviewed the roles of the ETS family proteins on apoptosis, and found the GGAA-duplications in the 5’-regulatory regions of the human PDCD1, DFFA, BCL2, FAS, and FASL genes [50]. The findings imply that expression of the apoptosis regulating factor-encoding genes is under the control of the duplicated GGAA-motifs. Previous studies revealed that mitochondrial functions closely associate with apoptosis [5, 48, 51]. For instance, it is one of its characteristics that cytochrome c is released from mitochondria during induction of DNA-damage signals, and that apoptosis regulator proteins BAX and BCL2 localize in mitochondria [48]. Our in silico surveillance of the human genomic data base retrieved several interesting examples of duplicated GGAA-containing bidirectional promoters, including ATG12/AP3S1, APOPT1/BAG5, and HTRA2/AUP1 gene pairs [12]. The ATG12 and HTRA2 genes encode an autophagy protein that takes a part in the quality control after mitochondrial damage [52, 53] and a serine protease that is localized in mitochondria [54], respectively. Importantly, with assistance of tumor suppressors, such as p53, RB1 and BRCA1, ATG12 and HTRA2 may contribute to determine cell fate between DNA-repair and cell death after excess cellular stresses.

2.4. Identification of duplicated GGAA (TTCC) motifs in the 5’-upstream of the human genes encoding DNA repair factors and apoptosis regulators

We have reported that duplications of the GGAA-motif are found in the 5’-regulatory regions of the human TP53 and RB1 genes [11]. Moreover, we have found the DNA sequence 5’-CAATAGGAACCGCCGCCGTTGTTCCCGTC-3’ near the TSS of the human E2F1 gene. These lines of evidences imply that tumors could be generated from mitochondrial dysfunctions when p53 and RB proteins lose their intrinsic biological functions as tumor suppressors, and that expression of their encoding genes are under the control of GGAA-motif binding TFs.

We have also identified GGAA-motif duplications in the 5’-upstream of the APEX1 gene, which has a bidirectional partner gene OSGEP [11]. The APEX1 encodes apurinic/apyrimidinic endonuclease 1 (APE1) that regulates both base excision repair and mitochondrial DNA-repair systems [7, 55]. It is noteworthy that APE1 interacts with XRCC1, which is recruited to the poly(ADP-ribosyl)ated site [56]. APE1 does not only function as a regulator of the base excision repair system, but also as a redox regulator [57]. The GGAA-duplication is contained in the regulatory region of the head-head configured ACO2/PHF5A genes [12]. The ACO2 encodes aconitase that functions in the TCA cycle to produce citrate and isocitrate and also serves as a mitochondrial redox-sensor [58]. More importantly, a recent study revealed that aconitase and mitochondrial base excision repair enzyme OGG1 (8-oxoguanine DNA glycosylase) cooperatively preserve mitochondrial DNA integrity [59]. Additionally, it has been shown that Cockayne syndrome (CS) proteins CSA and CSB, which play roles in nucleotide excision repair, accumulate in mitochondria upon oxidative stress [60]. A putative ETS1 binding motif is located, though no obvious duplication of the GGAA-motif is present near TSS of the ERCC8 (CSA) gene. Interestingly, it has a bidirectional partner NDUFAF2 that encodes one of the components of the NADH dehydrogenase (ubiquinone) [12]. The observation implies that not only GGAA-motif-duplication, but also another cis-element may take part in supporting transcription from a bi-directional promoter.

Collectively, our in silico analysis of the 5’-upstream regions of human genes suggested that transcription of a large numbers of DNA-repair/apoptosis/mitochondrial function associated genes could be regulated by duplicated GGAA-motif-containing promoters.

2.5. DNA-repair and immune responses

It should be noted that duplicated GGAA (TTCC) motifs are frequently contained in numbers of 5’-upstream region of the human interferon (IFN) stimulated genes (ISGs) [61]. BRCA1 has been reported to regulate IFN-gamma signaling by inducing IRF7 gene expression [62]. MRE11, which is a double-stranded DNA break sensor with Rad50, is required for activation of stimulator of IFN genes, STING [63]. These lines of evidences imply that response to IFN should be co-regulated in accordance with DNA repair system when damage was introduced in chromosomal DNAs. Conversely, IFN signaling affects expression of genes encoding DNA repair factors. Recent studies revealed that immune system is closely associated with DNA-repair system. It has been reported that transcription of the FANCF gene is up-regulated by IRF8 during differentiation of myeloid cells [64]. Moreover, IRF1 has been shown to regulate BRIP1 (FANCJ) gene expression [65]. IL-4 decreases DNA damage in murine and human glioblastoma cells when PARP-dependent DNA-repair is required [66]. Over expression of the IFN-related genes are caused by treatment with DNA-damaging agents and following ionizing radiation [67]. Interestingly, this over expression is enhanced in the BRCA2 knockout cells.

Integration of viruses into chromosomes might be damage on DNAs because exogenous DNAs will cause disruption of genes or enhancer insertions. Therefore, DNA repair system should be immediately evoked upon viral infection. Hence, immune sensing is primarily required to anti-viral immunity. It was indicated that oxidized base 8-hydroxyguanosine (8-OHG) potentiates cytosolic immune recognition by decreasing its susceptibility to TREX1-mediated degradation [68]. TREX1, which is also known as DNase III, is a 3’ exonuclease that is thought to play an important role in HIV-1 DNA sensing and viral immune evasion [69]. Interestingly, TP53 gene expression is induced by type-I IFN signaling in CD4+ T cells upon infection of HIV-1 [70]. Importantly, the concept has been postulated that DNA damage response affects innate immune sensors that drive metabolism, apoptosis, cancer, and aging [14].

Overall, the DNA repair system, including DNA damage sensing, and IFN response are thought to depend on and regulate each other. Previously, we identified duplicated GGAA (TTCC) motifs in a number of DNA repair associated genes, including TP53, RB1, and BRCA1 [11]. In order to examine if GGAA (TTCC) duplication is a common feature of the 5’-upstream region of the DNA repair associated genes, we proceeded to re-survey of the data base of the human genomic DNA.

3. Comprehensive analysis of the DNA repair-associated gene promoter regions

First, we retrieved 568 gene IDs from NCBI_GENE data base (http://www.ncbi.nlm.nih.gov/gene/) with a key word “DNA repair” on July 20, 2014. Then, we accessed to their individual sequence data and searched GGAA or TTCC motifs within a region between approximately 540 nucleotides upstream and 90 nucleotides downstream from the putative TSSs. At least one duplicated GGAA (TTCC) motif is contained in the 630 nucleotide region of 358 different genes (Table 1). Our defined GGAA (TTCC) duplications, with no more than ten nucleotide distance between GGAA (TTCC) sequence pairs, are not found in the remaining 210 genes (not shown). These genes, whose putative promoter regions contain duplicated GGAA motifs, could be classified into several groups according to the biological functions of the encoded proteins.

