Medicine » Infectious Diseases » "Manifestations of Cytomegalovirus Infection", book edited by Patricia Price, Nandini Makwana and Samantha Brunt, ISBN 978-953-51-1116-0, Published: May 29, 2013 under CC BY 3.0 license

Chapter 1

Hearing Loss in Children with Congenital Cytomegalovirus Infection

By Satoshi Iwasaki and Shin-ich Usami
DOI: 10.5772/56160

Article top

Hearing Loss in Children with Congenital Cytomegalovirus Infection

Satoshi Iwasaki1 and Shin-ich Usami2

1. Introduction

Sensorineural hearing loss (SNHL) is a common birth defect. The genetic origins of SNHL can be identified in half of the prelingual cases; in the others, SNHL is caused by environmental or unidentified genetic factors. The most common environmental cause of SNHL is congenital cytomegalovirus (CMV) infection. CMV is also the most common cause of intrauterine and congenital viral infection, affecting 0.5% to 2.5% of all live neonates [1]. While 90% of CMV-infected children are asymptomatic at birth, 10% of those exhibit clinically apparent sequelae at birth, including SNHL, mental retardation, motor disability, and microcephaly [1-4]. Recent studies have revealed that children with asymptomatic congenital CMV infection are at risk of late-onset SNHL and/or deterioration of SNHL during early childhood. These developments may not appear until months or even years following birth. The frequency of SNHL associated with asymptomatic congenital CMV infection reportedly ranges from 13% to 24% [5-9]. Although asymptomatic CMV infection is associated with a lower incidence of SNHL than symptomatic CMV infection, SNHL caused by congenital CMV often remains undiagnosed because maternal screening for CMV infection is not routinely conducted and the detection of SNHL during newborn hearing screening (NHS) tests is difficult [7, 10].

Hearing loss is detected in approximately 50% of children with symptomatic congenital CMV infection. In 66% of these patients, hearing loss will deteriorate [3, 11]. Children with symptomatic congenital CMV infection are easily identified at birth. In children with symptomatic infection, intrauterine growth retardation and petechiae have been associated with the development of hearing loss [12]. SNHL is diagnosed in 7%–25% of children with asymptomatic congenital CMV infection. Rates of delayed-onset SNHL, progressive SNHL, and improvement of SNHL are reported to be 11%–18%, 23%–62%, and 23% –47%, respectively [5-9].

Thus, the incidence of asymptomatic CMV infection and resulting SNHL may be higher, making it the leading cause of SNHL in children. Treatment of children with congenital CMV infection can prevent late-onset SNHL and/or deterioration of SNHL during early childhood. Cochlear implantation is also effective for the development of speech perception and auditory skills for deaf children with congenital CMV infection. Therefore, early identification of congenital CMV infection is very important.

2. Epidemiology of hearing-impaired children with congenital CMV infection

Of the 12,599 pregnant women included in a prospective study [13] conducted where from June 1996 to December 2003, maternal ages were as follows: <20 years, 1.6%; 20–24 years, 14.7%; 25–29 years, 41.4%; 30–34 years, 28.6%; 35–39 years, 7.9%; and >40 years, 0.8%. The annual seropositivity rate decreased over the 8-year study period, particularly during the last 4 years. The seropositivity rate of CMV immunoglobulin G (IgG) antibody was 75.3% in the sample as a whole. The seronegativity rate was 23.6%, and the percentage of cases borderline positive for IgG antibody was 1%. The seronegativity rate of CMV IgM antibody was 94.8% in the sample as a whole. The seropositivity rate was 2.2%, and 3% of cases were borderline positive for CMV IgM antibody. During the study period, in the cases positive for IgM antibody (n = 146), borderline positive for IgM antibody (n = 73), and borderline positive for IgG antibody (n = 14) and in cases with seroconversion of IgG antibody (n = 3), neonatal urine was analyzed for CMV DNA. Seroconversion of CMV IgG antibody occurred in 0.32% of the 929 cases negative for IgG antibody. Congenital CMV infection was identified in 18 infants by polymerase chain reaction (PCR) analysis of urine. Follow-up was conducted in these cases.

The symptoms at birth and sequelae observed during the first 6 months of life in the 18 children with congenital CMV infection are shown in Table 1. Among these infants, 2 children (11.1%) were symptomatic and the remaining 16 (88.9%) were asymptomatic. In this study, newborn infants were considered symptomatic if central nervous system involvement such as microcephaly or ventricular dilatation was detected. SNHL was detected in 1 child (50%) with symptomatic infection and in 4 children (25%) with asymptomatic infection. Profound unilateral SNHL had developed in the child with symptomatic infection. In the 4 children with asymptomatic infection, the severity of SNHL varied from mild unilateral loss to profound bilateral loss. Of the 4 children, unilateral SNHL was identified in 3 (75%). Mild unilateral SNHL occurred in 2 children (66.7%), and profound unilateral loss occurred in 1 child (33.3%). Profound bilateral SNHL occurred in 1 child with asymptomatic infection. The unilateral hearing loss in case 1 was detected by a neonatal automatic auditory brainstem response (ABR) screener. SNHL in the other 3 children was detected by conventional ABR. Table 2 shows a summary of the findings from longitudinal audiological evaluations in the 5 children with asymptomatic congenital CMV infection. On subsequent audiological testing, delayed-onset SNHL was detected in 2 children who had passed the newborn hearing screening (NHS) test (1 bilateral and 1 unilateral). Two cases (40%) had progressive hearing loss and 2 (40%) had improvement of hearing loss from the initial abnormal ABR (profound unilateral loss and profound bilateral loss, respectively).