Gene-Partner geneSequence
ABL1CGGCAGGAAATTTGTTGGAAGATGA, GTGACTTCCACAGGAAAAGTT
ACTL6ACTACCTTCCCCTACCCGGGTTCCCGCCG, GCTTCTTCCAGCCTTCCTCCTT, TCGCTTTCCTCTTTCCCGCCC
ADH5-LOC100506113TGAAATTCCCGTTCCCTCACC, CACGGGGAAGCCCTTTCCCGACA
ADPRHL2(ARH3)-TEKT2GATGGGGAACACTATTCCTCCGA, CGGACGGAAGTAGGGAAACTGT
AKAP9GAGTGGGAACCAGTGGAGGGAAGAGGG, CCACCGGAACTTTTCCGTTGG
ALKBH1-SLIRPGCCCCGGAAAAAATTTCCGGATCCGGAACACGA, CTTTCGGAAACTTTTCCGCTTC
ALKBH4-LRWD1CGACCGGAAGGAAGCGGAACCCAG
ALKBH6-LOC101927572AGACGGGAAAGGAAGTGCTTCCTTCAG
ALPK2AGTTTTTCCTTTCCTAAGG, TCTTCTTCCAGAACTTCCCCGGGCATGGAATTTCCCCTCTTAGGAAGAGAT
ANKRD26GACATGGAAGGGGAATAAAC, AGATTGGAAACCGCGGAGTTTCCTTTGG
APCAGGATTTCCCGGAAGAGGT
APEX1-OSGEPCAGCTTTCCGGAGCGCAGAGGAAGCTGG, CACTGGGAAAGACACCGCGGAACTCCC, CCGTTTTCCTATCTCTTTCCCGTGG
APITD1CGCAGTTCCTGTTCCACTCG
APOBEC3BCACACTTCCTTCCCCACT, GGAGGTTCCTCTGCCAGCGGGAAGGGTCCGGGGAAAACCA
APOBEC3GAAGCAGGAAGGAAAGAGC
ARAGGTATTCCTATCGTCCTTTTCCTCCCTC, GGGAGGGAAAAGGAGGTGGGAAGGCAAG
ASCC3TAATAGGAATTATTTCCTCCAC
ASF1AAAAGTTTCCGAGTCCATTCCGGGAG
ASTE1-NEK11ATCACGGAACTGTACTTCCCAGAG, GAGACTTCCGATTCCCGCTC
ATF2TGCTGGGAAGTGACGGAAACGGA
ATF3TACTAGGAAAGGAATCTGT
ATF4TCGCCGGAAAACGACCTTTCCCCGCC
ATM-NPATAAAGCTTCCCTACCAAGGGAAAACCT, CAGCAGGAACCACAATAAGGAACAAGA, CCTTCGGAACTGTCGTCACTTCCGTCCT
ATRCGGTGGGAACGTGAGGAACTTTT, ACGGCTTCCCGGCTTCCCCCGG
ATRIPCATCATTCCTCCTTGGACTTTCCTCCTC
ATRXTTGGTTTCCTCATCTGGAAAATGT
AURKBCTGGGGGAATTTGGGGAAACTTTCCTAAACTGGAAGCCAA, TCTCATTCCGCCTCTTCCATTGGGTTCCCATGA
BACH2TGCCCTTCCGGGAAAACGC
BARD1-LOC101928103GCAGCTTCCCTGTGGTTTCCCGAGGCTTCCTTGCTTCCCGCTC
BCCIP-UROSCTACGGGAAGGGGAGGGGAAGCTTT, GAGGGTGGAAAGCGGAAGAAAA, GCCGTGGAAAGTGGGGTTCCGCAGC, GACGAGGAAGAGGAAAAAGA
BCL2TTTTAGGAAAAGAGGGAAAAAAT
BCR-BCRP8AAGTGTTCCTGTTCCAGGAC
BLMCCGGGTTCCAGCTGCCTACTTCCTTTAA, TCGGCTTCCCCAGGAAGCAGCCAATCGGAATAGGCAAGCTTCCGGCGGGAAGTGAG
BRCA1-NBR2ATGCTGGAAATAATTATTTCCCTCCA, AATTCTTCCTCTTCCGTCTCTTTCCTTTTA, TTGGTTTCCGTGGCAACGGAAAAGCGCGGGAATTACA
BRCA2(FANCD1)GACAAGGAATTTCCTTTCG
BRE-RBKSTCTTCTTCCTGGAATAGTC, GCTGAGGAAGGAACTGTC
BRIP1 (FANCJ)GATACTTCCTTTCCGCTGG, GAGACTTCCAGTTTCCAAGGAATTTGC
BTG2-LINC01136CCACGGGAAGGGAACCGAC
C17orf70CCCGCTTCCCCACCCTGGGGAACCCGT
C19orf60CTTGGTTCCCCTTTCTTCCTTCTG
CAGE1-RIOK1GCGATGGAAAGGAACGGCT
CCNFGCGGCGGAAGGGAAGGCCG
CCNOCTGGCGGAAGGAAGGGCA
CDC20CAAGCTTCCCAATTCCGTCCC, TCTCCTTCCCCTTCTAGGAACGGCT, AGACTTTCCCCGGAAGGCCC
CDC25GCCTCTTCCCACTAGGTTCCATCAT, GGAGGGGAAAGAGGGAAGGAGG
CDK1TTTTTGGAATCTGGAATATTAGGAATCAAC
CDK2-PMELCGAGATTCCCGGCTTCCTGGTTTCCAAAGG, GCCAGGGAAACGCGGGAAGCAGG
CDK5-SLC4A2CCCATTTCCGCTGCATTCTGGAACGCGT, AAACTGGAAAAGATTGGGGAAGGTAATGGAATCTCG
CDK5RAP2GGTTAGGAACTTTGAGGATTCCTGAGT, CTCGTTTCCGTAGGAAGAAGCGCCGGGAAAGATG
CDK6-LOC101927497TGTGTTTCCTTGGAATCGGC
CDKN1A(p21)CATTGTTCCCAGCACTTCCTCTCCCTTCCTAGGC, CCTGCTTCCCAGGAACATGC
CDKN2A(p16)-CDKN2AAS1AGCCAGGAATAAAATAAGGGGAATAGGG
CEP63-ANAPC13AAGCGGGAAAGCCTTGTTCCTTGCT, CGATGGGAATAGGGGGAAGTCCG, TCGCTTTCCTCGGATTCCCGGAT
CFL1GAGATTTCCTTGTACCTTTCCCCTGTGCCTTTTCCTCCTA, AGCGGTTCCTGGGAAATTGG
CHAF1ATGGGAGGAATGGAAGTCAC
CHAF1BATAAATTCCGGCCGGGATTCCGACCC
CHD1L-PRKAB2GTGGGTTCCTTATAGGGAATAAGA
CHEK1TTTTTTTCCTACGGAATCATG, TCGCCTTCCCAAAGTGCTGGAATTACA, CTTATTTCCATTTTTCCTATTT
CINP-TECPR2ATCGG
TTCCTTTCCCGGGG
CLOCKCGGCAGGAAGCTCTTCTTCCTCCTC
CLSPNCCACGGGAACCTTGGAATTCCTCTAA, GCCCAGGAACCGTTTCCCAGCTCACTTCCCCCCG
CLUCTGATTTCCTAACTGGGAAGGCTC, GGCTCTTCCCTACTGGAAGCGCC
COCHAAGTAGGAACTCTTTCCACGAG
COL6A6GTCCGTTCCACGGTTCCGAGGT, TGCATGGAAGTTTCCCCAAG
COPS5CCTTCTTCCGGTGCGGAAGACTA
CPT2GAGTTGGAAGGAATCTTG, TGACAGGAAGCCTCTTCCAATAG, AACACGGAAGACTTCCTAGAG, GGGGATTCCGCTCGGAAGGGGC, CAGCGGGAAACTCCAGGTTTCCAACTC
CRY1AAAAATTCCAGGAAGTCCAGGAATGCCT, CTGAAGGAAACCGGACAATTTCCAGGCC
CSNK1DCGCGAGGAACTCACCTGGCTTCCTCGAC
CSNK1ETCCCAGGAACTGTGCTTCCGGGAT
CUL4AATCCATTCCCTATATTTCCTATCC
DCKACTCCGGAACCTCTTCCCGCGC
DCLRE1A-NHLRC2CAGCGGGAACTTGTTCCCGCCA
DCLRE1BTCCAGTTCCAGCCTTAATTCCCCCTC
DCLRE1C-MEIG1TAAACGGAAGAGGGAATTAATAGTTCCTGAAT, AAGCAGGAAGCGGAACGAAG, TCGATTTCCCTTCCCGCGA
DDB1-DAKAGTCCTTCCCGTTCCCAAAGGAGGAACAGCCC
DDX1GAGGATTCCTCATTTACTTTCCCCATC
DDX11-DDX11AS1GAGCGGGAAAACATTCCGGAAGTGGA
DEKATCTTTTCCAGGAAGCGACCGTGGAAACAAT, CGTCCTTCCGTTCCGCGCT, CCGCATTCCCGCTCTCCTTCCCGAAC
DHFR-MSH3GGCTCTTCCCACCTTCCCCTTC
DNTTGATCTGGAAAACATAGTTCCAAGTG, GATGCTTCCCTACCTTCCTCACG