Symptoms Audiologic examinations
Case 1Not foundAutomatic ABR: unilateral REFER
ABR: unilateral moderate hearing loss
Case 2Not foundABR: unilateral moderate hearing loss
Case 3Not foundABR: unilateral profound hearing loss
Case 4Not foundABR: bilateral severe hearing loss
Case 5Not foundAutomatic ABR: bilateral PASS
Case 6-16Not foundABR: normal
Case 17Microcephaly
Ventricular dilatation
ABR: unilateral profound hearing loss
Case 18Microcephaly
Ventricular dilatation
Heart anomaly
ABR: normal

Table 1.

Initial symptoms and audiologic results during the first 6 months of life in 18 children with congenital CMV infection.

[i] - ABR: auditory brainstem response. This table is cited from reference [11].

Initial hearing loss Results of follow-up audiologic examination Outcome
AgeHearing lossCharacteristic
Case 1Unilateral moderate
(Unilateral REFER)
36 moBilateral
profound
Delayed-onset
Progressive
Cochlear implantation
(39 mo)
Case 2Unilateral moderate
53 moUnilateral
moderate
FluctuatingNormal speech development
Case 3Unilateral profound
53 moUnilateral
mild
Fluctuating
Improvement
Normal speech development
Case 4Bilateral severe
17 moNormalFluctuating
Improvement
Normal speech development
Case 5Normal
(Bilateral PASS)
26 moBilateral
profound
Delayed-onset
Progressive
Cochlear implantation
(29 mo)

Table 2.

Results of longitudinal audiologic examinations in 5 children with SNHL caused by asymptomatic CMV infection.

[i] - SNHL: sensorineural hearing loss. This table is cited from reference [11].

In this prospective study, the rates of delayed-onset SNHL, progressive SNHL, and improvement of SNHL were 12%, 40%, and 40%, respectively. Although a low rate of fetal CMV infection was observed, the results of the present study regarding the rate of SNHL are in accordance with the findings of those previous studies. The prevalence of congenital CMV infection is affected by the socioeconomic and geographic differences, but it seems to be no differences on characteristics of hearing loss induced by congenital CMV infection.

Because they develop later, both delayed-onset and progressive hearing loss frequently remain undiagnosed during universal newborn hearing screening (NHS) test [7, 10]. The 1994 Joint Committee on Infant Hearing [14] pointed out that additional hearing evaluations after universal NHS are required to detect delayed-onset hearing loss. Combined neonatal screening for CMV infection and repeated auditory evaluation should be considered, particularly for children with asymptomatic congenital CMV infection. Counseling of pregnant women on prevention of CMV infection is also important.

2.1. Retrospective study of congenital CMV infection

Hearing loss in children with congenital CMV infection often presents at birth; however, in many instances, it may develop after months or even years. One report stated that children with normal hearing at 6 months of age develop hearing loss at a rate of approximately 1% per year; the cumulative risk of late-onset hearing loss is substantial (6.9%) in a population of infants with asymptomatic congenital CMV infection [15]. Speech is often delayed in children with bilateral hearing loss. For cases of severe bilateral SNHL, Ogawa et al. [16] reported that congenital CMV infection could be diagnosed through the detection of CMV DNA in the dried umbilical cord. In addition, genetic defects (particularly those related to GJB2) were identified in 15% and 30% of the children, respectively. However, the etiology of pediatric SNHL, including mild to moderate and unilateral SNHL, remains uncertain. In a study of congenital CMV infection retrospectively diagnosed by the detection of CMV DNA extracted from dried umbilical cord specimens, the prevalence of CMV in children with unilateral or bilateral SNHL was investigated. In many of these cases, SNHL developed several months or even years after birth.