EGFGGGATTTCCCTTTGATTTGGAAAGAAT, CCTGCTTTCCTGTGTGGAGGAATTGCC, TAGCTGGAACTTTCCATCAGTTCTTCCTTTCTTTTTCCTCTCT
EGFRAGAAGGGAAAGGGGGAAGGGGA, TGCTGGGAACGCCCCTCTCGGAAATTAA
EGR1AGGGCTTCCTGCTTCCCATAT
EIF2AK3TTGTAGGAAAGGTATTCCGGGAACTGAT, CACCAGGGAAAGTCCACCTTCCCCAAC
EIF3AGCTCCTTCCTTTCCGTCTC
EME2-MRPL34CGGCCGGAAGTCACCGGAAGAGGC, CGGCCGGAAGCGAGGAAGAGGT
ENDOV-LOC100294362GGGTGGGAAGTGCGGCCCGGGAAAGCGC, GTCGCTTCCGGAAGTGACGTGCGGAAGGGGT, CCAGTTTCCGGCGCGGAAGCGGA
ENGTCTAAGGAAGCGCATTTCCTGCCT
EPC1TTTTTTTCCCAAGGAATTAAA
EPC2GGAGGGGAAGGGAGAGGAAGGAGG
ERBB2-PGAP3GAAGCTTCCACTTCCGGAGTAACCGGAAGTTCCTGTGT
ERCC1AATTCGGAATTTTCCGAGAA
ERCC2(XPD)GCTCTTTCCCTTCCATGTT
ERCC3(XPB)GGAGCTTCCGGATTGAGCCGGAAGTCCC
ERCC4(FANCQ)CTTACTTCCCCTTCCCTTGC
ERCC6L2-LINC00476CAGAGGGAAGAGACATCGGGAAGATTG
ERN1GTTCATTCCAAGCGGAAGTGAT, TGAGGGGAATTCCTGAGGGCAAGGAAAAGGAAGAAAG
EWSR1-RHBDD3CGGACGGAACCATTCCAAACA
EYA1CTTTTGGAAGAACCGGTTCCTCAGC
EYA3ATGTCTTCCAAAACTTCCCACTC, CTTACTTCCGGTTCCTAGCG
EYA4GAGAGTTCCAG
GCAATTCCGGGGG, GGCCGTTCCCGGCTTCCGCGCAA
AACTTCCATCCT, GAGGGGGAAAGAGCTGCGGGAAAAGCC
FANCAAGTCTGGAATTCCTGGGC, AGTCATTCCCGGCAGGAACCACG
FANCB-MOSPD2GAGTCTTCCCTTCCCAGGA, GAGAGGGAAGGAAGCGGG
FANCCTCGTCGGAATTTTCCCGCGA, CCGCGGGAAAATTCCAAAAA
FANCD2-CIDECPCGGCCTTCCACTTCCGGCGCGGAAGTTGG
FANCECCTCCTTCCCTTTCCGACAGCGCGGGAACGGCT
FANCFGATATTTCCAAAGCGAAAGGAAGCGCG, CGTGGTTCCGGAAATTCT
FANCGTCGGTGGAAGCGGGAACCCAG
FANCICTGCCTTCCAGGCTTTTCCAGTGC
FANCLTTCATTTCCGCCCGCGGAATCCTC
FANCMTCATTGGAAACGGAACTTAA, AATCATTCCCAACGGAAACTCA
FBXO6CATAAGGAAGGAACTAGT
FEN1-TMEM258GGGGCTTCCCCCTTCCCCACC, CAACCGGAAAAG
GAAGTGCC
FGF10AATTCGGAAAGCGGGAAGATAC
FNDC4GAGGTGGAATTCCTCTTCCCAACT, GGCTCTTCCACGCGGGGAGGAAGGGGA
FOXM1ACGATTTCCCCCAGTGAGGAAATCAA
FOXO3CTCGTGGAAGGGAGGAGGAGGAATGTGGAAGGTGG
FUSCCACAGGAATCTCGGTTCCACCCC
GLB1TGCAGTTCCAAAGGGTCCCTTCCCAGGGAAGACGC
GSTP1GCAATTTCCTTTCCTCTAA, CTTAGGGAATTTCCCCCCG, ACCTGGGAAAGAGGGAAAGGCTTCCCCGGC
GTF2H1-HPS5TCGCGTTCCTCCCCTTCCTTGCT, GGGAGGGAACTAGCGGAAGGTGT
GTF2H2GTGAATTCCAGCTGGAACACCGTCCCTTTCCGCGCC, GCGGCGGAATGACTTCCGGGGC
GTF2H3-EIF2B1CCCACTTCCGGCGCACTTCCGTACCCCTCTTCCGGCGC
GZMAAGTGGGGAAGGAAAATCC
H2AFXTGGTCTTCCGCTTCTGGTTTCCGATTG
HERC2GGTGTTTCCTTCTTCGATTCCCTGCA, GTGGCGGAAATCCCGCCTTCCGGCGC
HELQ-MRPS18CCATGGTTCCGCGTTTCTTCCACTTCCTTTCGTTCCAAATCGTTCCGAAAGGCCCCTTCCGCTGCTCTTCCCCTGT
HINFPCACTGTTCCCGCCCCTTCCGTGTT
HLTF-HLTFAS1ATAAAGGAAGGTCGTTTCCCTCCG
HMGB2GGGCTTTCCTTCCCGAGC
HNRNPCCAATAGGAAGATTCTCAGGAATGGGG
HSPA1A-HSPA1LACCCTGGAATATTCCCGACC
HSD17B6-PRIM1CCACAGGAATTGGCGGGAACAGCA, CGCCGGGAATTGTAGTTCCCACTT, GTCCATTCCAGGAAGAGGA
HTATIP2AGAAAGGAATCAAAGGAATCCTG, GTGAGGGAAAACGCGGGAAGAGGG, GCAGATTCCAAACTTAGGAAGGGTC
HUS1BGGAGTGGAAACGGAAGCATT
HUWE1TCATGTTCCCTTCCGCGGCTTCCACCGT
IER3TCGTCGGAATTTCCAGCCC
IGF1AAATGTTCCCCCAGCTGTTTCCTGTCT
IGF1RTGAGCGGAAAAAAAAAGGGAAAAAAC
IGFBP3GCCGCTTCCTGCCTGGATTCCACAGC
IGHMBP2-MRPL21CGGCCGGAAACGGAAACGAC
IL18TGGGAGGAAGGGGAAGTCCT, TCGACTTCCATTGCCCTAGGAAAGAGC
INO80BGGACCGGAACGTTCGTTGGAAGGATC, AGTTTTTCCGCGGGGCGGAAAAGGC
INO80CACCTTTTCCGCGTGGGAAGGCAG
INO80E-HIRIP3AGTCAGGAACGGCGCTTTCCAGCGT, ATACCGGAATCTGAAGCGGAAGCTCAAGTTCCTCATC
IPO4GGGCATTCCTTCCCCAGA, GCCCTTTCCTCCGGAAGTGGG
IPPKAGGCCGGAAGCTTCTCTTCCGGCTC, CCGCGTTCCGGAAATGAG
IRS1TAAATTTCCTGGGGGAAACAGC
JMYGGGCTTTCCTCAGACACCTTCCTTTCA, CTCAGTTCCTCCGCCTTAGTTCCTCTTTTCCCGGGT, TGCGCGGAAGGAAGGAGA
KAT5AGCTAGGAATCTTCCCTGAG
KDM4AGCAGCTTCCCTTCCCTGTT
KIAA0101-TRIP4CCATCTTCCCCAGCCGGAACCAGC,
KIF2CGAAGTTTCCCAGTTTTCGGGAACCCCG, GCGTAGGAAGATGGTTGGGAACTGCG
KIF13BTGGCAGGAAATGAGCAGGAAGAGGT
KIF22GACTGGGAACCGGAACCGTG
KIN-ATP5C1CCCGGTTCCGTTTCCGGCTG
KLF8CTCCGTTCCTTTTAGCTTCCTCCCT
KRASCCCTCTTCCCTCTTCCCACAC
LCTACATTTTCCGGGTTCCTCTGC
LMNA-MEX3ATTTCTTTCCATTATTCCAGATA, GTGGTGGAAGGGAAAAGAG
LIG1-C19orf68GGCGCTTCCACCGATTCCTCCTCTTTCCCTGCC
LRRCC1AATGTTTCCAGGAACAAGA, TTTTCTTCCTCATACAGGGAAGTGAC, AGGCGGGAAAGTTCCCGGCT
MAD2L1TCTCGGGAAAAGCTGCGTTCCCACAC
MAD2L2-DRAXINGGACTGGAAGGAAGGGGG
MCM8-TRMT6GCCGCTTCCGCTTTCCGGCCC, ACCGCTTCCGGAAGCCTCTCGGCTTCCGTCTG, CTTCTGGAAGCTGCGGTGGGGAAACTGAGTTTCCCGAGC
MCRS1TCGTGGGAATTTGGAAGTCGA, AACTAGGAAAGCCTTTACTTTCCGCTAT
MDC1ACGTATTCCCAGGAAGAAAG, CAAAAGGAAATGAAATTCCAATGC
MGRN1CGCTTGGAACGCAGAGGGAAGGACC, GTTGGTTCCTTCCCTCTG, TCCTGGGAAAGATAGTTCCCAGACGGGCTTCCCGCGCTGCTTCCCGGCG
MIR96ACGTCGGAAACAGGCTGCTTCCAAGGG
MMS22LGTGCTTTCCAAGTTTTCCATATC
MNAT1TCATGGGAATGTTTCCAGACA, AAGATGGAATTTATCTTCCTAATT, CCGGGGGAACTGACTGCCGGAACGTTT
MORF4L2ATTTTTTCCTAGGAATGAAC
MPGGGCTGTTCCCACAGGAAGGAGA
MPLKIP-SUGCTGTAGCGGAAGCAGCTTCCGGGGAACCCCG
MRE11A-ANKRD49GCAGGTTCCCAGGCGGAAGCCCA
MSH3-DHFRGATTCTTCCAGTCTACGGGAAGCCTG
MSH6CGCTGTTCCCGCTTCCGCTCC
MSL1CCGCTTTCCCCTTCTTCCCGCGG
MYBGTGCGGGAATTTCCCCCCA
MYO5ACCCTAGGAATGCTTGGAAGGACG
NABP2-RNF41TCCCGGGAAGGGAAGGGAAAGGGGAAGGAGGGGAAAGAAG
NBN(NBS1)GGTTGGGAAGCTACTGGAATTAGG, CAGGTGGAAGTGGAAAGGAAGGGTA, CTAGATTCCAAAGGAATACCT, TGCTGTTCCTTTTCCAACCA
NCOR2GGCGCTTCCCCCCTCCTTCCTCCTC
NDNL2TGCACGGAAAACGCTGTTCCTTTTGG
NEIL1GGCGGTTCCTTCCGCCGG
NEIL2CCACTTTCCAGGGAATGAGC
NESCCTGGGGAAGCAGGAACAGAG
NFRKB(INO80G)GGACGGGAAGGAGGAATGAAGGAACTCGGAAGCACA
NIPBL-LOC646719GTGGCGGAAGTGGAGTGGGGAAGAGGG
NLRP11-NLRP4CGGCTGGAAGCGGGAAGAAAA, GGAGGTTCCTATTGAGAATTCCCAGGG
NONOTCCCCTTCCTCTCCCTCTTTCCACTTTCCTCTCC
NPAS2GCAGATTCCTTGTTCCCCCCG
NPM1CATCTTTCCTTCCTAACA
NR2C2CGCTGGGAAGAGGAAGAAGA
NSMCE1CTCAGTTCCACAGATGGGGAAACTGA, CAAGTGGAAGCCCCTTCCCATTA
NSMCE4ACGAACTTCCGCCGTTCCGAAGT
NUDT1-FTSJ2CCCGGGGAACTGCGACCCGGAATCCTG
NUPR1ATCCCTTCCCCCTCCTTCCTCACG
OFD1TAAATGGAATCACTAATGAGGAAAGGCA
OTUB2TACCCTTCCTGGATTCCAGAAA
PALB2(FANCN)-DCTN5AGAGATTCCGGCTACTTCCGGCCG
PARG-TIMM23BGCCGCTTCCCCCGCCTCCTTCCATGGT, TGACATTCCGGGCGCCGGTTCCCGTTA, GCCCCGGAAGCCGGAAGCGCC, CAGCTTTCCGGTGGTGGGAAAGTGA
PARP1GCGGGTTCCGTGGGCGTTCCCGCGG
PARP2-RPPH1CCCCCTTCCCCTTCCAGCTC
PARP4CCTGTTTCCACGAACTTTCCCGAAA, CCCGATTCCGGGCGCGTTCCGGCTA
PARPBP-NUP37AAGTGGGAAGGAAGAACTCCTGGGAATAGAG
PDE4DIPTCAAGGGAAAATTGAAAGGAAAAGATTTTAGGAAAGAGA,
PIWIL2-LOC100507071CACAGGGAACCTGCTGGAAAGGAC
PMS2-AIMP2TGGAGGGAACTTTCCCAGTC, CGGCATTCCAACCTCCCTGGAAATGGGGGGAACATGG
PNKPAGATGGGAAAAAAATCTTCCTCCCT, GTCATTTCCGTCCGCCGAGGAACCGAC
POLA1TCGCTTTCCCGGCTCTGGGGAAAACGA, CTCCTTTCCGGGAAAATGG, TGGCCTTCCGGCCGGAAGTCCG
POLBCCCGTTTCCCCTTCTAGGGAAAGGATTCCAGATA, AGGTCTTCCCATAGGAAGGCCC
POLD1GGCGGGGAACAGCGGAAGTGAG
POLD3CCTCTGGAAAAACCTTCCCTAAT
POLD4GCCTAGGAAGGGAAAACGGGAAGTGAG
POLGCTTCGTTCCTGAGGGAGGAATAAAC
POLH-XPO5AGCCCTTCCATTTTCCTTCCAGTAG
POLICAGGCGGAAGCGGCCGGAAGTAGC
POLLAACCGTTCCAGAGGGTCACTTCCGGCTGACTCGGAAGCTAT
POLMGGGGCTTCCTTCCGTCTC
POLQCCCAATTCCTCATTACATATTCCTCACA
POLR2A-ZBTB4GGGCGGGAAAGGAAGGGGC, ACCTTTTCCTTTTCCCTTCT, AAAATTTCCGGTAAGGGAAAGAAG, CTTATTTCCCCGCCTCCTTCCCTCCCCCACCTTCCCCTCC
POLR2BTTCTGGGAACGTCGGAGACGGAAGTTAC
POLR2F-C22orf23CTCCCGGAAGTGATTTCCTCTGG, GCCGAGGAAGGGAAGGGCG
POLR2GAGTGTTTCCGGTGGATTCCCAGGG
POLR2ICCCCCTTCCGGGAACCCCC, GTCCCTTCCCCACCGCCAGGAAGAGGG
PPM1DCCTTTGGAAGGGAGGTTTCCCGCCA
PPP1R15ACTTACTTCCACTTCCCACCC
PPP5CAGAGAGGAAGGGAAGATTT
PRKDC(DNA-PKCS)-MCM4ATCGAGGAACAAACTTGGAACTCTT, CGTTTTTCCTTAGGTTTCCATGTT, CCCCGGGAAAGTTCCTGCCG
PRMT8GGCATGGAAAACCAGGAAGTTTC
PRPF19TTCTGGGAAAGGGCAATTTCCGTTAG
RAD1-BRIX1TTCACTTCCTCCGCGGTTCCTCGGA
RAD9B-VPS29GTTTATTCCCTTTCCCTAGA, TTGCGGGAAACGAGTAGGAACCGTCTGGAAACGGA, CTCCCTTCCTTCCCTAGA, GGGATTTCCCAATTCCTCGCC
RAD17CCAACGGAATTAACGTTCCGCGTC
RAD23AAACCCGGAAGGCGGAAGCTGC
RAD23BCGACATTCCAGGACCGCCTTCCGCCCC
RAD51AP1-C12orf4TGGGAGGAAAACTAAGGGAAAAGAC
RAD51BAAAATTTCCAAACAGGGTGTTCCCTTGT, GCGTTTTCCGCGGGGAAACTGT
RAD51C(FANCO)-TEX14TTTGGGGAATCAAAACGGAATGGTG
RAD51DATCCGTTCCGTTTGGAACGGAAGCTGG, AGCCTGGAACCCGGAAGCGGC
RAD52-ERC1GGTGAGGAACTGGGAAGCGGG, CCGTAGGAAGTGGACGCTGGAAGCCCG
RAD54LAAATCTTCCCTTCCATAGC, CACTATTCCCGCCTCTTCCTTGGG
RAF1ATGGGGGAAAAATGAACTCGGAATTTAC
RASSFCACTGGGAAAAGCATGGAAAGACT, AGGAGGGAAGGAAGGGCAA
RB1-LINC00441CAGGTTTCCCAGTTTAATTCCTCATG, CGGGCGGAAGTGACGTTTTCCCGCGG
RBBP8TTTGATTCCATGTTCCACAGA
RBP14CCCAGGGAATGTTTCCAAAGA
RECQL-GOLT1BACGTCTTCCGGAAACACG
RECQL5-SAP30BPCCCGATTCCCCCTTCCAGCTT, CCGACTTCCGGGCGGAAAGGCA, AACAGTTCCGGAACCAGC
REV3L-TRAF3IP2GTTCGGGAAGGGGGAACGCCA
REXO2ACTCAGGAAATAACTCCTGGAAGCAAA
RFC2GGGGTGGAATTCCCATCT
RFC5AGGGAGGAAGTCGGAAACTGG
RHBDL2GCCCAGGAAGCCTGGAACGCAA
RIF1GGCAGGGAAGGGATGGGAAGGGATGGGAAGGGAG
RMI2CCCATTTCCTCCGTTCATTCCTAACT
RNF2AGAGTGGAAGGTCATTTTCCCAGGA
RNF4CGGCTGGAAATCTAGGAATGGGAAGGTTC
RNF44GTAAGGGAAGGCCCTCACTTTCCCCATC, CTTAGTTCCCAGTTTCCCTGGC, ACCTGTTCCCCGCCTCTCTTCCTCCAC
RNF113AGCTCCGGAAGAAGCGACGGAATCTGC
ROCK1GCTTCGGAACTTTCCCAGTG, GCTGGTTCCCCTTCCGAGCG
RPA2TTTGAGGAAGGAACTGAC
RPA3TTTTCTTCCTCTTTGGAATTAAA
RPS3CCCCTTTCCTGTTCCTGCCT, GCCACTTCCTTTCCTTTCA