In total, 134 patients (70 males and 64 females) with bilateral (n = 46; 34.3%) or unilateral (n = 88; 65.7%) SNHL were evaluated. These cases were referred to the Department of Otolaryngology, Shinshu University School of Medicine from May 2008 to September 2009 (Table 3) [17]. The age of these children ranged from 1 month to 138 months (mean age: 37.7 ± 36.2 months). In children with bilateral SNHL, both genetic testing for deafness and CMV DNA analysis were performed. For children with unilateral SNHL, CMV DNA analysis and genetic testing for gene mutations of GJB2, Mitochondrial1555 were performed. Objective audiometric evaluation was performed for each patient using ABR and auditory steady-state evoked response systems (MASTER 580-NAVPRO; NIHON KOHDEN Co., Ltd, Tokyo, Japan). Behavioral audiological tests and/or pure-tone audiometry were also performed. Hearing levels were classified into 2 categories on the basis of the severity of hearing loss in the worse ear as severe (>70 dB) to profound (>90 dB) and mild (20–40 dB) to moderate (41–70 dB). Follow-up hearing assessments were performed at intervals of 6–12 months. Progressive hearing loss was defined as a decrease in hearing of ≥10 dB at 1 or more frequencies. Fluctuating hearing loss was defined as a decrease in hearing of >10 dB followed by an improvement of >10 dB at 1 or more frequencies. To analyze congenital CMV infection, CMV DNA quantitative PCR (qPCR) analysis was performed. Prior to qPCR analysis, total DNA, including genomic DNA and CMV DNA, was extracted from preserved dried umbilical cords. The results of this study revealed that in 9.0% (12/134) of children, SNHL could be attributed to congenital CMV infection. CMV DNA from preserved umbilical cords was detected in 8.7% (4/46) of children with bilateral SNHL and 9.1% (8/88) of those with unilateral SNHL. Congenital CMV infection caused bilateral severe-to-profound SNHL, bilateral mild-to-moderate SNHL, unilateral severe-to-profound SNHL, and unilateral mild-to-moderate SNHL in 14.3% (4/28), 0% (0/18), 9.6% (7/73), and 6.7% (1/15) of hearing-impaired children, respectively. This study also revealed that both congenital and late-onset SNHL could be caused by congenital CMV infection.

Hearing loss Gender Hearing level Severe-profound HL Mild-moderate HL
(n)(dB)nDiagnostic agenDiagnostic age
Total
(N=134)
M: 70, F: 64101
(75.4%)
34.4±34.7 mo33
(24.6%)
48.8±38.7 mo
Bilateral HL
(N=46)
M: 31, F: 1571.8 dB [R]
71.7 dB [L]
28
(20.9%)
16.6±19.9 mo18
(13.4%)
11.1±39.1 mo
Unilateral HL
(N=88)
M: 39, F: 4989.5 dB (W)
13.6 dB (B)
72
(54.5%)
41.2±36.6 mo15
(11.2%)
40.3±36.8 mo

Table 3.

Summary of characteristics of children with bilateral or unilateral hearing loss.

[i] - HL: hearing loss. Diagnostic age: age diagnosed as hearing loss.

[ii] - M: male, F: female. R: right, L: left. B: better ear, W: worse ear. This table is cited from reference [16].

Table 4 shows the clinical characteristics of 12 children in whom CMV DNA was identified. Of these 12 children, bilateral SNHL was detected in 4 and unilateral SNHL in 8. All 4 children with bilateral SNHL had late-onset profound SNHL. Hearing fluctuation and PASS at the NHS test were confirmed in 3 children (75%). Of the 8 children with unilateral SNHL, detectable defects were confirmed in 2 children. Hearing fluctuation was detected in only 1 child (12.5%). No inner ear anomaly was found in any of the 8 children with unilateral SNHL.

Retrospective diagnosis of congenital CMV infection is important to improve our understanding of the etiology of pediatric SNHL. In previous reports (Table 5), the frequency of congenital CMV infection in children with bilateral SNHL has varied from 3% to 36% because of variations in parameters (number of subjects, severity of SNHL) and methods [CMV IgM testing, DNA urinalysis, DNA from dried blood spots (DBS) in Guthrie cards] [19-24]. In 2 Japanese studies based on the retrospective diagnostic method of analysis of preserved dried umbilical cords, congenital CMV infection was detected in 10%–12% of children with bilateral SNHL [25, 26]; however, these studies included few subjects (10–26 cases). In children with unilateral SNHL, CMV DNA from preserved umbilical cords was detected in 9.1% (8/88). The frequency of congenital CMV infection was similar in children with unilateral and bilateral SNHL. It has been speculated that approximately 10% of SNHL in children is caused by congenital CMV infection. Few reports have examined the frequency of congenital CMV infection using retrospective diagnostic methods in children with unilateral SNHL. However, using the CMV DNA detection method, 25% (1/4) [16] and 19% (8/42) [19] of children with unilateral SNHL were diagnosed with congenital CMV infection.

Case no. Sex Diagnostic age Bilateral/
Unilateral
Severity Average HL
(R/L: dB)
Onset NHS
1F60 moBilateralProfound87.5/108.8LatePass
2F52 moBilateralProfound87.5/110.0LatePass
3M50 moBilateralProfound100.0/100.0LatePass
4M62 moBilateralProfound110.0/46.3Likely late
5M6 moUnilateralProfound32.5/103.8CongenitalRefer (L)
6M65 moUnilateralProfound107.5/17.5Unknown
7M50 moUnilateralProfound6.3/100.0Unknown
8F98 moUnilateralProfound110.0/15.0Unknown
9F55 moUnilateralProfound15.0/92.5LatePass
10F2 moUnilateralProfound90.0/18.3CongenitalRefer (R)
11M80 moUnilateralSevere13.3/70.0Unknown
12F44 moUnilateralModerate15.0/58.3LatePass

Table 4.