RPM1TTTTCTTCCAGTTCCAGAGT
RRM2BCCAGCGGAAGCAGGGAGATTTCCTTAGG
RTEL1AAGCTGGAACGCAGGAGAGGAAGGAGA
RUNX1ATTCTTTCCCTTTCCCAGGC, TGGAGGGAAGGAAGGGCA, GCTGTGGAAAGGGGAACAGTT
RUVBL1-EEFSECACCCGTTCCGGCCCGGAAGCTTCCGCCCT
SAMHD1CCACTTTCCTTCCTCTGGGAATGCAG, AATCATTCCGGGTTCTTCCAGTTC, CTGTTTTCCTCTTCACTGGGAAGGTGC, GCTCTTTCCTCCCCCTTTCCACCAG
SAT1CCTCTGGAAAATTCCATTGT
SERPINE1CTGGGGGAAAACTTCCACGTT
SETMARGTCAAGGAAGGGAAGCGCCTTCCAGGCC
SETXGGCCTTTCCCGCAGTGTTCCCCTGG
SF3B3-COG4CGTGTGGAAGCAAGACGGAAGCATT
SFPQCTGTATTCCTATGAGGTTCCATAAT
SFR1CGAGAGGAAACTGGATTTCCAGTTT, CTCTCTTCCCCTTTGTAAATTCCTTGGG
SIRT1CTTCAGGAAGACGTGGAAATTCCCAGGG
SLC30A9CATCCTTCCCATCTTTCCTCCCATTTCCGAAAC, CCCCGGGAAGGAAGGCCT
SLX1A-BOLA2BGCCACTTCCGCTGGAAAACTCACTTCCGCCCT, GCGGCGGAACTCAGGGAAGGAGC
SLX4 (FANCP)GCAGAGGAAGACCGGAAGCGAG
SMAD3CGTGTTTCCCAGGACTTCCTCCCC, GGACTTTCCTTCCCGGAG
SMARCB1AGAGAGGAATGGAGAAGGTGGAAGGTGT
SMC1A-RIBC1GGTCCTTCCAATTCCCGACC
SMC2TCAAAGGAATAAATAGTTCCGGCGC
SMC3CAGCATTCCATGTGTTCCAAGGC, GGCGCGGAACCTTTCCCCCTT
SMC4-IFT80TCAAGTTCCAGGAAAGCGG, CTCCCTTCCTCTTCCCGCGA
SMC5-SMC5AS1CGGTGGGAACGGAAGTCGC
SMG1CTCCCTTCCCTTCCATCGT, GTGCTTTCCGGGAAGCGTT
SMOACGATTTCCACTCATCTCTTTCCCCCGG
SMUG1AGCATTTCCGGCGGAAGTGGC, GTGGGGGAAAGGAACCGGAAACGGG
SOX4TCGGGTTCCAAGCCAATGGGAAGCCCG
SP1CTGGTTTCCTTCCAAGCC
SPATA22GATTCTTCCAGGAACAACA, GTCGAGGAATTCCCGGAAACCTC
SPIDRCCCGGGGAAGGAAGCTCG
SPTAN1CCTCGGGAAAGTGAGCAGGAAGAGAC
SSRP1ACGCGGGAAAAGCTTCCCCGGT
STAT3GGACATTCCGGTCATCTTCCCTCCCT
STRA13CCGGCTTCCGGAAGGTGA
STUB1AACTCTTCCCGATACCTGAGGAAGGGCG
SUMO1CCCATTTCCCGCCTTGTCTTTCCTCTCT
SUPT16HTTGTGGGAAGGAACTAAA, GCTCTTTCCGCTCCCCCTTCCTTTGC
SUZ12TTTTTTTCCTCCCTCCTTCCCTCCT
SWI5TCAGTTTCCCAAGACCTGTTCCACAGA, TCCCCTTCCAGCTGGAAATTTA, CTACATTCCACTCCTAGGGGGAACATCA
SYNE2CAAGGGGAAGGAGGAACCCAG, CCTACTTCCAAGACCCAGGAATCTAC
TCEA1ACGGGTTCCATTTTTCCCCGTA, CAAAGTTCCATGCTCGGAATCTGC
TDP1-EFCAB11GGCAAGGAACGTGGGGCGAGTTCCTTTTC (11 nucleotide distance)
TDP2-ACOT13ACTTCGGAAGAGCTGGAAAGTCC
TDRD3TTTTGGGAAGACCAAACGGAATACCC, TCCCCTTCCTTCCGTAAC, TACCCTTCCGCCTGTTCCTCTCT
TERTTCCCCTTCCTTTCCGCGGC
TICRRAAGTTTTCCTCGGTCTTGGGAAACGTG, GCTGTTTCCCTGAAGGAAGGGAC
TIRAPCCTTTGGAAAAGTTCCATCTC
TK1TAAGCTTCCTTCTTGGAATTCCAATCT, TCTTCTTCCAAGGAACCTTGCTTGGGAAACCCA
TONSLCGTACTTCCCGGAATGCCC
TOP2ATCAGTTTCCTCAGGAAAACGA, ACCCCTTCCCGCTTCCAAAGC, ATCTCTTCCAAGCTTTCCGCACG
TOPBP2ATTGAGGAAATCCTTTCTTTCCCTGGC, GTCACTTCCACCGGAAAAGGC
TP53-WRAP53TCCATTTCCTTTGCTTCCTCCGG
TP63ATCAAGGAATTTCCCTGTC
TREX1GCTTCTTCCAGAGGTTCCCCAAC, GCCGCGGAAAC
CGATGTGGAAGACCC
TREX2CTCCCTTCCTTCCCCAGC
TRIM56CTCCAGGAAGCCTGTGCTGTTCCCTCAG
TRIP12-FBXO36GAGGGGGAATTAGTTCCTGCTA
TTC5TTTGTTTCCAGGATCTGGGAAAGAAA
TYMSCCGCAGGAAAACGTGGGAACTGTG, CCAGGTTCCCGGGTTTCCTAAGA, CCGCGGGAAAAGGCGCGCGGAAGGGGT
UBA1CCCAAGGAAGAATTTCCAGCAC, ACACGTTCCGTTTCCTCTTCCCACCC
UBA2CGCCCTTCCCCCACCCGCTTCCGGCCG
UBBTGCAAGGAAGTTTCCAGAGC, ATATTTTCCTAAAGAAGGAAGAGAA
UBC-MIR5188GTACAGGAAGGTGGAAGAACA, GGGGTTTCCGCCTCTTTTTTCCAAATT
UBE2B-CDKL3CTTCAGGAAGCCCAGGGGGAACCGCG
UBE2TCTAACTTCCACTTGAACATTTCCAGTGATGAAGGAATTCAC, ACGATTTCCAGCTCCTTCCTTGGT
UBE2V1GCGCCGGAAGGAATCCTG
UBE2V2ACAAGGGAATTGCGGAAACAGC
UBE2WTGGTTGGAAACGAAATAGGAAAAAAA
UBR5ATAATTTCCTTACTTTTCCAATAA
UHRF1AGGCGGGAAAACGAGGCGGGAAAAGAC
UNGGGGCAGGAACTTTTCTTCCCAGCC
UPF1GATGGGGAAACTGAGTTCCAAGCA
USF1GAATGGGAATCAAGATTCCTGTCA, CTTCTTTCCTGGAATGAAA
USP1GCGCGGGAACCCTGGGAAGCTCC
USP3CACCCTTCCCGGGGCCGGGGAAGCGGC, GACTAGGAAAGTCACTTCGGAACACAG, GGCCTGGAAAGGCGGAAGCCTC
USP28TGATGGGAAATCCTTTATTCCACGGT, GCAGTTTCCCACGGCGGGGGAACAGTT
USP47-LOC102724878GAGAAGGAAGTTCCCTGGAAGAGGG
UVSSAAGACCGGAACTTCCTTTCG
VCPGAGAATTCCAATCCGTCGAGGAAGCGTA
VWA2AAAAAGGAAATGGAAAACCT
WRNAGGTGGGAAGATGGGAATGAGG
WRNIP1-MYLK4GGGCCGGAAGACGACCCCTTCCTTTCG
XIAPCATCCTTCCCTTCTTGGAAACAGA, CTTTCTTCCACTATTCCTCAAC
XPC-LSM3CATTTTTCCTGAGTCTGGAAAAAGC, GCTCTTTCCTGCTTCCCGCAG
XRCC1GCTAAGGAACGCAGCGCTCTTCCCGCTC
XRCC3-ZFYVE21CGGCGGGAAGAGGAGTGCGGAACCCGC
XRCC4-TMEM167AGTTTTGGAAGATACCGGAAGTAGA
YBX1CTCGTGGAAGTCACGTTCCTTCTG
ZC3HAV1(PARP13)GCTCTTTCCGGGAATGGGT
ZNF143-LOC644656CCAATGGAAAACCGGAAGCGTC, ACGAAGGAATTGTTGGAAAATTT
ZNF668-ZNF646GGGAGGGAAGGGAAAGAGGGAAAGGAG, AGGGGGGAAGAGGAAGGAGG, TACTAGGAAACAGGAAGTGTC, AAAGCTTCCCCGCGAAACTTCCGCTTC, TTAAAGGAAATGTTGTGGAATATAA
ZNRD1-ZNRD1AS1TGGTGGGAAAATTTGCTGGAAGCGCAG, CCCCTGGAAAGGGTTCCAAGTC, GTCTGGGAATTCCGGGCG