Clinical data of CMV DNA-positive children

[i] - F: female, M: male. Mo: month. HL: hearing loss. R: right, L: left. NHS: newborn hearing screening.

Diagnostic age: age diagnosed as hearing loss. This table is cited from reference [16].

[ii] -

Reference Year Subjects CMV positive rate Diagnostic
methods
Country
Total Bilateral Unilateral
Barbi et al. [19]2003> 40 dBHL9/79 (11.4%)1/37 (2.7%)8/42 (19%)DBS, qPCRItaly
Ogawa et al. [16]2007> 20dB, nonsyndromic SNHL10/67 (10.5%)9/63 (14.3%)1/4 (25%)US, PCRJapan
Samileh et al. [21]2008> 40 dBHL33/95 (34.7%)NR/75NR/20Cerologic testIran
Stehel et al. [22]2008NHS refer16/256 (6%)16/256 (6%)NRDNA from urineUSA
Walter et al. [43]2008unexplained SNHL8/35 (22.9%)NRNRDSS, qPCRUK
Mizuno et al. [44]2008only bilateral3/45 (6.7%)3/45 (6.7%)0UC, qPCRJapan
Jakubikova et al. [20]2009> 60 dBHL, NHS refer4/71 (5.6%)4/55 (7.3%)0/16 (0%)Cerologic testSlovak Re.
Boudewyns et al. [45]2009NHS refer, > 20 dB4/55 (7.3%)NRNRDBS, qPCRBelgium
Choi et al. [18]2009NHS refer13/479 (2.7%)13/479 (2.7%)NRDBS, qPCRUSA
Tagawa et al. [26]2009> 70 dB, deaf school children3/26 (11.5%)3/26 (11.5%)0 (0%)UC, qPCRJapan
Kimani et al. [46]2010NHS refer11/109 (10.1%)8/92 (8.8%)3/17 (17.6%)DBS, qPCRUSA
Adachi et al. [47]2010NHS refer, >35dB, bilateral13/77 (17%)13/77 (17%)0US, qPCRJapan

Table 5.

List of previous reports on children with congenital CMV nfection.

[i] - NR: not reported. NHS: newborn hearing screening. DBS: dried blood spot. UC: umbilical cord. qPCR: quantitative PCR.

[ii] - HL: hearing level. SNHL: sensorineural hearing loss. Re.: republic. This table is cited from reference [16].

2.2. Genetic hearing loss and congenital CMV infection

Genetic testing for deafness has become valuable for precise diagnosis of hearing loss. The most frequently implicated gene in nonsyndromic hearing loss is GJB2, the most prevalent gene responsible for congenital hearing loss worldwide. GJB2, SLC26A4, CDH23, and mitochondrial 12s ribosomal RNA (rRNA) are the other major genes that cause hearing loss in Japan. One study stated that genetic mutations were responsible for deafness in 40%–45% of children with congenital hearing loss [27]. In our study [17], 10 gene mutations associated with deafness (GJB2, n = 7; SLC26A4, n = 3) were identified in 21.7% (10/46) of children with bilateral SNHL. In children with bilateral severe-to-profound SNHL, gene mutations causing deafness and CMV DNA positivity were detected in 32.1% (9/28) and 14.3% (4/28) of patients, respectively [17]. The diagnostic rate has been concluded to be 46.4% (13/28). If analysis of CMV DNA from preserved dried umbilical cords could be combined with genetic testing for deafness, approximately 50% of cases of bilateral severe-to-profound hearing loss in children could be detected.

Congenital CMV infection is also often diagnosed by detecting CMV DNA in urine within the first 2 weeks of life and serological testing for CMV-specific IgM antibody from mother and child [28]. In recent years, the detection of CMV DNA by retrospective methods has been more valuable not only in diagnosing congenital CMV infection during later stages of life but also in identifying children at highest risk of late-onset and progressive SNHL. Some reports have stated that DBS stored on Guthrie cards has been used for the retrospective diagnosis of congenital CMV infections [18, 29]. Similarly, preserved umbilical cords have been recently used in Japan [25, 26, 30]. The sensitivity varies widely depending on the DNA extraction method in the DBS case. Some investigators have reported sensitivities of 71%–100% and specificities of 99%–100% [19, 29]. In this study, the qPCR method and preserved umbilical cords were used because they were useful for more accurate detection of CMV DNA.

3. Diagnosis of congenital CMV infection

3.1. Detection methods

The gold standard for diagnosis of congenital CMV infection is isolation of the virus from urine or saliva in the first 2 weeks of life. However, asymptomatic congenital CMV infection in children who develop SNHL after the first 2 weeks following birth cannot be diagnosed on the basis of viral isolation from urine or saliva. Detection of CMV DNA in infant blood or the umbilical cord using PCR assays is a more feasible method for identifying children with late-onset SNHL. The method involves analysis of blood stored as DBS on Guthrie cards. In Japanese culture, the dried umbilical cord is generally stored at home as a memento of the birth. These specimens are suitable for retrospective diagnosis of congenital CMV infection. The sensitivity varied widely depending on the DNA extraction method from DBS on Guthrie cards. Some investigators reported sensitivities of 71-100% and specificities of 99-100% [19, 29]. The qPCR method and dried umbilical cord could be useful for more precise detection of CMV DNA.