Table 1.

GGAA motifs located in the 5’-upstream regions of human genes encoding DNA-repair associated factors. Duplicated GGAA (TTCC) motifs (bold) that are located between 540-bp upstream and 90-bp downstream of the putative transcription start sites (TSSs) of DNA repair-associated protein encoding genes are shown. Several of them have bidirectional partner genes. In that case, extra sequences containing both of the most upstream were surveyed. Nucleotide sequences contained in the 5’-upstream of the partner cDNAs are also included.

3.1. Classification of DNA repair genes whose upstream regions contain duplicated GGAA motifs

Numbers of genes (Table 1) encode proteins with multiple functions. However, they could be categorized into several groups as follows:

  1. Nucleotide excision repair (NER); ATR, CDKN1A, ERCC1, ERCC2(XPD), ERCC3(XPB), ERCC4 (XPF), GTF2H1, GTF2H2, GTF2H3, H2AFX, LIG1, PARP1, POLD1, POLD3, POLD4, RAD23A, RAD23B, RFC2, RFC5, RPA2, RPA3, UVSSA, XPC, XRCC1... NER is a DNA repair system that is executed with several functional proteins, which recognize a lesion to form TFIIH complex to excise the lesion introduced DNA chain and the gap is filled by DNA polymerases [71].

  2. Transcription coupled repair (TCR); APEX1, BRCA1, CDK1, CDK2, CDKN1A, CDKN2A, ERCC1, ERCC2, ERCC3, ERCC4, GSTP1, GTF2H1, GTF2H2, GTF2H3, LIG1, MRE11A, NBN, PARP1, POLD1, POLD3, POLD4, POLH, POLR2A, POLR2B, POLR2F, POLR2G, POLR2I, PRKDC, RFC2, RFC5, RPA2, RPA3, SP1, STAT3, TERT, TP53...TCR is thought to regulate genomic integrity. This process begins with unwinding the double stranded DNA by TFIIH, the next step is that the damaged strand is incised apart by XPF, XPG and endonucleases, then gap is filled and finally the nick is ligated [72].

  3. Fanconi anemia proteins; ATM, ATR, BRCA2 (FANCD1), BRIP (FANCJ), CHEK1, ERCC4(FANCQ), FANCA, FANCB, FANCC, FANCD2, FANCE, FANCF, FANCG, FANCI, FANCL, FANCM, NBN, PALB2 (FANCN), LMNA, RAD51C (FANCO), SLX4(FANCP)...Encoded proteins are involved in Fanconi anemia pathway that plays a part in the repair of inter strand cross links [73]. Notably, all genes that encode protein components in the Fanconi anemia core complex are listed in Table 1.

  4. Double strand break (DSB) repair, Non homologous end joining (NHEJ); APC, APEX1, ATM, ATR, BLM, BRCA1, BRCA2, CHEK1, DCLRE1A, DCLRE1B, DCLRE1C, DDX1, ERCC1, ERCC4, FEN1, LIG1, LMNA, MCM8, MRE11A, NBN, PARP1, RBBP8, POLA1, POLB, POLH, POLL, POLM, POLR2A, RAD51AP1, RAD51B, RAD51C, RAD51D, RAD52, RECQL, RECQL5, SP1, TERT, TP53, TREX2, XRCC4... DSBs are caused by stresses on chromosomal DNAs, such as irradiation of ultra violet or X-ray, and alkylating agents. Unrepaired DSBs will lead to collapse of stalled replication forks and in response to uncapped telomeres [74]. Some of the genes that encode protein components in the MRE11 complex are listed in Table 1. Not only serving as regulator of the mammalian DNA damage response, the MRE11 complex plays an important role in the maintenance of telomeres [75].

  5. Base excision repair (BER); APC, APEX1, BRCA1, BRCA2, CDKN1A, CHEK1, ERCC1, ERCC2, FEN1, LIG1, NBN, NEIL1, NEIL2, PARP1, PARP2, POLA1, POLB, POLD1, POLD3, POLD4, POLG, POLH, POLI, POLL, POLL, POLQ, RAD23B, RECQL5, RPA2, RPA3, RPS3, TP53, TREX1, UNG, WRN, XPC, XRCC... BER is a fundamental repair system to eliminate nucleotide-bases from mutated nucleotides that is recognized by AP endonucleases. FEN1 and Ligases fill the gap to ligate DNA ends [76, 77].

  6. Apoptosis; ABL1, APC, BARD1, BCL2, BCR, BLM, BRCA1, CNKN1A, CDKN2A, CHEK1, ERCC1, ERCC2, ERCC3, ERCC4, HMGB2, KRAS, LMNA, MRE11A, PARG, PARP1, PARP4, RAD23A, RAD23B, RAD51B, SIRT1, SUMO1, TERT, TOP2A, TP53, TP63, XIAP... Apoptosis or programmed cell death is executed by a number of proteins, including mitochondrial protein BCL2 and tumor suppressor p53 [48, 51]. It is thought to be an important process to eliminate cells with unrepairable DNA damage.

  7. Mitochondrial functions; ADPRHL2 (ARH3), APEX1, ATM, BARD1, BCL2, BRCA1, BTG2, CDKN1A, CDKN2A, ERBB2, FEN1, FOXO3, LMNA, PARG, POLG, SIRT1, STAT3, SUMO1, TERT, TP53, TP63, XIAP... Mitochondria and nuclei are communicating to regulate each other [6-9]. Several of the DNA repair factors, including p53 and BRCA1, have been shown to localize in mitochondria [78, 79]. It has been shown that mitochondrial matrix-associated proteins are poly(ADP-ribosyl)ated [80]. Poly(ADP-ribosyl)ation, which is catalyzed by PARP enzymes, is a modification of proteins utilizing NAD+ molecule as a substrate [81]. The NAD+/NADH ratio is thought to regulate mitochondrial metabolism. A recent study showed that decrease in NAD+/NADH ratio, which is thought to occur by an aberrances in mitochondria, does not only enhance cancer progression but also metastasis [82].

  8. Response to IFN; ABL1, BCL2, BCR, FOXO3, IL18, PARP1, PRKDC, RUNX1, RUVBL1, SAMHD1, SP1, STAT3, TERT, TP53, TREX1... Duplicated GGAA (TTCC) motifs are found in number of the 5’-upstream regions of the human Interferon Stimulated genes (ISGs) [61]. The observation suggests that expression of some of the DNA repair factor-encoding genes might be up-regulated by IFN-induced signals.

3.2. The GGAA (TTCC) motifs are often present in the 5’-flanking regions of the genes that encode protein modification factors

PARP enzymes and p53, which have multiple functions in DNA repair process, are thought to affect mitochondrial metabolism [29, 83]. We previously reported that 5’-upstream regions of many of the mitochondrial function associated genes contain duplicated GGAA (TTCC) motifs [12]. Therefore, mitochondrial function could be up-regulated when cells encounter with various stresses, including DNA damage, viral infections, or tumorigenesis. It is noteworthy that PARP enzymes consume NAD+ to synthesize poly(ADP-ribose)s on various target proteins, including p53 [18, 19]. Given that NAD+ is an essential molecule for energy metabolism, the ratio of inner cellular NAD+/NADH may keep balance of mitochondria/DNA repair system. SIRT1, which is known as a NAD+ dependent de-acetylating enzyme, is not only involved in controlling life spans of organisms but also DNA repair system with PARPs [84]. Besides affecting transcription by its de-acetylating activity, SIRT1 may indirectly contribute to regulate inner cellular acetyl-CoA level [85]. SIRT3, which localizes in mitochondria, catalyzes de-acetylation of acyl-CoA dehydrogenase and acetyl CoA synthase 2 [86-88]. It should be noted that SIRT3 gene is head-head configured with PSMD13 gene [89], and that the bidirectional promoter contains a sequence, 5’-ACTAGGGAACTTCCTCTAC-3’ [12]. It is important to remind that both the NAD+ and the acetyl-CoA are essential molecules in energy metabolism. Thus, GGAA-mediated transcription might be a biologically constitutional response to nutrition stress.

Not only the ubiquitin encoding genes, UBB and UBC, ubiquitin metabolism factor encoding genes, including UBE2B, UBE2T, UBE2V1, UBE2V2, UBE2W, UBR5, UHRF1, USP1, USP3, USP28, and USP47, are included in Table 1. Protein ubiquitination has been suggested to regulate DNA repair [90]. Notably, SUMOylation, which is a modification of proteins with Small Ubiquitin-like Modifier [91], plays an important role in DNA repair [92, 93]. The duplicated GGAA motif is also present in the SUMO1 promoter [50]. Furthermore, UBA1, whose encoding gene is listed in Table 1, is a SUMO1 activating enzyme [94].

3.3. Possible roles of the duplicated GGAA motif in the 5’-upstream regions of DNA-repair genes

Genome wide analysis of the human promoters revealed that c-ETS binding element is frequently found with another c-ETS binding element [95, 96]. Redundant occupation of the duplicated GGAA motifs by Ets family proteins seems to be a complicated system, but this would enable finely tuned regulation of each promoter through altering composition of Ets family or GGAA-binding proteins, including GABP and STATs, in the nucleus in response to cellular signals [95].

4. Bidirectional promoters that regulate DNA repair factor-encoding genes

From the surveillance of the human DNA data base, not only mitochondrial function associated genes but also DNA repair factor encoding genes have head-head oriented partner genes [12]. Recent studies on RNA sequencing revealed a wide variety of transcripts, and the human DNA data base is continuously updated. Therefore, numbers of known bidirectional promoters are increasing day by day. As the reason why so many genes have bidirectional partners has not yet been elucidated, there is great value in investigating the role of bidirectional promoters driving transcription of DNA-repair factor encoding genes.

4.1. Surveillance of the bidirectional promoters from human genomic database

We have reported that a lot of human mitochondrial function associated genes have a bidirectional partner [12]. Moreover, several DNA repair associated genes are head-head configured with another gene [11]. Re-surveillance of DNA repair factor-encoding genes revealed that a number of the genes have opposite direction transcribed partner genes, utilizing the same regulatory region as their common promoter (Table 1). Although the number of the bidirectional gene pair is increasing according to recent findings of transcripts with next generation sequencing, at least 95 gene pairs were identified from the surveillance of the 358 DNA repair associated genes whose promoter contains GGAA (TTCC) motifs. The observation suggests that duplicated GGAA (TTCC) motifs and the binding factors may play a part in the bidirectional transcription of both mitochondrial function- and DNA repair-associated genes. However, these genes are not always simply controlled by GGAA-motif alone. For example, Sp1 binding element or GC-box is co-localized with ETS binding motifs in human promoters with 28.4% occurrence [95]. Co-operation of the GABP binding motif with Sp1/3 and YY1 binding sites is required for murine Gabpa-Atp5j bidirectional promoter [97]. These observations suggest that another cis-element, such as GC-box, may play a role in the co-operative transcription.

4.2. Biological relevance of bidirectional transcription

It has been reported that many cancer or DNA repair associated genes have bidirectional partner genes, and that tandem repeated ETS binding sites are frequently found in the 5’-upstream regions of both genes [98-101]. Therefore, expression of many DNA repair factor encoding genes is thought to be regulated by TFs that bind to GGAA motifs.

Surveillance of the human genomic sequence database revealed that several ISGs have bidirectional partner genes [61]. Similar to the bidirectional promoters involved with DNA repair factor encoding genes, bidirectional ISG promoters contain duplicated GGAA motifs. They are BAG1-CHMP5, BLZF1-NME7, EIF3L-ANKRP54, CCDC75-HEART5B, IFI27L1-DDX24, PARP10-PLEC, PSMA2-MRPL32, RPL22-RNF207, and TRADD-FBXL8 [61]. It is noteworthy that the bidirectional gene pair HSPD1-HSPE1, which encodes the mitochondrial chaperon proteins HSP60 and HSP10, respectively, has been reported to be regulated by IFN gamma [102]. These findings suggest that promoters of the DNA-repair and mitochondrial function associated genes that carry duplicated GGAA-motifs could be simultaneously regulated by IFN-induced signals.

5. Cellular senescence and cancer generation might be simultaneously regulated at transcriptional level

Introduction of several transcription factors (OSKM or Yamanaka factors) into somatic cells could reprogram and generate induced pluripotent stem (iPS) cells [103]. Recently, it was demonstrated that three transcription factors, Blimp1, Prdm14, and Tfap2c, direct epiblast-like cells into primordial germ cells [104]. Moreover, transcription factor C/EBPα enhances effects of the OSKM factors to reprogram B cells [105]. These lines of evidences imply that the transcriptional profile determines cell fate towards proliferation, cell cycle arrest, differentiation, senescence or programmed cell death. Furthermore, it has been postulated that nutrient or metabolite state may contribute to affecting the balance between quiescence and proliferation of stem cells [106]. In this article, we would propose a hypothesis that DNA-repair and mitochondrial functions are regulated by the same or similar mechanisms that affect transcription of various genes via common duplicated GGAA motifs. The scenario is that transcriptional dysregulation should proceed to characteristics of cancer, including mitochondrial dysfunction and genomic instabilities. Conversely, cancer and malignant tumors could be reprogrammed to benign state if transcriptional state in the cells were altered.

5.1. Effect of caloric restriction (CR) mimetic drugs on telomere associated protein-encoding gene promoters

Loss of function mutations on the WRN gene, which encodes telomere regulating RecQ helicase, can lead to cancer or premature aging syndrome [107, 108]. On the other hand, caloric restriction (CR) can extend life spans of various organisms [109], and thus CR mimetic drugs may have an anti-aging effect. We therefore hypothesized that CR mimetic drugs activates transcription of telomere-associated genes and demonstrated that promoter activities of the human shelterin encoding genes are up-regulated by 2-deoxy-D-glucose (2DG) and Resveratrol (Rsv) in HeLa S3 cells [110].

2DG and Rsv, which are known as a potent inhibitors of glucose metabolism [109], and an activator of sirtuin-mediated de-acetylation [111], respectively, are often referred as CR mimetic drugs. We observed moderate activation of telomerase activity in HeLa S3 cells with 2DG and Rsv treatment [110, 112], suggesting that CR mimetic drugs have protective effects on telomeres by inducing telomerase activity along with up-regulating expression of the telomere maintenance factor-encoding genes. The human TERT (hTERT) promoter has been well characterized with c-Ets, GC-box, E-box and other TF-binding elements that are located in its 5’-flanking region [113, 114]. GC-boxes and Sp1-binding sites are frequently found in the human TERT, WRN and shelterin protein-encoding gene promoters with duplicated GGAA elements that present adjacent to TSSs [110, 115].

Interestingly, both duplicated GGAA-motif and GC-boxes are contained within 500-bp upstream of the TSS of the human SIRT1 gene [116]. SIRT1, which plays a role in NAD+ dependent de-acetylation of various proteins including histones, PGC-1α, FOXO1, p53 and HIF1α, is proposed to regulate aging and the healthspan of organisms [117]. Human SIRT1 gene expression is regulated by PPARβ/γ through Sp1 binding elements [118]. Therefore, signals evoked by CR or CR mimetic drugs might induce Sp1 or GC-box binding TFs, thus simultaneously up-regulating expression of TERT, WRN, SIRT1, and the shelterin-encoding genes. Given that the CR imposes a stress on cells due to the lack of nutrients or energy to survive, cells need to stop growth but need to keep the integrity of chromosomes and telomeres without replication of their genome. Under these circumstances, cells may require full commitment of mitochondria to drive TCA cycle and OXPHOS generating more ATP molecules than glycolysis does. Therefore, CR mimetic compounds with ability to induce telomere maintenance factor encoding genes might be anti-aging drugs simultaneously up-regulating expression of mitochondrial function associated genes.

5.2. Mechanisms that regulate aging or lifespan via mitochondria and metabolic state

Genetic studies of C. elegans implied that the insulin/IGF-1 signaling pathway regulates the lifespan of animals [119]. Insulin/IGF-1 signaling and glucose metabolism are thought to be associated with several diabetes/obesity controlling factors, including AKT, FOXO, mTOR and AMPK [120]. The mTOR is a component of mTORC1 and mTORC2 that play key roles in signal transduction in response to changes in energy balance [120]. Recently, it was reported that mTORC1 in the Paneth cell niche plays a role in calorie intake by modulating cADPR release from cells [121]. AMPK is known to be a sensor for energy stress and DNA damage to induce phosphorylation of various TFs, such as FOXO, PGC-1α, CREB and HDAC5 [120, 122]. Moreover, AMPK regulates SIRT1 activity by modulating NAD+ metabolism [122].

Mitochondrial functions are known to affect lifespan of organisms [123]. Furthermore, a cross talk between telomeres and mitochondria is suggested to regulate aging [124]. This concept was implied from a Tert knock down experiment that indicates telomere dysfunction causes suppression of PGC-1α in a p53-mediated manner [6]. The tumor suppressor p53 has been suggested to affect aging of organisms as a pro-aging factor [125]. It does not only affect cell cycle arrest and apoptosis, but also play a role in mitochondrial respiration and glycolysis [126, 127]. These lines of evidences strongly suggest that p53-mediated signaling is transferred to both telomeres and mitochondria to control cellular senescence. Although no canonical GC-boxes are found, duplicated GGAA-motifs are located near the TSS of the human TP53 promoter (Table 1). Detailed analysis of the TP53-WRAP53 bidirectional promoter region revealed that both the duplicated GGAA motif and a putative E2F binding sequence are involved in the response to Rsv [128]. Therefore, various stresses from DNA damage, viral infection, or lack of nutrients, will activate expression of genes encoding DNA repair/mitochondrial/telomere maintenance-associated factors via duplicated GGAA-motif with help from other cis-elements, including GC-box and E2F elements.