3.2. Serological method

Diagnosis of symptomatic CMV infection is easier in children who display cognitive or neuromuscular abnormalities than in asymptomatic children with CMV infection. Without neonatal viral screening, the prevalence of SNHL caused by asymptomatic CMV infection remains undetermined. To diagnose primary CMV infection, a serological method has been used [31]. Pregnant women who test positive for CMV IgG seroconversion or CMV IgM antibody may transmit the virus to the fetus. Production of IgM antibody persists for 6–9 months [28]; therefore, a CMV IgM-positive result alone does not accurately predict the risk of fetal infection.

3.3. Detection of CMV DNA from umbilical cord

For the detection of congenital CMV infection, CMV DNA qPCR analysis was performed. Prior to qPCR analysis, total DNA, including genomic DNA and CMV DNA, was extracted from preserved dried umbilical cords. The procedure is as follows. Each 5-mm tissue section was incubated in a lysis buffer containing proteinase K and incubated overnight at 56°C. Total DNA was extracted using the DNeasy® Blood & Tissue Kit (Qiagen GmbH, Hilden, Germany), according to the manufacturer’s instructions. The total amount of DNA was measured using the Qubit® Fluorometer with Quant-iT™ dsDNA BR Assay Kit (Life technologies-Invitrogen, Carlsbad, CA, USA). Total DNA (10 pg) was analyzed using the Step One Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) and TaqMan® Universal Master Mix II (Applied Biosystems). The qPCR primers and TaqMan® probe used for CMV DNA qPCR analysis were as follows: US14-1F: 5′-ACGTCCACGTTAGGATGAGG-3′, US14-1R: 5′-GTATGTGGCGCTTCTCTCGT-3′, and US14-1 TaqMan probe: 5′-FAM- AACCTGTGCACCACAGCGCC -TAMRA-3′. To quantify the input DNA amount in each sample, qPCR of each genomic region was also performed using the following primers and TaqMan® probe: GJB2-2F: 5′-ACGTCCACGTTAGGATGAGG-3′, GJB2-2: 5′-GTATGTGGCGCTTCTCTCGT-3′, and GJB2-2 TaqMan probe: 5′-FAM- AACCTGTGCACCACAGCGCC -TAMRA-3′. The initial preheating steps were performed for 2 min at 50°C and 10 min at 95°C. Following this, qPCR was performed for 43 cycles of 15 s at 95°C and 60 s at 60°C. After qPCR analysis, relative CMV concentrations in each sample were evaluated as ΔCt (delta cycle threshold), which was calculated by determining the threshold cycle of CMV qPCR minus that of GJB2 qPCR. The invader assay described by Abe [32] was used for genetic testing for deafness.

4. Treatment for hearing loss induced by congenital CMV infection

4.1. Cochlear implantation in children deafened by symptomatic CMV infection

Cochlear implantation for the correction of congenital deafness is an effective way to ensure the development of speech recognition. Cochlear implantation in children deafened by symptomatic CMV infection has been reported [33, 34]. The prognosis of children with symptomatic CMV infection is worse than that of those with asymptomatic CMV infection with regard to cognitive and neurological development. It has been suggested that cochlear implantation should be contraindicated for infants with symptomatic CMV infection and deafness because they are less likely to develop spoken language [35]. In contrast, other reports [33, 34] have suggested that cochlear implantation may improve quality of life, even if progress is slower or lesser than that expected in congenitally deaf children not infected with CMV. Pyman et al. [35] suggested that the prognosis in terms of linguistic outcome after cochlear implantation is poorer for CMV-infected deaf children than for other congenitally deaf children because of coexisting central disorders. Wide variation in speech perception and intelligibility after cochlear implantation has also been reported in children deafened by symptomatic CMV infection [33]. In that report, poor development in these areas was observed in 50% of children with symptomatic CMV infection, whereas development similar to that in congenitally deaf children not infected with CMV was evident in 31% of children and development better than that in noninfected congenitally deaf children was evident in 19% of children. In addition, a recent study has shown that deafness caused by symptomatic congenital CMV infection associated with motor and cognitive delays is not a contraindication for cochlear implantation. Early diagnosis of hearing loss and subsequent cochlear implantation is important for successful speech perception [34].

4.2. Cochlear implantation in children deafened by asymptomatic CMV infection

The effectiveness of cochlear implantation in children deafened as a result of symptomatic congenital CMV infection has been evaluated by various groups, but there are only limited outcome data for deaf children with asymptomatic CMV infection. Children with asymptomatic congenital CMV infection have a better prognosis than symptomatic children, but it is difficult to evaluate the SNHL because children with asymptomatic congenital CMV infection are at risk of development of delayed onset SNHL and progressive SNHL. As a result, they are also at risk of late-onset learning difficulties and/or progressive learning difficulties.

A prospective study was conducted on deaf children with asymptomatic CMV infection to assess the development of speech perception and auditory skills. This study examined 2 deaf infants before and after cochlear implantation using the Infant/Toddler Meaningful Auditory Integration Scale (IT-MAIS) [36]. Vocalization behavior in case 1 was observed 6 months after implementation and showed slow improvement but finally overtook after 36 months. After 3 months of cochlear implant use, the 2 children responded to speech and environmental sounds in everyday situations and interpreted sounds in a meaningful way. They continued to improve at 36 months postoperatively. IT-MAIS scores in these 2 children were similar to the mean scores in the 5 congenitally deaf children without CMV infection. No difference was observed in the effect of early cochlear implantation for deafness induced by CMV infection between the groups of children. Another group reported that significant improvement in auditory and language skills could be achieved in cochlear implanted children with asymptomatic CMV infection, but they did not achieve the same levels of outcome as congenitally deaf children without CMV infection [37]. They found a wide variation in the outcome of cochlear implantation in these children and speculated that the variation is related to the degree of cognitive impairment. There are only a few studies available on outcomes of cochlear implanted children with asymptomatic CMV infection. Therefore, more studies will be needed to evaluate the effectiveness of cochlear implantation in these children.

4.3. Treatment for hearing-impaired children with congenital CMV infection

To prevent late-onset and/or deterioration of SNHL, treatment with intravenous ganciclovir (GCV) and/or oral valganciclovir (VGCV) has been recommended in children with symptomatic congenital CMV disease involving the central nervous system [38-41]. In previous reports, treatment with intravenous GCV was initiated within the first 10–14 days of life for 2–6 weeks, and GCV doses ranged from 5 to 12 mg/kg twice daily. One report revealed that in 5 of 9 children with congenital CMV infection and SNHL, treatment with intravenous GCV induced improvement of SNHL in 2 children and prevented deterioration of SNHL in 5 children [38]. Another report revealed that in 4 of 6 children with congenital CMV infection and SNHL, treatment with intravenous GCV induced improvement of SNHL in 2 children and no deterioration of SNHL in 4 children during the 21-month observation period [39]. Improvement of SNHL or maintenance of normal hearing was reported in 84% of children treated with intravenous GCV and 59% of untreated children. Deterioration of SNHL was reported in 21% of treated children and 68% of untreated children [40]. According to these reports, good results have been observed in the group of children treated with GCV. Treatment with intravenous GCV and oral VGCV can prevent the development of SNHL during an 18-month administration period [41]. Treatment with intravenous GCV has been investigated in hearing-impaired children with asymptomatic congenital CMV infection. No SNHL was found for 4 –11 years in 12 children with asymptomatic congenital CMV infection treated with intravenous GCV, but SNHL developed in 2 of 11 untreated children [42]. Unfortunately there is no evidence for the efficacy of longer treatment with oral VGCV.

5. Conclusion

Congenital CMV infection is a major cause of bilateral and unilateral SNHL in children. In total, 9.0% of SNHL cases of unknown causes (bilateral SNHL: 8.7%, unilateral SNHL: 9.1%) are attributed to congenital CMV infection. Screening tests such as the detection of CMV DNA from preserved dried umbilical cords and genetic testing are important for the detection of SNHL in children. Using this combined methodology, detection of the cause of SNHL is possible in approximately 50% of children with hearing loss.

Cochlear implantation is effective to ensure the development of speech perception and auditory skills in deaf children with asymptomatic congenital CMV infection. No significant difference in growth of meaningful auditory integration was observed between the overall pediatric cochlear implant population not infected with CMV and that with asymptomatic CMV infection. Implementation of CMV screening models is important to prevent late-onset SNHL and deterioration of hearing loss.

Acknowledgements

These works were supported by grants for Research on Sensory and Communicative Disorders from Ministry of Health, Labour and Welfare and grants for Scientific Research (C) from Ministry of Education, Culture, Sports, Science and Technology, Tokyo, Japan.