5.3. Implication of transcriptional control on genes that encode TCA cycle enzymes

It has long been argued how and why cancers are generated. Recently, diagnosis of cancer and diseases that are thought to occur from genomic alterations could be analyzed by second-generation sequencing [129]. In general, it has been thought that cancer is a genetic disease with several mutations on driver genes, including PIK3CA, IDH1 and RB1 [130]. Another aspect of cancer is that it is a metabolic disease [79]. It is widely known that cancer consumes more glucose to produce ATP by glycolysis or fermentation. The metabolic state of the cells could be referred to as the “Warburg effect” [131]. Importantly, TCA-cycle enzymes, FH (Fumarate hydratase) and SDH (succinate dehydrogenage) have been suggested as tumor suppressors [132]. We have confirmed that duplicated GGAA motifs are present near TSSs of the CS, ACO2, IDH1, IDH3A, IDH3B, SUCLG1, SDHAF2, SDHB, SDHD, FH, and ACLY genes that encode enzymes in the TCA-cycle [12]. In this chapter, it was shown that a number of the 5’-upstream regions of DNA repair factor- and IFN responding factor-encoding genes contain duplicated GGAA (TTCC) motifs near their TSSs. The observation suggests that expression of genes encoding TCA cycle enzymes is mediated by GGAA-motifs in a similar manner to that of DNA repair factor encoding genes.

Figure 1.

Dysfunction of tricarboxylic acid (TCA) cycle, which could be caused by alteration of GGAA-dependent transcription, may enforce the “Warburg effect”. Duplicated GGAA-motifs are contained in the 5’-upstream regions of the ACO2, GLUD2, IDH1, IDH3A, IDH3B, MDH2, ME2, SUCLG1, SDHAF2/SDHB/SDHD, FH, ACLY, CS, and PDHX genes (red). The activity of the IDH3 complex, OGDH, and MDH1B will be reduced when NAD+/NADH ratio was attenuated according to the poly(ADP-ribosyl)ation when cells encountered DNA-damage. Compounds highlighted in yellow indicate metabolites that are produced when dysfunction of mitochondria and PARP activation has occurred, which push the cycle in the counter clockwise direction (reductive carboxylation). When FH and SDHs do not work sufficiently, glutamate will be used as a source to process TCA-cycle. Various cellular stresses, including chemicals, X-ray and UV irradiation, virus infection, and aging, may alter the quality and/or quantity profile of the GGAA-binding factors in a normal cell (upper panel). That will lead to disruption of the mitochondrial- and DNA repair function-associated gene expression. Repeated DNA-damage will enforce PARP activity to consume and deplete NAD+ molecule from cytoplasm and mitochondria. When NAD+/NADH ratio decreased to cause dysfunction of the TCA-cycle, cells would synthesize ATP by glycolysis or fermentation (lower panel). The consequence could be referred to as the “Warburg effect”.

5.4. Regulation of rate limitting factors in the DNA repair system

As noted in 3.2., PARP, which localizes in mitochondria, may play a key role as one of the rate limitting factors in the DNA repair system. Poly(ADP-ribosyl)ation is essential for DNA repair, especially in cells that have deficiencies in BRCA, which is also known to localize in mitochondria [78, 79]. Therefore, highly potent inhibitors for PARP1 have been tested in different clinical trials [47]. Inhibition of the PARP enzyme will not only prevent over consumption of the NAD+ molecule, but it also blocks DNA repair systems in cancer cells. This balance in metabolism/DNA repair should be taken into account for treatment of cancer patients. The other key factor in mitochondria is the p53, which is frequently referred as a “gurdian of the genome“ [27, 28]. Although it has not been elucidated which TFs play essential roles in the regulation of those rate limitting factors in DNA repair, cells have some systems to monitor metabolites. For instance, C terminal-binding protein (CtBP), which is a transcriptional repressor of tumor suppressors [133], regulates BRCA1 gene expression in a NAD+/NADH ratio-dependent manner [134]. This implies that a metabolic swich mediated by CtBP plays a role in the regulation of the genes encoding DNA repair factors.

5.5. Alteration in transcriptional profile may cause cancerous state

It has been postulated that epigenetic and/or transcriptional changes play a role to determine chromatin states in tumor cells [135]. Recent genomic studies indicated alterations of gene expression in many human diseases [136, 137]. The transcriptome indicating cis- quantitative trait loci (QTLs) has been reported as value to reveal gene expression and transcription state in cells from patients of specific disease [138]. Cancer incidence in humans increase exponentially with age, suggesting that aging is the strongest demographic risk factor for most human malignancies [139, 140]. This has been mainly explained by reactive oxygen species (ROS) generation and accumulation of DNA damage on chromosomes or increased genomic stability, including telomere shortening [140]. Moreover, hypoxia, which will attenuate DNA damage response causing an increased mutation rate and chromosomal instability, has been suggested to modulate senescence [141, 142]. Importantly, aging is accompanied with epigenetic change and alteration of gene expression profile [143, 144]. Numerous GGAA motif-binding TFs acting as positive and negative transcriptional regulators, could drive mitochondrial- and DNA repair factor-encoding genes. The redundancy of the binding factors to the related sequences may help to control expression of a specific gene with accuracy, and subtle changes in the profile of the TFs would not cause severe abnormalities in normal cells. However, repeated cell division and extracellular signals will gradually disturb the balance of TFs that bind to GGAA (TTCC) motifs, and finally lead to dysregulation of mitochondrial functions, DNA-repair system, and IFN-response simultaneously. At this stage, abnormalities in metabolism, mutations on DNAs, and aberrant IFN response would be observed in the cells. These features could be referred to as characteristics of cancer and malignant tumors. Moreover, DNA damage-inducing signals will activate poly(ADP-ribosyl)ation to lead to over consumption of NAD+ molecule for poly (ADP-ribose) synthesis. The reduction of NAD+/NADH ratio in mitochondria may in turn reverse the direction of the TCA cycle. If the TCA cycle cannot meet demand for ATP levels, cells will abandon dependence on the normal respiratory system in favour of up-regulating glycolysis or fermentation (Fig. 1).

6. Concluding remarks

It remains unclear how the GGAA motif has been duplicated and incorporated into specific regulatory regions of various genes. However, the duplication of TF binding site might have been advantageous for organisms in the course of evolution. The crystal structure of mouse Elf3 with type II TGF-β receptor promoter was reported [145], representing an association model of the ets motif binding protein with the duplicated GGAA motifs. Very recently, it was shown that binding sites for MYC and its partner MIZ correlate with Pol II binding and transcription start site [146], implying that two adjacent TF-binding sites play significant roles in the regulation of transcription of multiple genes. At least twenty seven ETS family proteins and other TFs, including GABP, NF-κB/c-Rel, and STAT proteins, recognize the sequence. Therefore, the transcriptional efficiency could be determined only by the distance between GGAA (TTCC) sequences, variation of the flanking sequences and the combination of binding factors, which might have acquired variations as a consequence of evolution.

It has been shown that a lot of head-head configured gene pairs are contained in human genomes [99]. In this chapter, we proposed a mechanism that alterations in the transcriptional state in the cells lead to insufficient mitochondrial function accompanied with impaired DNA repair system. In this regard, cancer could be referred to as a “transcriptional disease“. Given that introduction of the four OSKM (Yamanaka) factors enables reprogramming of cell, enforced expression of some TFs could reprogramm metabolic state in cancerous cells [103]. In order to assess the possibility, elucidation of how human genes, especially those that encode mitochondrial function- and DNA repair-associated factors, are regulated by GGAA motif-dependent transcription system, should be done [128]. If the mechanism were revealed, scientists could establish gene therapy to let pre-cancerous cells regain normal TCA cycle/respiration from unhealthy ATP-synthesis, or get rid of “Warburg effect”. In addition, this therapy will up-regulate DNA repair system. We believe that the concept is valuable, though not yet fully cultivated, to find a way to next generation cancer treatment with much lower side effects.

Acknowledgments

The authors are grateful to Kaori Inoue and Sayaka Ishibashi for discussion and outstanding technical assistance. This work was supported in part by JSPS KAKENHI Grant Number 24510270 and a Research Fellowship from the Research Center for RNA Science, RIST, Tokyo University of Science.

How to cite and reference

Link to this chapter Copy to clipboard

Cite this chapter Copy to clipboard

Fumiaki Uchiumi, Steven Larsen and Sei-ichi Tanuma (November 18th 2015). Transcriptional Regulation of the Human Genes that Encode DNA Repair- and Mitochondrial Function-Associated Proteins, Advances in DNA Repair, Clark C. Chen, IntechOpen, DOI: 10.5772/59588. Available from:

chapter statistics

1034total chapter downloads

3Crossref citations

More statistics for editors and authors

Login to your personal dashboard for more detailed statistics on your publications.

Access personal reporting

Related Content

This Book

Next chapter

Epigenetic Reduction of DNA Repair in Progression to Cancer

By Carol Bernstein and Harris Bernstein

Related Book

First chapter

The DNA-Damage Response to Ionizing Radiation in Human Lymphocytes

By Maddalena Mognato, Mauro Grifalconi, Sabrina Canova, Cristina Girardi and Lucia Celotti

We are IntechOpen, the world's leading publisher of Open Access books. Built by scientists, for scientists. Our readership spans scientists, professors, researchers, librarians, and students, as well as business professionals. We share our knowledge and peer-reveiwed research papers with libraries, scientific and engineering societies, and also work with corporate R&D departments and government entities.

More About Us