References

1 - Z. J Hagay, G Biran, A Ornoy, E. A Reece, Congenital cytomegalovirus infection: a long-standing problem still seeking a solution. Am J Obstet Gynecol 19961742415
2 - S Stagno, R. F Pass, G Cloud, W. J Britt, R. E Henderson, P. D Walton, et alPrimary cytomegalovirus infection in pregnancy. Incidence, transmission to fetus, and clinical outcome. JAMA 198625619048
3 - R. F Pass, S Stagno, G. J Myers, C. A Alford, Outcome of symptomatic congenital cytomegalovirus infection: results of long-term longitudinal follow-up. Pediatrics 19806675862
4 - D. W Kimberlin, C. Y Lin, P. J Sanchez, G. J Demmler, W Dankner, M Shelton, et alEffect of ganciclovir therapy on hearing in symptomatic congenital cytomegalovirus disease involving the central nervous system: a randomized, controlled trial. J Pediatr 20031431625
5 - M. D Yow, D. W Williamson, L. J Leeds, P Thompson, R. M Woodward, B. F Walmus, et alEpidemiologic characteristics of cytomegalovirus infection in mothers and their infants. Am J Obstet Gynecol 1988158118995
6 - W. D Williamson, G. J Demmler, A. K Percy, F. I Catlin, Progressive hearing loss in infants with asymptomatic congenital cytomegalovirus infection. Pediatrics 1992908626
7 - T Hicks, K Fowler, M Richardson, A Dahle, L Adams, R Pass, Congenital cytomegalovirus infection and neonatal auditory screening. J Pediatr 199312377982
8 - K. B Fowler, F. P Mccollister, A. J Dahle, S Boppana, W. J Britt, R. F Pass, Progressive and fluctuating sensorineural hearing loss in children with asymptomatic congenital cytomegalovirus infection. J Pediatr 199713062430
9 - A. J Dahle, K. B Fowler, J. D Wright, S. B Boppana, W. J Britt, R. F Pass, Longitudinal investigation of hearing disorders in children with congenital cytomegalovirus. J Am Acad Audiol 20001128390
10 - K. B Fowler, A. J Dahle, S. B Boppana, R. F Pass, Newborn hearing screening: will children with hearing loss caused by congenital cytomegalovirus infection be missed? J Pediatr 1999135604
11 - W. D Williamson, M. M Desmond, LaFevers N, Taber LH, Catlin FI, Weaver TG. Symptomatic congenital cytomegalovirus. Disorders of language, learning, and hearing. Am J Dis Child 19821369025
12 - L. B Rivera, S. B Boppana, K. B Fowler, W. J Britt, S Stagno, R. F Pass, Predictors of hearing loss in children with symptomatic congenital cytomegalovirus infection. Pediatrics 20021107627
13 - S Iwasaki, M Yamashita, M Maeda, K Misawa, H Mineta, Audiological outcome of infants with congenital cytomegalovirus infection in a prospective study. Audiol Neurotol 200712316
14 - Joint Committee on Infant Hearingposition statement. Pediatrics 1995951526
15 - L. S Rosenthal, K. B Fowler, S. B Boppana, W. J Britt, R. F Pass, D. S Schmid, et alCytomegalovirus shedding and delayed sensorineural hearing loss: results from longitudinal follow-up of children with congenital infection. Pediatr Infect Dis J 20092851520
16 - H Ogawa, T Suzutani, Y Baba, S Koyano, N Nozawa, K Ishibashi, et alEtiology of severe sensorineural hearing loss in children: independent impact of congenital cytomegalovirus infection and GJB2 mutations. J Infect Dis 20071957828
17 - S Furutate, S Iwasaki, S Nishio, H Moteki, S Usami, Clinical profile of hearing loss in children with congenital cytpmegalovirus (CMV) infection: CMV DNA diagnosis using preserved umbilical cord. Acta Ololaryngol 201113197682
18 - K. Y Choi, L. A Schimmenti, A. M Jurek, B Sharon, K Daly, C Khan, et alDetection of cytomegalovirus DNA in dried blood pots of Minnesota infants who do not pass newborn hearing screening. Pediatr Infect Dis 20092810958
19 - Barbi M Binda SCaroppo S, Ambrosetti U, Corbetta C, Sergi P. A wider role for congenital cytomegalovirus infection in sensorineural hearing loss. Pediatr Infect Dis J 2003223942
20 - J Jakubikova, Z Kabatova, G Pavlovcinova, M Profant, Newborn hearing screening and strategy for early detection of hearing loss in infants. Int J Pediatr Otorhinolaryngol 20097360912
21 - N Samileh, S Ahmad, F Mohammad, M Framarz, T Azardokht, E Jomeht, Role of cytomegalovirus in sensorineural hearing loss of children: a case-control study Tehran, Iran. Int J Pediatr Otorhinolaryngol 2008722038
22 - EK Stehel, , AG Shoup, , Owen, , Jackson GL, Sendelbach DM, Boney LF, et al. Newborn hearing screening and detection of congenital cytomegalovirus infection. Pediatrics 2008;121:970-5.
23 - S. D Grosse, D. S Ross, S. C Dollard, Congenital cytomegalovirus (CMV) infection as a cause of permanent bilateral hearing loss: a quantitative assessment. J Clin Virol 2008415762
24 - I Foulon, A Naessens, W Foulon, A Casteels, F Gordts, Hearing loss in children with congenital cytomegalovirus infection in relation to the maternal trimester in which the maternal primary infection occurred. Pediatrics 2008e11237
25 - H Ogawa, Y Baba, T Suzutani, N Inoue, E Fukushima, K Omori, Congenital cytomegalovirus infection diagnosed by polymerase chain reaction with the use of oreserved umbilical cord in sensorineural hearing loss children. Laryngoscope 200611619914
26 - M Tagawa, H Tanaka, M Moriuchi, H Moriuchi, Retrospective diagnosis of congenital cytomegalovirus infection at a school for the deaf by using preserved dried umbilical cord. J Pediatr 200915574951
27 - S Usami, M Wagatsuma, H Fukuoka, H Suzuki, K Tsukada, S Nishio, et alThe responsible genes in Japanese deafness patients and clinical application using Invader assay. Acta Otolaryingol 200812844654
28 - B Genser, M Truschnig-wilders, D Stunzner, M. D Landini, G Halwachs-baumann, Evaluation of five commercial enzyme immunoassays for the detection of human cytomegalovirus-specific IgM antibodies in the absence of a commercially available gold standard. Clin Chem Lab Med 2001396270
29 - J. C De Vries, E. C Claas, A. C Kroes, A. C Vossen, Evaluation of DNA extraction methods for dried blood spots in the diagnosis of congenital cytomegalovirus infection. J Clin Virol 2009S3742
30 - S Koyano, N Inoue, T Nagamori, H Yan, H Asanuma, K Yagyu, et alDried umbilical cords in the retrospective diagnosis of congenital cytomegalovirus infection as a cause of developmental delays. Clin Infect Dis 2009e935
31 - T Lazzarotto, L Gabrielli, M Lanari, B Guerra, T Bellucci, M Sassi, M. P Landini, Congenital cytomegalovirus infection: recent advances in the diagnosis of maternal infection. Hum Immunol 2004654105
32 - S Abe, T Yamaguchi, S Usami, Application of deafness diagnostic screening panel based on deafness mutation/gene database using invader assay. Genet Test 20071133340
33 - Ramirez Inscoe JMNikolopoulos TP. Cochlear implantation in children deafened by cytomegalovirus: speech perception and speech intelligibility outcomes. Otol Neurotol 20042547982
34 - D. J Lee, L Lustig, M Sampson, J Chinnici, J. K Niparko, Effects of cytomegalovirus (CMV) related deafness on pediatric cochlear implant outcomes. Otolaryngol Head Neck Surg 20051339005
35 - B Pyman, P Blamey, Lacy P Clark G, Dowell R. The development of speech perception in children using cochlear implants: effects of etiologic factors and delayed milestones. Am J Otol 2000215761
36 - S Iwasaki, H Nakanishi, K Misawa, T Tanigawa, K Mizuta, Cochlear implant in children with asymptomatic congenital cytomegalovirus infection. Audiol Neurotol 20091414652
37 - V Malik, I. A Bruce, S. J Broomfield, L Henderson, K Green, R. T Ramsden, Outcome of cochlear implantation in asymptomatic congenital cytomegalovirus deafened children. Laryngoscope 201112117804
38 - M. G Michaels, D. P Greenberg, D. L Sabo, E. R Wald, Treatment of children with congenital cytomegalovirus infection with gancicolovir. Pediatr Infect Dis J 2003225049
39 - D. W Kimberlin, C. Y Lin, P. J Sanchez, G. J Demmler, W Dankner, M Shelton, et alEffect of ganciclovir therapy on hearing in symptomatic congenital cytomegalovirus disease involving the cebtral nervous system: a randomized, controlled trial. J Pediatr 200314346
40 - N Kitajima, N Sugaya, T Futatani, H Kanegane, C Suzuki, M Oshiro, et alGanciclovir therapy for congenital cytomegalovirus infection in six infants. Pediatr Infect Dis J 2005247825
41 - Meine Jansen CFToet MC, Rademaker CM, Ververs TH, Gerards LJ, van Loon AM. Treatment of symptomatic congenital cytomegalovirus infection with valganciclovir. J Perinat Med 2005333636
42 - A Lackner, A Acham, T Alborno, M Moser, H Engele, R. B Raggam, et alEffect on hearing of ganciclovir therapy for asymptomatic congenital cytomegalovirus infection: four to 10 year follow up. J Laryngol Otol 20091233926
43 - S Walter, C Atkinson, M Sharland, P Rice, E Raglan, V. C Emery, et alCongenital cytomegalovirus: association between dried blood spot viral load and hearing loss. Arch Dis Child Fetal Neonatal Ed 2008932805
44 - T Mizuno, S Sugiura, H Kimura, Y Ando, M Sone, Y Nishiyama, et alDetection of cytomegalovirus DNA in preserved umbilical cords from patients with sensorineural hearing loss. Eur Arch Otorhinolaryngol 20092663515
45 - A Boudewyns, F Declau, K Smets, D Ursi, F Eyskens, Van den Ende J, et al. Cytomegalovirus DNA detection in Guthrie cards: role in the giagnostic work-up of childhood hearing loss. Otol Neurotol 2009309439
46 - J. W Kimani, C. A Buchman, J. K Booker, B. Y Huang, M Castillo, C. M Powell, et alSeonsorineural hearing loss in a pediatric population: association of cobgenital cytomegalovirus infection with intracranial abnormalities. Arch Otolaryngol Head Neck Surg 20101369991004
47 - N Adachi, K Ito, H Sakata, T Yamasoba, Etiology and one-year follow-up results of hearing loss identified by screening of newborn hearing in Japan. Otolaryngol Head Neck Surg 201014397100